Afferent synaptogenesis between ectopic hair-cell-like cells and neurites of spiral ganglion induced by Atoh1 in mammals in vitro

Neuroscience 357 (2017) 185–196

AFFERENT SYNAPTOGENESIS BETWEEN ECTOPIC HAIR-CELL-LIKE CELLS AND NEURITES OF SPIRAL GANGLION INDUCED BY Atoh1 IN MAMMALS IN VITRO WEN-WEI LUO, a,b,c,dy RUI MA, b,c,dy XIANG CHENG, a,b,c,d XIAO-YU YANG, a,b,c,d ZHAO HAN, a,b,c,d DONG-DONG REN, a,b,c,d PING CHEN, e FANG-LU CHI a,b,c,d* AND JUAN-MEI YANG a,b,c,d*

endings of SGN-derived neurons adjacent to EHCLCs. PSD-95 was located directly opposite CtBP2-positive puncta in the terminals of branches of SGNs, demonstrating that the neurites of SGNs formed afferent-like synaptic connections with EHCLCs. However, the expression of glutamate receptor type 2 (GluR2) could not be detected in the terminals of branches of SGNs surrounding EHCLCs. In addition, we found that the presynaptic ribbon (CtBP2) formation in EHCLCs preceded neural innervation. Furthermore, CtBP2-positive puncta increased and then decreased in EHCLCs, similar to the changes observed in endogenous HCs in terms of their number and distribution. Our finding of the generation of cochlear afferent synapses between EHCLCs and original SGNs will lay the foundation for regenerative approaches to restoring hearing after hair cell loss. Ó 2017 Published by Elsevier Ltd on behalf of IBRO.

a Department of Otology and Skull Base Surgery, EYE & ENT Hospital of Fudan University, Shanghai 200031, PR China b

Shanghai Clinical Medical Center of Hearing Medicine, Shanghai 200031, PR China c Key Laboratory of Hearing Medicine, Ministry of Health, Shanghai, 200031 PR China d

Research Institute of Otolaryngology, Fudan University, Shanghai, 200031 PR China e Department of Cell Biology, Emory University, Atlanta, GA 30322, USA

Abstract—Newly formed ectopic hair-cell-like cells (EHCLCs) induced by overexpression of atonal homolog 1 (Atoh1) in vitro were found to possess features of endogenous hair cells (HCs) in previous reports and in the present study. However, limited information is available regarding whether EHCLCs and native spiral ganglion neurons (SGNs) form afferent synapses, which are important for the restoration of hearing. In the current study, we focused on the afferent synaptogenesis between EHCLCs and SGN-derived dendrites. Cochlear explants of auditory epithelia with native SGNs retained were cultured in vitro, and human adenovirus serotype 5 (Ad5) vectors encoding Atoh1 were used to overexpress Atoh1 and induce EHCLCs. We observed that the neurites of the original SGNs extended toward the lesser epithelial ridge (LER) and innervated the EHCLCs. Immunohistochemical analyses revealed the expression of presynaptic ribbon C-terminal-binding protein 2 (CtBP2) and postsynaptic density protein (PSD)-95 in the nerve

Key words: Atoh1, ectopic hair-cell-like cells (EHCLCs), lesser epithelial ridge (LER), C-terminal-binding protein (CtBP2), postsynaptic density protein 95 (PSD-95), afferent synaptogenesis.

INTRODUCTION In the mammalian organ of Corti, hair cells (HCs) and their associated synapses with afferent nerves are responsible for faithfully transmitting acoustic information from the inner ear to the brain (Keithley et al., 1989; Fuchs et al., 2003; Grant et al., 2011; Rutherford and Pangrsic, 2012; Safieddine et al., 2012). Presynaptic ribbons release neurotransmitters to the postsynaptic receptors on afferent neural boutons (Glowatzki and Fuchs, 2002; Fuchs et al., 2003; Fuchs, 2005; Khimich et al., 2005; Nouvian et al., 2006; Grant et al., 2011). Noise, ototoxic drugs, aging or diseases can cause permanent damage to the auditory system, leading to sensorineural hearing loss (Pujol and Puel, 1999; Knipper et al., 2000; Harding et al., 2002; Lee et al., 2003; Kujawa and Liberman, 2009; Shi et al., 2015a,b). Mammalian HCs or auditory neurons have minimal capacity to spontaneously recover from injury (Forge et al., 1993; Warchol et al., 1993; Starr et al., 1996; White et al., 2000; McFadden et al., 2004; Kujawa and Liberman, 2009). Thus, hearing loss is permanent in patients with damaged auditory neurons or HCs (Starr et al., 1996; White et al., 2000; McFadden et al., 2004; Kujawa and Liberman, 2009).

*Corresponding authors. Address: Eye & ENT Hospital of Fudan University, 83 Fenyang Road, Shanghai 200031, PR China. E-mail addresses: [email protected] (F.-l. Chi), yangjuanmei1982@ 126.com (J.-m. Yang). y These authors contributed equally to this work. Abbreviations: Ad5, human adenovirus serotype 5; AMPA receptor, a-amino-3-hydroxy-5-methyl- 4-isoxazolepropionic acid receptor; Atoh1, atonal homolog 1; CtBP2, C-terminal-binding protein 2; DVI, day after viral infection; EDTA, ethylenediaminetetraacetic acid; EGFP, enhanced green fluorescent protein; EHCLCs, ectopic hair-cell-like cells; GluR2, glutamate receptor type 2; HCLCs, hair-cell-like cells; HCs, hair cells; IHC, inner hair cell; LER, lesser epithelial ridge; MAGUK, membrane-associated guanylate kinase; Myo7a, myosin 7a; NF-200, neurofilament of 200 kDa; OHC, outer hair cell; P2, postnatal day two; PBS, phosphate-buffered saline; PSD, postsynaptic density; RT-PCR, real-time polymerase chain reaction; SE, sensory region; SEM, standard error of the mean; SGNs, spiral ganglion neurons; TuJ1, class III beta-tubulin. http://dx.doi.org/10.1016/j.neuroscience.2017.05.040 0306-4522/Ó 2017 Published by Elsevier Ltd on behalf of IBRO. 185

186

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

Over the past several decades, there have been tremendous advances in hair cell regeneration through interventions targeting the key genes involved. The basic helix-loop-helix transcription factor, atonal homolog 1 (Atoh1), plays a critical role in HC development and regeneration (Bermingham et al., 1999; Kawamoto et al., 2003; Woods et al., 2004; Kelly et al., 2012; Yang et al., 2012). Knocking out Atoh1 in mice results in the complete absence of HCs and SCs (Bermingham et al., 1999), while its ectopic overexpression in the greater epithelial ridge or lesser epithelial ridge (LER) of neonatal mice or rats induces the formation of hair-cell-like cells (HCLCs) (Zheng and Gao, 2000; Yang et al., 2012, 2013; Luo et al., 2014). Multiple studies have demonstrated that Atoh1-induced cochlear HCLCs assume morphological, molecular, and physiological characteristics similar to those of endogenous HCs (Kelly et al., 2012; Liu et al., 2012; Yang et al., 2012, 2015). Spiral ganglion fibers can extend toward HCLCs and surround them in Kӧlliker’s organ or the region of the LER in a manner similar to that of intrinsic HCs (Kelly et al., 2012; Yang et al., 2012). Though studies have identified the presynaptic ribbon component Cterminal-binding protein 2 (CtBP2) in new HCLCs in transgenic mice (Liu et al., 2014; Kuo et al., 2015), limited information is available regarding the afferent synaptogenesis between ectopic hair-cell-like cells (EHCLCs) and spiral ganglion neurons (SGNs), which is important for restoring hearing. In this study, we preserved SGNs in the auditory epithelia in vitro to determine whether afferent synaptogenesis occurred between the nerve endings of SGN-derived neurons and EHCLCs in the LER. Consistent with previous studies, SGNs sent out dendrites toward LER cells and contacted the EHCLCs induced by Atoh1 overexpression (Yang et al., 2012). We observed presynaptic ribbons and postsynaptic densities between EHCLCs and SGN-derived dendrites. We then demonstrated the existence of ectopic afferent synaptogenesis and the similarities and differences between the ectopic and original afferent synapses.

EXPERIMENTAL PROCEDURES Animals The care and use of animals were approved by the Institutional Animal Care and Use Committee of Fudan University. Sprague Dawley (SD) rats at postnatal days two, five, nine, and thirteen (P2, P5, P9 and P13) were used for the experiment. All of the animals were purchased from Slaccas Experimental Animal Company (Xuhui, Shanghai, China).

12 (DMEM/F12; Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen, USA) to ensure that the LER cells were fully stretched. The following day, the medium was replaced with serum-free DMEM/F12 containing B27 (Invitrogen, USA) and Ad5-EGFP/Ad5EGFP-Atoh1/Ad5-Atoh1 (Sinogene, China) at a final concentration of 0.8  108 PFU/ml for 20 h. The viruses used in this experiment were described in previous studies (Yang et al., 2012, 2013; Luo et al., 2014). Tissue preparation and immunofluorescent staining of cells The cultured explants were fixed with 4% paraformaldehyde (Electron Microscopy Science, Hatfield, Pennsylvania, USA, Cat#: 157-8) for 10 min at room temperature. Freshly dissected cochleae were fixed with 4% paraformaldehyde (Electron Microscopy Science, Cat#: 157-8) for 30 min on a shaker at room temperature. The fixed cochlear bones were decalcified in 10% EDTA for at least 24 h at 4 °C. Next, the tissues were subjected to three 10-min washes with phosphatebuffered saline (PBS). Then, the tissues were permeabilized with 0.3% Triton X-100 (Fisher BioReagents ChemAlert) in PBS for 1 h. The tissues were blocked with 0.1% Triton X-100 mixed with 15% donkey serum (Millipore, USA)/goat serum (Millipore) in PBS for 1 h. Then, the samples were incubated with the following primary antibodies overnight at 4 °C: mouse anti-myosin 7a (1:200, DSHB, Cat#: 138-1), rabbit antimyosin 7a (1:200, Proteus Biosciences, Cat#: 25-6790), chicken anti-NF-200 (1:2000, Millipore, Cat#: AB5539), mouse anti-TuJ1 (b-III tubulin, 1:500, Covance, Cat#: MMS-435P), mouse (IgG1) anti-CtBP2 (1:200, BD Transduction Labs, Cat#: 612044), mouse (IgG2a) antiPSD-95 (1:100, NeuroMab, Cat#: 73-028), and mouse anti-GluR2 (1:1000, Millipore, Cat#: MAB397). The tissue was rinsed 3–5 times in 0.1% Triton X-100 in PBS and then incubated with secondary antibodies for 1 h at room temperature in the dark. The secondary antibodies used were as follows: Alexa Fluor 488 donkey anti-rabbit/mouse, Rhodamine Red-Xconjugated donkey anti-rabbit/mouse/chicken, Alexa Fluor 647 donkey anti-rabbit/mouse/chicken, Alexa Fluor 488 goat anti-chicken (1:1000, Jackson ImmunoResearch Laboratories, Baltimore, Maryland, USA), Alexa Fluor 647 goat anti-mouse (IgG1) (1:1000, Molecular Probes, Waltham, Massachusetts, USA, Cat#: A21240), and Alexa Fluor 555 goat anti-mouse (IgG2a) (1:1000, Molecular Probes, Cat#: A21137). After three 10-min washes in PBS, the tissues were placed on glass microscope slides with a drop of fluorescent mounting medium (Electron Microscopy Sciences).

Sample dissection, tissue culture, and Atoh1 gene transfer

Image acquisition and evaluation

The cochlear explants were prepared as previously described (Yang et al., 2012, 2013; Luo et al., 2014). Only the middle turns of cochleae were used in this experiment. Cochlear explants with SGNs retained were cultured in Dulbecco’s Modified Eagle’s Medium/nutrient mixture F-

The specimens were visualized with a Leica SP8 confocal microscope (Leica, Germany). All of the images were digitally processed and evaluated using Adobe Photoshop CS5. Images were acquired with a pixel size of 0.03 mm  0.03 mm  0.30 mm following Nyquist

187

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

sampling, with no pixel saturation to ensure that no structural information was lost. The percentage of EHCLCs with CtBP2-positive puncta per 100 mm in the LER was quantified at the border between the LER and original along the length of the cochlea (Fig. 3C). We examined three random areas in each sample. Each group contained at least five different samples (Fig. 3C). To determine the number of CtBP2-positive puncta per EHCLC, at least 40 EHCLCs with CtBP2-positive puncta were counted manually per group at 3 days after viral infection (DVI), 5 DVI, 7 DVI and 11 DVI following Ad5-EGFP-Atoh1 infection (Fig. 4H). To determine the number of CtBP2-positive puncta per IHC or OHC, at least 30 IHCs and 60 OHCs were counted separately in the middle turns of P2, P5, P9 and P13 cochleae (Fig. 4I, J). To determine the number of CtBP2-positive puncta per innervated EHCLC (Fig. 5C), only EHCLCs contacted by SGN-derived neural boutons were counted. At least 5 innervated EHCLCs were counted in each group. To count the number of postsynaptic density protein (PSD)-95 positive puncta adjacent to innervated EHCLCs, at least 5 innervated EHCLCs were included in each group (Fig. 5D). To determine the number of CtBP2/PSD-95 complexes per innervated EHCLC and the percentage of PSD-95 juxtaposed with CtBP2, at least 10 innervated EHCLCs were counted in each group following Ad5-Atoh1 infection (Fig. 6C, D). To determine the number of glutamate receptor type 2 (GluR2)-positive puncta per IHC and the percentage of GluR2 juxtaposed with CtBP2 in IHCs, at least 20 IHCs were counted separately in the middle turns of P2, P5, P9 and P13 cochleae (Fig. 7H, I). Analysis of mRNA expression using reverse transcription polymerase chain reaction (RT-PCR) For RT-PCR analysis, sensory epithelia (SE) and LER tissues were harvested from each explant at 11 DVI following treatment with Ad5-EGFP (control) or Ad5EGFP-Atoh1. The SE and LER cells in the cultured explants were separated from the lateral edge of the outer HCs (OHCs) along the length of the auditory epithelia using the lateral edge of a syringe tip (Becton Dickinson, Franklin Lakes, New Jersey, U.S., Cat#: 328410). RNA from 2 to 3 explanted cochleae was purified with an RNeasy Plus Micro Extraction Kit (Qiagen, Hilden, Germany, Cat#: 74034) and reverse transcribed with a High Capacity RNA-to-cDNA kit (TaKaRa, Cat#: RR036A). PCR was conducted using an Applied Biosystems 7500 Real-time PCR System (Applied Biosystems, Foster City, CA, USA). The RTPCR consisted of 35 cycles as follows: denaturation for 30 s at 94 °C, annealing for 30 s at 57 °C, 30 s at 72 °C, and a final extension at 72 °C for 5 min. b-actin was used as an endogenous control. PCR products were subjected to electrophoresis on a 2.5% agarose gel (Sangon Biotech Co., Ltd., Shanghai, China) containing ethidium bromide and visualized under ultraviolet light. The following primer pairs were designed using Primer3 software: b-actin (F) agggtgtgatggtgggtatg; (R) ggtgacaatgccgtgttcaa, product size 110 bp; and GluR2

(F) ttcgccaagatccctctctg; product size 136 bp.

(R)

agcactttcgatgggagaca,

Statistics Statistical analyses were conducted using Microsoft Excel and GraphPad Prism 6.0 (GraphPad Software, USA). All data were analyzed using unpaired two-tailed Student’s ttests. All data are presented as the mean ± standard error of the mean (SEM). P < 0.05 was considered significant.

RESULTS Pre- and post-synaptic components in the afferent synapses of the cochleae of newborn rats Afferent synapses are characterized by the presence of both presynaptic ribbons in the HCs and PSD in the neurites of SGNs (Fuchs et al., 2003; Khimich et al., 2005; Keen and Hudspeth, 2006). We performed immunohistochemistry to identify presynaptic and/or postsynaptic markers in the auditory epithelia of P2 rats (Fig. 1). SGN-derived fibers were stained with an antibody against neurofilament of 200 kDa (NF-200). HC ribbon synapses were labeled with an antibody against CtBP2, a specific presynaptic protein found in the ribbon synapse (Khimich et al., 2005; Nouvian et al., 2006). The presynaptic HC ribbons were detected in the basal-lateral aspects of the inner HCs (IHCs) in the organ of Corti (Fig. 1A). PSD-95, a membrane-associated guanylate kinase (MAGUK) scaffolding protein, was mostly seen at the end of the SGN-derived neurites innervating IHCs (Flores-Otero et al., 2007; Grant et al., 2011). PSD-95positive puncta in the terminal of SGN-derived neurites were adjacent to CtBP2-positive puncta in HCs (Fig. 1A, A0 ). We also immunostained the P2 rat cochleae with an antibody against AMPA-type glutamate receptors that recognizes GluR2 subunits (renamed GluA2) (Collingridge et al., 2009). GluR2-positive puncta were adjacent to CtBP2-positive synaptic ribbons located in the basolateral region of the IHCs (Fig. 1B, B0 ). In contrast, no GluR2-positive puncta were visible in the OHC area (Fig. 1B, B0 ). SGNs send out neurites that contact the Atoh1induced EHCLCs in the LER Cochlear explants containing retained SGNs were cultured and transfected with Ad5-EGFP, Ad5-EGFPAtoh1, or Ad5-Atoh1 to determine whether the neurites of SGN could send out fibers toward EHCLCs (Fig. 2A– A0 ). Consistent with previous studies (Yang et al., 2012, 2013; Luo et al., 2014), the cultured cochleae were fully stretched (Fig. 2A). Following infection with Ad5-EGFPAtoh1 or Ad-EGFP, the LER cells showed robust enhanced green fluorescent protein (EGFP) fluorescence (Fig. 2A0 –C). No myosin 7a (Myo7a)-positive cells were observed in the control group (Fig. 2B). Ad5-EGFPAtoh1 infection led to the induction of Myo7a-positive EHCLCs in the LER (Fig. 2C).

188

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

Formation of presynaptic ribbon synaptic puncta in EHCLCs precedes neural innervation

Fig. 1. Pre- and post-synaptic components in the afferent synapses of P2 rat cochleae. (A) Triple staining of NF-200 (blue), CtBP2 (green), and PSD-95 (red) in the middle turn of P2 rat cochlea. NF-200-labeled neural fibers of SGNs (blue). CtBP2-labeled ribbon puncta (green). The cell nuclei were CtBP2 positive. PSD-95-labeled postsynaptic densities (red); (A0 ) Enlarged view of the white box shown in panel A. The merged view of CtBP2 (green) and PSD-95 (red) shows that PSD-95positive puncta (red) were directly apposed to the CtBP2-positive puncta (green) in IHCs. (B) Triple staining of NF-200 (green), CtBP2 (blue), and GluR2 (red) in the middle turn of P2 rat cochlea. NF-200-labeled neural fibers of SGNs (green). CtBP2-labeled ribbon puncta (blue). GluR2 punctalabeled postsynaptic components (red). (B0 ) The merged view of CtBP2 (blue) and GluR2 (red) shows that GluR2-positive puncta (red) were apposed to the CtBP2-positive puncta (blue) in IHCs. GluR2 (red) was not detected in the OHC region. Scale bars = 10 mm in A; 10 lm in B.

Seven days after Ad5-EGFP-Atoh1 infection, the SGNs preferentially grew into LER cells (Fig. 2B, C) with SGN-derived neurites extending toward the EHCLCs (Fig. 2C–C00 ), which was consistent with the results from previous studies (Yang et al., 2012). Class III betatubulin (TuJ1) staining clearly showed that SGN-derived neurites elongated and surrounded EHCLCs in the LER (Fig. 2B, C–C00 ). The neural processes grew along the LER cells and branched to contact several EHCLCs (Fig. 2C–C00 ), resembling the type II SGN fibers that innervate OHCs (White et al., 2000). As observed under high magnification, SGN-derived neurites contacted and surrounded EHCLCs (Fig. 2C0 –C00 ), suggesting that neural synaptic connections might have been established between EHCLCs and SGN-derived neurites in the LER.

The presence of presynaptic proteins in EHCLCs was evaluated using an antibody against CtBP2. Immunohistochemistry for CtBP2positive puncta indicated the presence of synaptic ribbon in the HCs. HC nuclei in LER cells were also positive for CtBP2 (Fig. 3A, B). However, no CtBP2-positive puncta were found in the LER cells in the control group (Fig. 3A0 ). We then triple labeled SGNs with NF-200, presynaptic ribbons with CtBP2, and EHCLCs with Myo7a (Fig. 3B). In a representative cochlear explant 7 days after Ad5-Atoh1 infection (Fig. 3B), CtBP2-positive puncta were detected in some EHCLCs that were not innervated by SGN-derived neurites, demonstrating that the formation of presynaptic ribbons was independent of neural innervation (Fig. 3B0 ). We quantified the percentage of EHCLCs with CtBP2-positive puncta from 3 to 11 days after Ad5-Atoh1 infection (Fig. 3C). The percentage of EHCLCs with CtBP2-positive puncta per 100 mm along the LER was 13.40 ± 11.06% at 3 DVI (n = 6), which significantly increased to 39.23 ± 5.84% at 5 DVI (p < 0.01, n = 6), 63.26 ± 8.93% at 7 DVI (p < 0.01, n = 8), and 84.18 ± 10.11% at 11 DVI (p < 0.01, n = 10) (Fig. 3C). This finding suggested that the proportion of EHCLCs with CtBP2-positive puncta increased over time.

Dynamic changes in the number and distribution of presynaptic ribbon puncta in EHCLCs were similar to those in endogenous HCs CtBP2-positive puncta were observed in EHCLCs as early as three days after Ad5-Atoh1 infection (Fig. 4A), before the innervation of EHCLCs by SGNs at approximately 7 days after Ad5-Atoh1 infection. We counted the numbers of CtBP2-positive puncta at various time points after Ad5-EGFP-Atoh1 infection (Fig. 4A–D, H). The mean numbers of presynaptic CtBP2-positive puncta per EHCLC were 2.13 ± 1.36 (n = 40), 7.91 ± 2.35 (n = 40), 25.16 ± 9.61 (n = 42), and 9.57 ± 2.73 (n = 45) at 3, 5, 7, and 11 DVI, respectively (Fig. 4H). Overall, the number of CtBP2positive puncta in the EHCLCs increased significantly from 3 to 5 DVI (p < 0.001) and from 5 to 7 DVI

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

Fig. 2. SGNs extended neurites that surrounded the EHCLCs induced by Atoh1 in the LER. (A) A P2 rat cochlear explant was cultured for 24 h in vitro. SGNs were retained. LER cells were fully stretched (white bracket). (A0 ) Most LER cells were EGFP-positive at 24 h after Ad5-EGFP-Atoh1 infection. (B) Seven days after Ad5-EGFP infection (control group), there were no Myo7a-positive cells (red) in the LER. SGNs sent out neurites expressing TuJ1 (blue) to the LER. (C) Seven days after Ad5-EGFP-Atoh1 infection, numerous Myo7a-positive cells (red) were observed in the LER. SGNs sent out neurites (blue) that surrounded EHCLCs (red). (C0 ) Magnified view of the white box shown in panel C depicting SGN-derived neurites (blue) surrounding the EHCLCs (red) (short arrows). (C00 ) x-z-axial view of the EHCLCs indicated by short arrows in panel C0 . EHCLCs (red) were innervated by SGN-derived neurites (blue). Scale bars = 50 lm in A; 20 lm in A0 ; 100 lm in B; 50 lm in C.

(p < 0.001), followed by a significant decrease from 7 to 11 DVI (p < 0.001) (Fig. 4H). The peak of CtBP2positive puncta occurred at 7 DVI (Fig. 4H), unlike those in IHCs and OHCs (Fig. 4E-G, I-J). The total number of CtBP2-positive puncta per IHC increased significantly from P2 to P5 (17.0 ± 3.3 vs. 25.0 ± 4.8 per IHC, p < 0.001, n = 31 and 30, respectively) and from P5 to P9 (25.0 ± 4.8 vs. 32.0 ± 3.9 per IHC, p < 0.001, n = 30 and 33, respectively), followed by a significant decrease from P9 to P13 (32.0 ± 3.9 vs. 23.0 ± 2.8 per IHC, p < 0.001, n = 33 and 30, respectively) (Fig. 4E– G, I). The mean numbers of CtBP2 puncta per OHC were 3.0 ± 1.1 (n = 61), 9.0 ± 2.1 (n = 62), 5.0 ± 1.8 (n = 60), and 2.0 ± 1.0 (n = 60) in the middle turns of P2, P5, P9, and P13 rat cochleae, respectively (Fig. 4E– G, J). The mean number of CtBP2 puncta per OHC increased significantly from P2 to P5 (p < 0.001) and decreased drastically from P5 to P9 (p < 0.001) and from P9 to P13 (p < 0.001) (Fig. 4E–G, J). The peak of CtBP2-positive puncta occurred at P9 in IHCs (Fig. 4I) and at P5 in OHCs (Fig. 4J). We also assessed the distribution of the synaptic ribbons in EHCLCs and original HCs (Fig. 4A–G). The majority of CtBP2-positive puncta in EHCLCs were initially scattered throughout the cells from 3 to 5 DVI

189

(Fig. 4A, B) and gradually accumulated in the cytomembrane from 5 to 11 DVI (Fig. 4C, D). By 11 DVI, the CtBP2-positive puncta were localized to the basolateral region in nearly 60% of EHCLCs. However, in nearly 40% of EHCLCs, CtBP2-positive puncta were distributed throughout the cytomembrane, with a few ribbons scattered throughout the EHCLCs at 11 DVI (Fig. 4D). In IHCs, the majority of the CtBP2-positive puncta were localized to the basolateral region of the IHCs in P2, P5, P9 and P13 rat cochleae (Fig. 4E–G). In OHCs, clusters of CtBP2-positive puncta were primarily found in the basolateral region of the OHCs from P2 to P9. At P13, the basolateral distribution changed markedly, and the majority of the CtBP2-positive puncta in OHCs moved away from the basolateral region into the cytoplasm (Fig. 4E– G). Only a small fraction of CtBP2positive puncta remained in the basolateral region after this time (Fig. 4E–G). Ectopic afferent synaptogenesis between EHCLCs and SGN neurites

To examine the ectopic afferent synaptogenesis between SGN neurites and EHCLCs, triple staining was performed for CtBP2, NF-200, and Myo7a (Fig. 5A) or for PSD-95, NF-200, and Myo7a (Fig. 5B). Immunohistochemical analyses revealed the presence of CtBP2-positive puncta in the EHCLCs adjacent to the nerve endings of SGN-derived neurons (Fig. 5A0 –A00 ). PSD-95 expression was observed in the neurites of SGN-derived neurons that elongated toward EHCLCs (Fig. 5B–B00 ). No PSD-95 staining was observed in the terminals of SGN neurites if they did not innervate EHCLCs. The mean number of CtBP2-positive puncta per innervated EHCLC was 14.25 ± 2.16 at 7 DVI (n = 6), which decreased significantly to 7.33 ± 2.49 at 11 DVI (p < 0.001, n = 9) (Fig. 5C). PSD-95positive puncta that were adjacent to EHCLCs became visible at 7 DVI (2.5 ± 0.47 per adjacent EHCLC, n = 5). By 11 DVI, significantly more PSD-95 puncta were observed (7.0 ± 2.36 per adjacent EHCLC, p < 0.01, n = 6) (Fig. 5D). Triple staining revealed that the PSD-95 puncta in the endings of SGN-derived neurites were juxtaposed with CtBP2-positive puncta in EHCLCs (Fig. 6A, B), similar to the afferent synapses observed in endogenous HCs (Fig. 1A–C). These results demonstrated the establishment of afferent synaptic connections between EHCLCs and the neurites of SGNs. Afferent

190

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

either group (Fig. 7G). These results indicate that no GluR2 transcription occurred in the SGN-derived neurites that innervated EHCLCs. We also assessed the number and distribution of GluR2-positive puncta in the original IHCs and OHCs in the middle turns of cochleae (Fig. 7E, F, H, I). GluR2positive puncta were detected in the IHCs of P2, P5, P9 and P13 rat cochleae (Fig. 7E, F). The mean numbers of GluR2 puncta per IHC were 53.2 ± 6.58 (n = 20), 52.8 ± 7.47 (n = 20), 38.2 ± 5.19 (n = 22), and 35.6 ± 3.01 (n = 21) in the middle turns of P2, P5, P9 and P13 rat cochleae, respectively (Fig. 7H). The number of GluR2positive puncta per IHC decreased drastically from P5 to P9 (p < 0.01) Fig. 3. Formation of the presynaptic ribbon in EHCLC precedes neural innervation. (A) A cochlear explant was cultured for 7 days after Ad5-EGFP (control) infection. (A0 ) Enlarged views of the LER and remained stable from P9 to P13 cells in the white box shown in panel A. The nuclei of LER cells were positive for CtBP2 (red). (Fig. 7H). The percentage of GluR2Neither Myo7a-positive EHCLCs (blue) nor CtBP2-positive puncta (red) were detected in the LER. positive puncta juxtaposed with (B) A cochlear explant was cultured for 7 days following Ad5-Atoh1 infection. The explant was triple CtBP2-positive puncta per IHC was stained with Myo7a (green), CtBP2 (red), and NF-200 (blue). NF-200-positive SGNs (blue) failed to send out neurites toward the Myo7a-positive EHCLCs (green) in the LER. (B0 ) Magnified views of 53.89 ± 9.41% (n = 20) at P2, and the white box shown in panel B. CtBP2-positive puncta (red) were detected in the Myo7a-positive this fraction increased to 58.62 EHCLCs (green) in the LER. (C) Quantification of the percentage of EHCLCs with CtBP2 puncta ± 6.10% (n = 20) at P5, 45.27 per 100 mm along the LER at 3 to 11 days after Ad5-Atoh1 infection. The data in C are presented ** ± 8.29% (n = 22) at P9, and 43.52 as mean ± SEM. p < 0.01. Scale bars = 100 lm in A; 100 lm in B. ± 8.69% (n = 21) at P13 in the middle turns of rat cochleae (Fig. 7I). The percentage of GluR2-positive synaptogenesis was observed as early as 7 DVI (Fig. 6C). puncta juxtaposed with CtBP2 per The mean number of CtBP2/PSD-95 complexes per IHC decreased significantly from P5 to P9 (p < 0.01) innervated EHCLC was 2.2 ± 0.75 at 7 DVI (n = 10). At (Fig. 7I). 11 DVI, significantly more CtBP2/PSD-95 complexes GluR2-positive puncta were not detected in the OHCs were detected (7.8 ± 1.6 per innervated EHCLC, of P2 and P5 rat cochleae but were visible in the OHCs of p < 0.001, n = 12) (Fig. 6C). The percentage of PSDP9 and P13 rat cochleae, where they were not juxtaposed 95 juxtaposed with CtBP2 was 21.21 ± 3.21% at 7 DVI with CtBP2-positive puncta (Figs. 1B–B0 and 7E, F). (n = 10), and this fraction increased to 83.68 ± 8.55% at 11 DVI (p < 0.001, n = 12) (Fig. 6D).

DISCUSSION GluR2 was absent in the terminals of SGN neurites that innervated EHCLCs To further demonstrate the afferent synaptogenesis between EHCLCs and SGNs, we examined AMPA-type glutamate receptors in the innervation sites between SGNs and EHCLCs by triple staining with Myo7a, NF200, and GluR2 (Fig. 7A). The SGNs projected neural processes toward and surrounded several EHCLCs in the LER (Fig. 7A–A00 ). A higher-magnification view (Fig. 7B–D) showed the points of contact between SGN processes and EHCLCs, and terminal neural boutons formed around EHCLCs (Fig. 7C, D). However, the terminals of SGN neurites that innervated EHCLCs were GluR2 negative (Fig. 7A–D). RT-PCR was used to detect the mRNA expression of GluR2 in cultured SE and LER cells after treatment with Ad5-EGFP (control) or Ad5-EGFP-Atoh1 (Fig. 7G). GluR2-positive bands were detected in the SE tissues in both groups. However, no band was observed in the LER tissues of

The present study showed that SGNs can extend their neurites and innervate the EHCLCs induced by Atoh1 overexpression in vitro. Afferent synaptogenesis between EHCLCs and SGNs was demonstrated by a series of immunofluorescent staining results. Presynaptic CtBP2-positive puncta were observed in EHCLCs and were juxtaposed with PSD-95-positive puncta in the terminals of SGN neurites that innervated EHCLCs. Formation of presynaptic ribbon CtBP2positive puncta occurred in the EHCLCs as early as 3 days after Ad5-EGFP-Atoh1 infection. formation of these puncta preceded and was independent of SGN innervation. Meanwhile, the number and distribution of presynaptic ribbon CtBP2-positive puncta in EHCLCs changed over time, resembling the changes in ribbon puncta observed in endogenous IHCs and OHCs. However, GluR2, a specific postsynaptic marker for IHCs, was not detected in the terminals of SGN neurites that innervated EHCLCs. Our study presents the

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

191

Fig. 4. Dynamic changes in the number and distribution of presynaptic CtBP2-positive puncta in EHCLCs and endogenous HCs. (A–D) Double staining for Myo7a (blue) and CtBP2 (red) after Ad5-EGFP-Atoh1 infection. CtBP2-positive puncta (red) were observed in the Myo7a-positive EHCLCs (blue) at various time points after Ad5-EGFP-Atoh1 infection. (E) Triple staining for Myo7a (blue), CtBP2 (green) and NF-200 (red) in the middle turns of P2, P5, P9 and P13 rat cochleae. (F) CtBP2-positive puncta were observed in the OHCs and IHCs of P2, P5, P9 and P13 rat cochleae. (G) Magnified views of white boxes in F show the CtBP2-positive puncta in IHCs and OHCs. (H) Quantification of the presynaptic CtBP2positive puncta per EHCLC at 3–11 days following Ad5-EGFP-Atoh1 infection. (I, J) Quantification of the presynaptic CtBP2-positive puncta per IHC (I) and OHC (J) in the middle turns of P2, P5, P9 and P13 rat cochleae. The data in H, J are presented as mean ± SEM. ***p < 0.001. Scale bars = 20 lm in A-D; 10 lm in A0 –D0 ; 20 lm in E.

establishment of synaptic connections between EHCLCs and SGNs via viral transfection of in vitro immature cochlear explants for the first time. Previous studies have demonstrated that Atoh1 can induce the development of HCs with features of intrinsic HCs in mammals (Kelly et al., 2012; Liu et al., 2012; Yang et al., 2012, 2015). In addition, HCLCs in Ko¨lliker’s organ or the LER also attract neuronal fibers from SGNs to contact them (Kelly et al., 2012; Yang et al., 2012). Some studies have demonstrated synaptic components such as CtBP2 in HCLCs (Liu et al., 2014; Kuo et al., 2015). Whether the SGNs in the auditory epithelium can

make synaptic connections with newly formed EHCLCs and how this process occurs have been insufficiently investigated. To address these questions, we established an explant culture model in which SGNs were well maintained (Fig. 2A). SGNs are bipolar auditory primary neurons that make synaptic connections with auditory HCs (Keithley et al., 1989; White et al., 2000; Fuchs et al., 2003) and that can extend neurites toward the LER (Fig. 2B, C) and form neural connections with EHCLCs in vitro (Fig. 2C) (Yang et al., 2012). The LER was fully stretched and infected with Atoh1 to induce EHCLCs (Fig. 2), similar to previous reports (Yang et al., 2012,

192

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

the active zone of the ribbon synapse (Keen and Hudspeth, 2006; FloresOtero et al., 2007; Grant et al., 2011). Presynaptic ribbons at the basolateral membrane of HCs directly face the postsynaptic densities on afferent fibers and are responsible for releasing neurotransmitters into the synaptic cleft and inducing fast excitatory postsynaptic currents in afferent fibers (Glowatzki and Fuchs, 2002; Fuchs, 2005; Khimich et al., 2005; Nouvian et al., 2006; Safieddine et al., 2012). The presence of both CtBP2-positive puncta and PSD-95-positive puncta (Fig. 6A, B) indicated that afferent synaptic connections had formed between the EHCLCs and SGNs in the LER. In the current study, CtBP2positive puncta were observed in EHCLCs that were not innervated by SGN fibers (Fig. 3B). In addition, the appearance of afferent presynaptic ribbons (CtBP2) in EHCLCs was detected as early as 3 days after Ad5-EGFP-Atoh1 infection in the Fig. 5. Pre- and post-synaptic components in the ectopic afferent synapses in the LER. (A) The auditory epithelium of a P2 rat was cultured for 7 days following Ad5-Atoh1 infection. The explant LER (Fig. 4A), almost simultaneously was triple stained with Myo7a (blue), CtBP2 (green), and NF-200 (red). (A0 ) Magnified view of the with the formation of EHCLCs (Luo white box shown in A in the LER. Presynaptic CtBP2-positive puncta (green) were observed et al., 2014). At this time point, SGN00 between the contact site of EHCLC (blue) and SGN-derived neurites (red). (A ) Representative derived neurites did not contact the views from panel A0 show the CtBP2-positive puncta (green) in an EHCLC (blue) innervated by SGN-derived neurites (red) (long arrows). (B) A P2 rat cochlear explant was cultured for 11 days EHCLCs. These results demonstrated following Ad5-Atoh1 infection; the explant was triple stained for Myo7a (blue), NF-200 (red), and that the formation of presynaptic PSD-95 (green). (B0 ) Magnified view of the white box shown in B in the LER. Postsynaptic PSDCtBP2-positive puncta was indepen95-positive puncta (green) were observed between SGN-derived neurites (red) and the innervated dent of and preceded the SGN innerEHCLC (blue); (B00 ) Representative views from panel B show that the PSD-95-positive puncta vation of EHCLCs. In intrinsic HC (green) in the contact sites of SGN-derived neurites (red) innervated EHCLCs (blue) (short arrows). (C-D) Quantification of the CtBP2-positive puncta per innervated EHCLC (C) and PSDafferent synaptogenesis, the postsy95-positive puncta adjacent to innervated EHCLCs (D) at 5, 7 and 11 DVI after Ad5-Atoh1 naptic density appears later than the ** *** infection. The data in C and D are presented as mean ± SEM. p < 0.01, p < 0.001. Scale presynaptic densities (Safieddine et al., bars = 100 lm in A and B; 10 lm in A0 and B0 ; 5 lm in A00 and B00 . 2012). Our results show that the formation of afferent presynaptic ribbons in EHCLCs was similar to that in the 2013; Luo et al., 2014). Preserving original SGNs in audiinherent HC afferent synaptogenesis. tory epithelia provides an ideal system in which to explore In our previous study, the EHCLCs underwent a afferent synaptogenesis (Fig. 2). developmental process (Yang et al., 2012). In the In normal cochleae, afferent synaptic connections at present results, the percentage of EHCLCs with CtBP2the base of HCs are characterized by the presence of positive puncta increased over time after Ad5-Atoh1 synaptic ribbons in the HCs; these ribbons are infection (Fig. 3C). In addition, in the present study, juxtaposed with the postsynaptic membrane density at presynaptic CtBP2-positive puncta in EHCLCs showed the terminal neural boutons of SGNs (Fuchs et al., marked changes in terms of their numbers and distribu2003; Khimich et al., 2005; Keen and Hudspeth, 2006; tion as the HCs developed (Fig. 4). The number of Flores-Otero et al., 2007; Tong et al., 2013). In the preCtBP2-positive puncta per EHCLC increased significantly sent study, the CtBP2-positive puncta in the EHCLCs (p < 0.001) between 3 and 5 DVI and between 5 and indicated the presence of presynaptic ribbons in the basal 7 DVI and decreased from 7 to 11 DVI (p < 0.001) poles of HCs (Figs. 3B, 4A–D). Similar to endogenous (Fig. 4H). The changes in the number of CtBP2-positive afferent synapses (Sobkowicz and Slapnick, 1992), puncta resembled those seen in IHCs and OHCs, in presynaptic CtBP2-positive puncta are adjacent to PSDwhich the number first increases, then decreases, and 95-positive puncta, which are located in the SGNstabilizes around the onset of hearing (Sobkowicz derived nerve endings that surround EHCLCs (Fig. 6A, et al., 1986; Roux et al., 2009; Huang et al., 2012). B). PSD-95, a MAGUK scaffolding protein, was located The peak of CtBP2-positive puncta in EHCLCs directly adjacent to the postsynaptic membrane facing occurred at 7 DVI (Fig. 4H), unlike that of IHCs or OHCs

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

193

at E18 in mice and then migrate to the basolateral region until adult in IHCs (Sobkowicz et al., 1986; Huang et al., 2012). In mouse OHCs, CtBP2-positive puncta first disperse at E18, migrate to the basolateral region from P0 to P6, and then disperse throughout the cytomembrane again from P6 to adulthood; this phenomenon is due to the transient innervation of OHCs by type I SGN-derived neurites from P0 to P6 (Huang et al., 2012). When type I SGN neurites retracted, CtBP2-positive puncta in OHCs moved away from the basolateral region into the cytoplasm (Huang et al., 2012). The following explanations could account for our finding that 40% of EHCLCs at 11 DVI remained dispersed throughout the cytomembrane instead of being concentrated in the basolateral region. One explanation is that the 40% of EHCLCs with CtBP2 puncta throughout the cytomembrane are not as mature as the 60% of EHCLCs with CtBP2 puncta only in the basolateral region. Atoh1 expression level defines the fate and formation time of EHCLCs, and higher Atoh1 expression levels lead to faster EHCLC formation (Luo et al., 2014). Atoh1 expression levels varied among LER cells. Thus, some EHCLCs were less mature than others, even at the same time point after Ad5-Atoh1 infection (Luo et al., 2014); thus, the CtBP2 in Fig. 6. Ectopic afferent synaptogenesis between EHCLCs and the terminals of SGN neurites. (A) those immature EHCLCs was scatA P2 rat cochlear explant was cultured for 11 days after Ad5-Atoh1 infection. The explant was tered and dispersed. This phetriple stained for CtBP2 (blue), NF-200 (green), and PSD-95 (red). (A0 ) Magnified view of the white nomenon could also be due to the box shown in panel A. CtBP2-positive puncta (blue) in EHCLCs were juxtaposed with PSD-95resemblance between EHCLCs and 0 positive puncta (red) in the terminal of SGN neurites. (B) Separate views of A . (C, D) OHCs. The CtBP2-positive puncta in Quantification of the CtBP2/PSD-95 complexes per innervated EHCLC in the LER (C) and the percentage of PSD-95 juxtaposed with CtBP2 at the contact sites between EHCLCs and SGNs (D) endogenous OHCs moved away from at 5, 7 and 11 days after Ad5-Atoh1 infection. The data in C and D are presented as mean ± SEM. the basolateral region into the cyto*** 0 p < 0.001. Scale bars = 100 lm in A; 20 lm in A . plasm again when the cells matured with age, according to the present results and our previous study (Fig. 4) (Huang et al., 2012). (Fig. 4I-J). In rat cochleae, the peak of CtBP2-positive In addition, PSD-95-positive puncta appeared puncta occurred at P9 in IHCs (Fig. 4I) and at P5 in alongside the sites of connection between EHCLCs and OHCs (Fig. 4J). innervating neurites (Fig. 5B). PSD-95 staining was The CtBP2-positive puncta in most EHCLCs were absent if the neurites failed to innervate EHCLCs, initially scattered throughout the cells, but at 11 DVI, suggesting that unlike the expression of CtBP2-positive they were localized to the basolateral region in nearly puncta (Fig. 3), PSD-95 expression in the SGN-derived 60% of EHCLCs (Fig. 4A–D). However, nearly 40% of neurites is dependent on neural innervation of EHCLCs. EHCLCs at 11 DVI still showed CtBP2-positive puncta PSD-95-positive puncta also showed dynamic changes dispersed throughout the cytomembrane, not in the in their numbers, being detected occasionally at 7 DVI basolateral region. The change in the distribution of and showing a significant increase from 7 to 11 DVI CtBP2-positive puncta possessed similarities to and (p < 0.01) (Fig. 5D). differences from that seen in endogenous IHCs and Excitatory neurotransmission at postsynaptic afferent OHCs (Fig. 4E, F). According to previous reports and fibers is primarily mediated by AMPA-type glutamate the present study, CtBP2-positive puncta first disperse

194

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

Fig. 7. GluR2 was not detected in the afferent synapses between EHCLCs and the neurites of SGNs. (A) A P2 rat cochlear explant was cultured for 11 days after Ad5-Atoh1 infection. The explant was triple stained for Myo7a (blue), NF-200 (green) and GluR2 (red). (A0 , A00 ) Magnified views of the white box shown in panel A. SGN-derived neurites (green) surrounded and innervated the Myo7a-positive EHCLCs (blue). No GluR2-positive puncta (red) were detected in the LER. (B-D) Magnified views of EHCLCs indicated by short arrows in panel A0 . Neural boutons between SGNderived neurites (green) and EHCLCs (blue) were observed. GluR2 (red) was not detected in the contact sites. (E) Double staining for CtBP2 (green) and GluR2 (red) in the middle turns of P2, P5, P9 and P13 rat cochleae. (F) Magnified views from the white boxes in panel E show the GluR2- (red) and CtBP2-positive (green) puncta in the IHCs or OHCs of P2, P5, P9 and P13 rat cochleae. GluR2-positive puncta (red) were detected in the IHC region and were juxtaposed with the CtBP2-positive puncta (green) in P2, P5, P9 and P13 rat cochleae. GluR2-positive puncta (red) were observed in the OHCs of P9 and P13 rat cochleae and were not juxtaposed with CtBP2 puncta (green). (G) The RT-PCR results showed that GluR2 transcript was detected in the cells of the SE region but not in the LER at 11 days after infection with Ad5-EGFP (control) or Ad5-EGFPAtoh1 (Atoh1). Β-Actin served as a housekeeping gene control in the RT-PCR experiments. SE and LER tissues were harvested at 11 DVI. (H-I) Quantification of the GluR2 puncta per IHC (H) and the percentage of GluR2 juxtaposed with CtBP2 in the IHC (I) in the middle turns of P2, P5, P9 and P13 rat cochleae. The data in H and I are presented as mean ± SEM. **p < 0.01. Scale bars = 100 lm in A; 10 lm in E.

receptors (Ruel et al., 1999, 2000), which are restricted in IHCs (Liberman et al., 2011). In our data, GluR2 staining was juxtaposed with CtBP2-positive puncta in the IHCs of P2, P5, P9 and P13 rat cochleae (Figs. 1B–B0 , 7E, F). In the OHCs, GluR2 was detected in P9 and P13 rat cochleae, in which it was not juxtaposed with CtBP2positive puncta (Fig. 7E, F). However, no glutamate receptors were found in the terminals of SGN-derived neurites that innervated EHCLCs at 11 DVI, which was the latest time point we examined (Fig. 7A–D). Our RTPCR results further confirmed that afferent synaptogene-

sis between EHCLCs and SGNs did not involve GluR2 expression (Fig. 7G). A previous study reported that the postsynaptic marker GluR2 was observed in newly formed HCLCs in the IHC region of P21 transgenic mice (Kuo et al., 2015). However, another study reported that GluR2 signals were absent in newly formed HCLCs of P22 mice (Liu et al., 2014). The HCLCs were likely not mature enough and did not express AMPA receptors at the time points examined (Liu et al., 2014). Another possibility is that EHCLCs resemble OHCs and do not express GluR2. In addition, we observed that the fibers

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

derived from SGNs branched and attached to several EHCLCs, which is similar to the innervation pattern of type II neurons into OHCs (Weisz et al., 2009, 2012). In our previous study, we found that based on patch clamp results, ectopic HCs possessed features similar to those of developing IHCs, OHCs or vestibular HCs (Yang et al., 2012). Thus, both the cell type of the EHCLCs and the types of neurons that innervate EHCLCs merit further exploration in a future study.

CONCLUSION The present study illustrated the ectopic afferent synaptogenesis between EHCLCs and neurites of SGNs in neonatal rat cochlea in vitro, which is promising for hearing restoration via hair cell regeneration. Presynaptic CtBP2 puncta were observed in EHCLCs, and these puncta were juxtaposed with PSD-95 in the terminals of SGN neurites that innervated the EHCLCs. The number and distribution of presynaptic CtBP2positive puncta in EHCLCs changed over time, similar to the case in developing IHCs and OHCs. GluR2 is a specific postsynaptic marker for IHCs; however, GluR2 was not detected in the terminals of SGN neurites that innervated EHCLCs. Ectopic afferent synapses between EHCLCs and SGNs appear to represent a developmental process and resemble the synapses between OHCs and type II SGNs. In future experiments, assessing the cell type of EHCLCs and the type of SGNs that innervated EHCLCs would be of great interest. In addition, we need to determine the refined structure of regenerated afferent-like synapses with a transmission electron microscope. Another topic worth exploring is the physiological properties of the ectopic afferent synapses in the LER. A better understanding of newly formed synapses will be valuable for inducing the formation of mature functional synapses, which is pivotal for the restoration of hearing. Acknowledgments—This study was supported by the National Natural Science Foundation of China (NSFC) grant numbers: 81420108010, 81271084 to F.C.; and the Key Project of Chinese National Programs (2016YFC0905200): 81370022, 81570920, 81000413 to D.R.; 81200740 to J.Y.; 81200738 to N.C.; 81371093 to Z.H.; and 81400460 to Z.G. The 973 Program (grant numbers: 2011CB504500 and 2011CB504506) also supported this study. The Innovation Project of Shanghai Municipal Science and Technology Commission (grant number: 11411952300) funded F.C., and the Training Program of the Excellent Young Talents of the Shanghai Municipal Health System (grant number: XYQ2013084) funded D.R. The ‘‘Zhuo-Xue Plan” of Fudan University also funded D.R.

REFERENCES Bermingham NA, Hassan BA, Price SD, Vollrath MA, Ben-Arie N, Eatock RA, Bellen HJ, Lysakowski A, Zoghbi HY (1999) Math1: an essential gene for the generation of inner ear hair cells. Science 284:1837–1841. Collingridge GL, Olsen RW, Peters J, Spedding M (2009) A nomenclature for ligand-gated ion channels. Neuropharmacology 56:2–5.

195

Flores-Otero J, Xue HZ, Davis RL (2007) Reciprocal regulation of presynaptic and postsynaptic proteins in bipolar spiral ganglion neurons by neurotrophins. J Neurosci 27:14023–14034. Forge A, Li L, Corwin JT, Nevill G (1993) Ultrastructural evidence for hair cell regeneration in the mammalian inner ear. Science 259:1616–1619. Fuchs PA (2005) Time and intensity coding at the hair cell’s ribbon synapse. J Physiol 566:7–12. Fuchs PA, Glowatzki E, Moser T (2003) The afferent synapse of cochlear hair cells. Curr Opin Neurobiol 13:452–458. Glowatzki E, Fuchs PA (2002) Transmitter release at the hair cell ribbon synapse. Nat Neurosci 5:147–154. Grant L, Yi E, Goutman JD, Glowatzki E (2011) Postsynaptic recordings at afferent dendrites contacting cochlear inner hair cells: monitoring multivesicular release at a ribbon synapse. J Vis Exp 48:e2442. Harding GW, Bohne BA, Ahmad M (2002) DPOAE level shifts and ABR threshold shifts compared to detailed analysis of histopathological damage from noise. Hear Res 174:158–171. Huang LC, Barclay M, Lee K, Peter S, Housley GD, Thorne PR, Montgomery JM (2012) Synaptic profiles during neurite extension, refinement and retraction in the developing cochlea. Neural Dev 7:38–54. Kawamoto K, Ishimoto S, Minoda R, Brough DE, Raphael Y (2003) Math1 gene transfer generates new cochlear hair cells in mature guinea pigs in vivo. J Neurosci 23:4395–4400. Keen EC, Hudspeth AJ (2006) Transfer characteristics of the hair cell’s afferent synapse. Proc Natl Acad Sci U S A 103:5537–5542. Keithley EM, Ryan AF, Woolf NK (1989) Spiral ganglion cell density in young and old gerbils. Hear Res 38:125–133. Kelly MC, Chang Q, Pan A, Lin X, Chen P (2012) Atoh1 directs the formation of sensory mosaics and induces cell proliferation in the postnatal mammalian cochlea in vivo. J Neurosci 32:6699–6710. Khimich D, Nouvian R, Pujol R, Tom Dieck S, Egner A, Gundelfinger ED, Moser T (2005) Hair cell synaptic ribbons are essential for synchronous auditory signalling. Nature 434:889–894. Knipper M, Zinn C, Maier H, Praetorius M, Rohbock K, Kopschall I, Zimmermann U (2000) Thyroid hormone deficiency before the onset of hearing causes irreversible damage to peripheral and central auditory systems. J Neurophysiol 83:3101–3112. Kujawa SG, Liberman MC (2009) Adding insult to injury: cochlear nerve degeneration after ‘‘temporary” noise-induced hearing loss. J Neurosci 29:14077–14085. Kuo BR, Baldwin EM, Layman WS, Taketo MM, Zuo J (2015) In vivo cochlear hair cell generation and survival by coactivation of betacatenin and Atoh1. J Neurosci 35:10786–10798. Lee JE, Nakagawa T, Kim TS, Iguchi F, Endo T, Dong Y, Yuki K, Naito Y, Lee SH, Ito J (2003) A novel model for rapid induction of apoptosis in spiral ganglions of mice. Laryngoscope 113:994–999. Liberman LD, Wang H, Liberman MC (2011) Opposing gradients of ribbon size and AMPA receptor expression underlie sensitivity differences among cochlear-nerve/hair-cell synapses. J Neurosci 31:801–808. Liu Z, Dearman JA, Cox BC, Walters BJ, Zhang L, Ayrault O, Zindy F, Gan L, Roussel MF, Zuo J (2012) Age-dependent in vivo conversion of mouse cochlear pillar and Deiters’ cells to immature hair cells by Atoh1 ectopic expression. J Neurosci 32:6600–6610. Liu Z, Fang J, Dearman J, Zhang L, Zuo J (2014) In vivo generation of immature inner hair cells in neonatal mouse cochleae by ectopic Atoh1 expression. PLoS One 9:e89377. Luo WW, Yang JM, Han Z, Yuan YS, Sheng HB, Liu X, Chi FL (2014) Atoh1 expression levels define the fate of rat cochlear nonsensory epithelial cells in vitro. Mol Med Rep 10:15–20. McFadden SL, Ding D, Jiang H, Salvi RJ (2004) Time course of efferent fiber and spiral ganglion cell degeneration following complete hair cell loss in the chinchilla. Brain Res 997:40–51. Nouvian R, Beutner D, Parsons TD, Moser T (2006) Structure and function of the hair cell ribbon synapse. J Membr Biol 209:153–165.

196

W.-w. Luo et al. / Neuroscience 357 (2017) 185–196

Pujol R, Puel JL (1999) Excitotoxicity, synaptic repair, and functional recovery in the mammalian cochlea: a review of recent findings. Ann N Y Acad Sci 884:249–254. Roux I, Hosie S, Johnson SL, Bahloul A, Cayet N, Nouaille S, Kros CJ, Petit C, Safieddine S (2009) Myosin VI is required for the proper maturation and function of inner hair cell ribbon synapses. Hum Mol Genet 18:4615–4628. Ruel J, Chen C, Pujol R, Bobbin RP, Puel JL (1999) AMPA-preferring glutamate receptors in cochlear physiology of adult guinea-pig. J Physiol 518:667–680. Ruel J, Bobbin RP, Vidal D, Pujol R, Puel JL (2000) The selective AMPA receptor antagonist GYKI 53784 blocks action potential generation and excitotoxicity in the guinea pig cochlea. Neuropharmacology 39:1959–1973. Rutherford MA, Pangrsic T (2012) Molecular anatomy and physiology of exocytosis in sensory hair cells. Cell Calcium 52:327–337. Safieddine S, El-Amraoui A, Petit C (2012) The auditory hair cell ribbon synapse: from assembly to function. Annu Rev Neurosci 35:509–528. Shi L, Guo X, Shen P, Liu L, Tao S, Li X, Song Q, Yu Z, Yin S, Wang J (2015a) Noise-induced damage to ribbon synapses without permanent threshold shifts in neonatal mice. Neuroscience 304:368–377. Shi L, Liu K, Wang H, Zhang Y, Hong Z, Wang M, Wang X, Jiang X, Yang S (2015b) Noise induced reversible changes of cochlear ribbon synapses contribute to temporary hearing loss in mice. Acta Otolaryngol 135:1093–1102. Sobkowicz HM, Slapnick SM (1992) Neuronal sprouting and synapse formation in response to injury in the mouse organ of Corti in culture. Int J Dev Neurosci 10:545–566. Sobkowicz HM, Rose JE, Scott GL, Levenick CV (1986) Distribution of synaptic ribbons in the developing organ of Corti. J Neurocytol 15:693–714.

Starr A, Picton TW, Sininger Y, Hood LJ, Berlin CI (1996) Auditory neuropathy. Brain 119(Pt 3):741–753. Tong M, Brugeaud A, Edge AS (2013) Regenerated synapses between postnatal hair cells and auditory neurons. J Assoc Res Otolaryngol 14:321–329. Warchol ME, Lambert PR, Goldstein BJ, Forge A, Corwin JT (1993) Regenerative proliferation in inner ear sensory epithelia from adult guinea pigs and humans. Science 259:1619–1622. Weisz C, Glowatzki E, Fuchs P (2009) The postsynaptic function of type II cochlear afferents. Nature 461:1126–1129. Weisz CJ, Lehar M, Hiel H, Glowatzki E, Fuchs PA (2012) Synaptic transfer from outer hair cells to type II afferent fibers in the rat cochlea. J Neurosci 32:9528–9536. White JA, Burgess BJ, Hall RD, Nadol JB (2000) Pattern of degeneration of the spiral ganglion cell and its processes in the C57BL/6J mouse. Hear Res 141:12–18. Woods C, Montcouquiol M, Kelley MW (2004) Math1 regulates development of the sensory epithelium in the mammalian cochlea. Nat Neurosci 7:1310–1318. Yang J, Bouvron S, Lv P, Chi F, Yamoah EN (2012) Functional features of trans-differentiated hair cells mediated by Atoh1 reveals a primordial mechanism. J Neurosci 32:3712–3725. Yang J, Cong N, Han Z, Huang Y, Chi F (2013) Ectopic hair cell-like cell induction by Math1 mainly involves direct transdifferentiation in neonatal mammalian cochlea. Neurosci Lett 549:7–11. Yang XY, Jin K, Ma R, Yang JM, Luo WW, Han Z, Cong N, Ren DD, Chi FL (2015) Role of the planar cell polarity pathway in regulating ectopic hair cell-like cells induced by Math1 and testosterone treatment. Brain Res 1615:22–30. Zheng JL, Gao WQ (2000) Overexpression of Math1 induces robust production of extra hair cells in postnatal rat inner ears. Nat Neurosci 3:580–586.

(Received 30 December 2016, Accepted 23 May 2017) (Available online 31 May 2017)