- Email: [email protected]
AKT and Telomerase
Accepted Manuscript Title: Epigallocatechin-3-gallate promotes apoptosis in human breast cancer T47D cells through down-regulation of PI3K/AKT and Telomerase Authors: Maliheh Moradzadeh, Azar Hosseini, Saiedeh Erfanian, Hadi Rezaei PII: DOI: Reference:
S1734-1140(16)30135-9 http://dx.doi.org/doi:10.1016/j.pharep.2017.04.008 PHAREP 704
To appear in: Received date: Accepted date:
31-8-2016 11-4-2017
Please cite this article as: Maliheh Moradzadeh, Azar Hosseini, Saiedeh Erfanian, Hadi Rezaei, Epigallocatechin-3-gallate promotes apoptosis in human breast cancer T47D cells through down-regulation of PI3K/AKT and Telomerase (2010), http://dx.doi.org/10.1016/j.pharep.2017.04.008 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
Epigallocatechin-3-gallate promotes apoptosis in human breast cancer T47D cells through down-regulation of PI3K/AKT and Telomerase Maliheh Moradzadeh1, Azar Hosseini2, Saiedeh Erfanian*3, Hadi Rezaei4 1
Department of New Sciences and Technology, School of Medicine, Mashhad University of Medical
Sciences, Mashhad, Iran. 2
Pharmacological Research Center of Medicinal Plants, School of Medicine, Mashhad University of
Medical Sciences, Mashhad, Iran. 3
Research center for non-Communicable Diseases, Jahrom University of Medical Sciences, Jahrom,
Iran. 4
Department of Microbiology, Jahrom University of Medical Sciences, Jahrom, Iran.
*
Corresponding author:
Saiedeh Erfanian Research Center for non.Communicable Diseases, Jahrom University of Medical Sciences, Motahari Avenue, Jahrom, Iran. Tel: +989178912489
Fax: +987154340405
E-mail: [email protected]
Abstract Background: Green tea has antioxidant, anti-tumor and anti-bacterial properties. Epigallocatechin-3-gallate (EGCG) in green tea is highly active as a cancer chemopreventive agent. In this study, we designed a series of experiments to examine the effects of EGCG on proliferation and apoptosis of estrogen receptor α-positive breast cancer (T47D) cells. Methods: Cells were treated with EGCG (0-80 µM) and tamoxifen (0-20 µM), as the positive control, up to 72 h. Cell viability was determined by MTT assay. Apoptosis investigated by
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
real time PCR of apoptosis and survival (Bax, Bcl-2, p21, p53, PTEN, PI3K, AKT, caspase3 and caspase9 and hTERT) genes and by western blot of Bax/Bcl-2 proteins expressions. Results: The results showed that EGCG decreased cell viability as concentration- and timedependently. IC50 values were 14.17 µM for T47D and 193.10 µM for HFF cells, as compared with 3.39 µM and 32.75 µM for tamoxifen after 72 h treatment, respectively. Also, EGCG (80 µM) significantly increased the genes of PTEN, CASP3, CASP9 and decreased AKT approximately equal to tamoxifen. In gene expression, EGCG (80 µM) significantly increased Bax/Bcl-2 ratio to 8-fold vise 15-fold in tamoxifen (20 µM)–treated T47D cells during 72 h. In protein expression of Bax/Bcl-2, EGCG significantly increased 6-fold while this ratio augmented 10-fold in tamoxifen group. EGCG significantly decreased 0.8, 0.4 and 0.3 gene expression of hTERT in 24, 48 and 72 h, respectively. Conclusions: This study suggests that EGCG may be a useful adjuvant therapeutic agent for the treatment of breast cancer. Keywords: Breast cancer; ; ; ; , epigallocatechin-3-gallate, telomerase, apoptosis, PI3K/AKT signaling cascade Introduction The most common cancer among women is breast cancer (17.1 per 100,000 person-year), which has mainly affected Iranian women about a decade earlier than western countries [1, 2]. Presently, common treatments for breast cancer are chemotherapy, radiotherapy and surgery. Current systemic therapies for breast cancer are often limited by major organ damage, shortterm efficacy due to the emergence of drug resistance and poor prognosis [3]. So, the search for new antitumor agent’s development with improved efficacy and side-effect profile has been continued. Researchers believe that dietary phytochemical agents may influence chemotherapy treatment and help cure patients with cancer. Different natural compounds can improve the efficiency of chemotherapeutic agents, decrease resistance of chemotherapeutic drugs, and
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
lower as well as alleviate adverse side-effects of chemotherapy [4]. As a result, researchers attempt to employ different herbs and their effective agents both in vitro and in vivo for cancer therapy. Most herbs contain antioxidant agents that could be consumed to prevent cancer or potentiate chemotherapy. Experimentally, several medicinal plants and herbal ingredients have been reported to have anticancer effects [5]. Also, a number of phytochemicals isolated from medicinal plants have been shown to decrease cell proliferation, induce apoptosis, retard metastasis and inhibit angiogenesis [6]. Currently, some of these plant-derived compounds are widely used for the chemotherapy of patients with cancer. For example, taxol analogues, vinca alkaloids (vincristine, vinblastine), and podophyllotoxin analogues have played an important role in the treatment of such patients [7]. Green tea is a popular beverage in Asia. Epidemiological studies have suggested that drinking green tea is effective in the treatment of different diseases. Based on many in vivo and in vitro studies, the biological activity of green tea is mediated by its major polyphenolic constituent, epigallocatechin gallate (EGCG), which is a potent antioxidant [8]. The beneficial effects of EGCG are reported in the treatment of cancer, cardiovascular diseases, diabetes, neurodegenerative diseases, and liver diseases. It reduces the risk of cancer developing in the prostate, bladder, stomach, oesophagus and lung [9-13]. In the pioneer study confirmed that EGCG affected the ERα-positive cells more than ERα-negative breast cancer cells [14]. Therefore, we chose T47D cells (as estrogen receptor α-positive breast cancer cell model) to evaluate the effects of EGCG on proliferation and apoptosis compared with tamoxifen (as positive control). It was also aimed to determine whether antitumor effects of EGCG are associated with altering of PI3K/AKT and telomerase genes expressions. Materials and Methods Cell lines and reagents
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
The estrogen receptor positive human breast cancer cell line T47D and normal Human Foreskin Fibroblast cell line HFF were obtained from Pasteur Institute of Iran. Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum, trypsin, penicillin and streptomycin were obtained from Gibco BRL Life Technologies (USA). The 3-(4, 5-dimethylthiazol-2-yl)-2, 5diphenyl tetrazolium (MTT) 4-, OH-tamoxifen and EGCG (> 95%) were purchased from Sigma-Aldrich company (USA). Tripure was purchased from Invitrogen (USA). Real-time PCR Master Mix and cDNA synthesis Kit were obtained from Roche Diagnostic (Switzerland) and Fermentas (Lithuania), respectively. The enhanced chemiluminescence (ECL) detection kit and polyvinylidene difluoride (PVDF) membranes were purchased from GE Healthcare (UK) and Millipore (USA), respectively. Primary antibodies to Bcl-2, Bax, β-actin, and secondary antibody were obtained from Cell Signaling Technology (USA). Cell culture T47D and HFF cells were maintained at 37°C in a humidified atmosphere (90%) containing 5% CO2 and DMEM with 10% (v/v) fetal bovine serum, 100 units/ml penicillin and 100 µg/ml streptomycin. The cells were seeded overnight and then, incubated with various concentrations of EGCG (10-80 µM) and tamoxifen (2.5-20 µM) for 24, 48 and 72 h. For each concentration and time course study, there was a control sample which remained untreated and received the equal volume of medium. All the different treatments were carried out in triplicate. Cell viability The cell viability was determined using a modified MTT assay. Briefly, the cells were seeded (5000 cells/well) on to the flat bottomed 96-well culture plates and allowed to growth for 24 h and then, treated with EGCG (0, 10, 20, 40 and 80 µM) and tamoxifen (0, 2.5, 5,10 and 20 µM) for 24, 48 and 72 h. After removing the medium, the cells were labeled with MTT solution
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
(5 mg/ml in PBS) for 2h and the resulting formazan dye was solubilized with DMSO (100 µl). The absorption was measured at 570 nm (620 nm as a reference) in an ELISA plate reader [15]. Real-time PCR Total RNA was extracted from EGCG (10-80 µM)- and tamoxifen (20 µM)-treated T47D cells using Tripure according to the manufacturer’s instruction. Then, 1µg of RNA was applied to cDNA synthesis using reverse transcription kit. Quality of the cDNA samples was confirmed by PCR reaction detecting glyceraldehyde phosphate dehydrogenase (GAPDH) expression. Quantitative PCR reaction was carried out on step one real time PCR system using SYBR Green PCR Master Mix. The reaction mixture consisted of 1X Q-PCR master mix and 5µM of the primers for Bax, Bcl-2, p21, p53, PTEN, PI3K, AKT, caspase3, caspase9, hTERT and GAPDH (Table 1). The primer sequences were designed by Allel ID software. Thermal cycling condition was programmed as: an initial denaturation step for 10 min at 95°C followed by 40 cycles including a denaturation step for 15 s at 95°C and annealing step for 1min at 60°C. Fluorescent data were acquired in the extension step. Finally, for each reaction, a melting curve analysis was performed from 55 to 95°C to confirm the specifity of each reaction. Each sample was analyzed in triplicate and GAPDH was applied as the normalizer gene. Fold changes in gene expression were calculated by delta-delta CT method [16]. Western blot analysis Bax and Bcl-2 protein were evaluated in treated-T47D cells with EGCG (80µM) and tamoxifen (20µM) during 72 h. Extracted proteins were separated by SDS-PAGE and then, performed immunoblotting. Briefly, after treatment T47D cells were homogenized with lysis buffer (10 mM Tris–HCl, 5 mM EDTA, 50 mM NaCl, 30 mM sodium pyrophosphate, 50 mM NaF, 1 mM Na3VO4, 1 mM PMSF, and pH 7.5) and the lysates centrifuged at 18000 × g, 1 hr, at 4°C to precipitate the particulates. Then, equal amounts of total protein extracts were separated by 10% SDS-polyacrylamide gel and transferred on to a polyvinylidene difluoride (PVDF)
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
membranes. After blocking with 2% BSA, the extracts were exposed to primary antibody for 1 h at room temperature. They were next washed and incubated with the corresponding horseradish peroxidase conjugated secondary antibody for 2 h. Bound secondary antibody was detected using an ECL detection kit. The reactions were revealed and documented by Gel-Doc (Syngene, Cambridge, UK). Images were quantified by using Image J software version 1.46r [17]. Statistical analysis All the results were expressed as mean ± SEM. The significance of the difference was evaluated by two-way or one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for multiple comparisons. A probability level of p < 0.05 was considered statistically significant. Results EGCG decreased cell viability in a concentration-dependent manner T47D and HFF cell lines were treated with different concentrations of EGCG (10-80 µM) or tamoxifen (2.5-20 µM) for up to 72 h. Then, cell viability was measured by MTT assay. Exposure to EGCG or tamoxifen showed concentration-dependent suppression in cell survival (Fig.1A). The toxicity of EGCG and tamoxifen was significantly higher in T47D than HFF cells. The results are summarized in Table 2. The IC50 (concentration of 50% inhibition) values of EGCG in T47D cells were 46.88, 22.31 and 14.17 µM at 24, 48 and 72 h of treatment, respectively, as compared with 284.7 and 193.1 µM for the normal HFF cells at 48 and 72 h, respectively (p < 0. 05) (Fig.1B, Table 2). On the other hand, after 24, 48 and 72 h of treatment, the IC50 values of tamoxifen were found to be 12.11, 7.09 and 3.39 µM in T47D cells, respectively. These values for the normal HFF cells were reported to be about 44.97 and 32.75 µM at 48 and 72 h of exposure, respectively (p < 0.01) (Fig.1, Table 2).
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
EGCG concentration-dependently induced apoptotic cell death T47D cells were treated with different concentrations of EGCG (10-80 µM) or tamoxifen (20 µM) for up to 72 h; the expression of genes involved in survival and apoptosis (Bax, Bcl-2, p21, p53, PTEN, PI3K, AKT, caspase3, caspase9 and hTERT) was measured by real time PCR. EGCG or tamoxifen induced apoptosis as concentration-and time-dependently (Fig. 2). The highest apoptosis was related to the high concentration of EGCG (80 µM). EGCG at concentration of 80 µM significantly increased the expressions of p21, p53, PTEN, CASP9 and Bax while decreased the expressions of AKT and PI3K during 24 h (p < 0.05, Fig 2). EGCG increased the expressions of p21, p53, PTEN, CASP3, CASP9 and Bax while decreased the expressions of AKT and Bcl-2 in T47D cells during 48 and 72 h (p < 0.001 for both, Fig 2). These data showed a significant reduction in the PI3K/AKT pathway that finally increased Bax/Bcl-2 in both gene and protein expression levels. In gene expression of Bax/Bcl-2, EGCG (80 µM) significantly increased 8-fold vise 15-fold in tamoxifen (20 µM)–treated T47D cells during 72 h (p < 0.001) (Fig. 3A). In protein expression of Bax/Bcl-2, EGCG (80 µM) significantly increased 6-fold while this ratio augmented 10-fold in tamoxifen (20 µM)–treated T47D cells during 72 h (p < 0.001) (Fig. 3B). These data showed that EGCG (80 µM) significantly increased the genes of PTEN, CASP3, CASP9 and decreased AKT approximately equal to tamoxifen (p < 0.01). One of the pathways of cell aging that regulates apoptosis is telomerase pathway. In this study, the expression level of hTERT (catalytic subunit of telomerase) gene was measured in EGCGand tamoxifen-treated T47D cells for up to 72 h. EGCG (80 µM) significantly decreased 0.8, 0.4 and 0.3 gene expression of hTERT in 24, 48 and 72 h, respectively (p < 0.001). However, after 24, 48 and 72 h of treatment, gene expression of hTERT in tamoxifen (20 µM)-treated
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
cells was found to be 0.4, 0.3 and 0.3, respectively (p < 0.001). Therefore, EGCG downregulated hTERT gene as tamoxifen similar to T47D cells during 72 h of treatment (Fig. 2). Discussion Breast cancer is the most common cancer and, after lung cancer, is the second cause of cancer death in women. Defects in the apoptotic pathways are responsible for both the disease pathogenesis and its therapy resistance. It is thus a good candidate for treatment by proapoptotic agents [1]. Natural products have long been utilized to prevent and treat neoplasms; therefore, searching for natural products directed at the inducing apoptosis of cancer cells may be a great strategy for breast cancer chemoprevention [4]. EGCG as one of the most important polyphenols in green tea has been demonstrated to be a potent growth suppressor in a number of cell lines [18]. This study was the first to simultaneously investigate the effects of EGCG on ten genes involved in apoptotic and cellular aging in T47D breast cancer cell up to 72 h as compared with tamoxifen (as the positive control). We reported that EGCG effectively induced the apoptosis of T47D breast cancer cells via the up-regulation of pro-apoptotic genes such as p53, p21, casppase3, caspase9, Bax and PTEN and down-regulation of survival genes including PI3K, AKT and Bcl-2. Finally, the ratio of Bax/Bcl2 significantly increased in EGCG-treated cells, suggesting that EGCG modulates mitochondrial function to mediate cell death. In this study, we also showed that EGCG increased cellular aging via reducing of telomerase gene, this result is agreement with Meeran study [19]. The applied dose in this study is according to recent studies [20]. One thing to note is that the dose of EGCG used in this study would be considered as pharmacological therapeutic doses [21]. Previous studies have also reported the LD50 of EGCG to be 2g/kg [22].The pharmacokinetic and pharmacodynamics studies demonstrated that EGCG is safe as a chemotherapeutic agent [23].The cytotoxic effect of EGCG was more pronounced against the neoplastic cells than human normal fibroblast cells. It is noteworthy to mention that these effects are comparable with the standard anti-neoplastic
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
drug, tamoxifen, especially increasing CASP3, CASP9 and inhibiting telomerase in 72 h. Various clinical studies have revealed that treatment by EGCG inhibits tumor incidence and multiplicity in different organ sites such as the liver, stomach, skin, lung, mammary gland and colon [24-26]. In agreement with our findings, the study in 2006, EGCG increased the inhibitory effect of tamoxifen on the proliferation of human breast cancer cells [27]. Also, in animal experiments, treated groups with EGCG and tamoxifen had better effect in comparison with each group alone [27]. In another study, EGCG and tamoxifen exhibited concentrationdependent antiproliferative effects on MCF-7 cells [14, 28]. In the same study, the growthinhibitory effect of EGCG and tamoxifen was investigated on mice and the tumor incidences were decreased in the treated groups. Even more importantly, in the group treated with green tea extract and tamoxifen, no tumors were developed [28]. On the other hand, EGCG with tamoxifen investigated in a xenograft model of ER-negative breast cancer and observed tamoxifen alone was not effective in suppressing ER-negative tumor growth, whereas EGCG had a modest effect on tumor growth [29]. In contrast, EGCG had no effect of cytotoxic on T47D cells and only affected MCF-7 and HS578T cells, while in this cell line, the combination with 4-OHT did not increase cytotoxicity [14]. In MDA-MB-231 cells, EGCG produced a greater cytotoxic effect than 4-OHT and the combination of the two resulted in synergistic cytotoxicity [14, 30]. Pharmacokinetic study of EGCG and tamoxifen suggested that, since 4OHT and EGCG had a glucuronide structure, the combination of tamoxifen and EGCG might increase tamoxifen cytotoxicity [31]. In the research, this result was proven that EGCG significantly increased the AUC 0– ∞ and C max of oral tamoxifen in rats [32]. In conclusion, our results demonstrated that EGCG could induce apoptosis in a time- and concentrationdependent manner via inhibiting telomerase and PI3K/AKT pathways and increasing p53 and Bax/Bcl-2 in breast T47D cancer cell while posing no significant toxic effects on normal cells. The precise signaling pathway by EGCG that could induce apoptosis needs further research.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
EGCG has a great potential in cancer prevention because of its safety, low-cost and bioavailability. Therefore, non-toxic natural agents could be useful either alone or in combination with conventional therapeutics for the prevention of tumor progression and/or treatment of human malignancies. On the other hand, the inhibition of telomerase by EGCG could provide a safe and effective therapy for breast cancer. Funding acknowledgement This work was supported by a grant from the Vice Chancellor for Research and Technology, Jahrom University of Medical Sciences, Jahrom, Iran.
Authors and contributions Design study and collection data: M.M.; Analysis and interpretation of data: S.E., H.R.; Writing of manuscript and decision to submit the article for publication: A.H., M.M.
References: 1. Mousavi SM, Gouya MM, Ramazani R, Davanlou M, Hajsadeghi N, Seddighi Z: Cancer incidence and mortality in Iran. Ann Oncol, 2009, 20, 556-63. 2. Ahmad N, Cheng P, Mukhtar H: Cell cycle dysregulation by green tea polyphenol epigallocatechin-3-gallate. Biochem Biophys Res Commun, 2000, 275, 328-34. 3. Xiang L-P, Wang A, Ye J-H, Zheng X-Q, Polito CA, Lu J-L, et al.: Suppressive effects of tea catechins on breast cancer. Nutrients, 2016, 8, 458. 4. Surh Y-J: Cancer chemoprevention with dietary phytochemicals. Nat Rev Cancer, 2003, 3, 768-80. 5. Teiten M-H, Gaascht F, Dicato M, Diederich M: Anticancer bioactivity of compounds from medicinal plants used in European medieval traditions. Biochem Pharmacol, 2013, 86, 123947. 6. Shu L, Cheung K-L, Khor TO, Chen C, Kong A-N: Phytochemicals: cancer chemoprevention and suppression of tumor onset and metastasis. Cancer Metastasis Rev, 2010, 29, 483-502. 7. Saklani A, Kutty SK: Plant-derived compounds in clinical trials. Drug Discov Today, 2008, 13, 161-71. 8. Gupta S, Hussain T, Mukhtar H: Molecular pathway for (−)-epigallocatechin-3-gallateinduced cell cycle arrest and apoptosis of human prostate carcinoma cells. Arch Biochem Biophys, 2003, 410, 177-85.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
9. Thielecke F, Boschmann M: The potential role of green tea catechins in the prevention of the metabolic syndrome–a review. Phytochemistry, 2009, 70, 11-24. 10. Xiao J, Ho CT, Liong EC, Nanji AA, Leung TM, Lau TYH, et al.: Epigallocatechin gallate attenuates fibrosis, oxidative stress, and inflammation in non-alcoholic fatty liver disease rat model through TGF/SMAD, PI3 K/Akt/FoxO1, and NF-kappa B pathways. Eur J Nutr, 2014, 53, 187-99. 11. Yang CS, Landau JM, Huang M-T, Newmark HL: Inhibition of carcinogenesis by dietary polyphenolic compounds. Annu Rev Nutr, 2001, 21, 381-406. 12. Li M, Liu J-T, Pang X-M, Han C-J, Mao J-J: Epigallocatechin-3-gallate inhibits angiotensin II and interleukin-6-induced C-reactive protein production in macrophages. Pharmacol Rep, 2012, 64, 912-8. 13. Zhou J, Farah BL, Sinha RA, Wu Y, Singh BK, Bay B-H, et al.: Epigallocatechin-3-gallate (EGCG), a green tea polyphenol, stimulates hepatic autophagy and lipid clearance. PLoS One, 2014, 9, e87161. 14. Zeng L, Holly JM, Perks CM: Effects of physiological levels of the green tea extract epigallocatechin-3-gallate on breast cancer cells. Front Endocrinol, 2014, 5, 61. 15. Hosseini A, Shafiee-Nick R, Mousavi SH: Combination of Nigella sativa with Glycyrrhiza glabra and Zingiber officinale augments their protective effects on doxorubicin-induced toxicity in h9c2 cells. Iran J Basic Med Sci, 2014, 17, 993. 16. Pfaffl MW: Relative quantification. Real-time PCR, 2006, 63, 63-82. 17. Sedghy F, Sankian M, Moghadam M, Ghasemi Z, Mahmoudi M, Varasteh A-R: Impact of traffic-related air pollution on the expression of Platanus orientalis pollen allergens. Int J Biometeorol, 2017, 61, 1-9. 18. Braicu C, Pileczki V, Pop L, Petric RC, Chira S, Pointiere E, et al.: Dual targeted therapy with p53 siRNA and Epigallocatechingallate in a triple negative breast cancer cell model. PLoS One, 2015, 10, e0120936. 19. Meeran SM, Patel SN, Chan T-H, Tollefsbol TO: A novel prodrug of epigallocatechin-3gallate: differential epigenetic hTERT repression in human breast cancer cells. Cancer Prev Res, 2011, 4, 1243-54. 20. Belguise K, Guo S, Sonenshein GE: Activation of FOXO3a by the Green Tea Polyphenol Epigallocatechin-3-Gallate Induces Estrogen Receptor α Expression Reversing Invasive Phenotype of Breast Cancer Cells. Cancer Res, 2007, 67, 5763-70. 21. Chen L, Lee M-J, Li H, Yang CS: Absorption, distribution, and elimination of tea polyphenols in rats. Drug Metab Dispos, 1997, 25, 1045-50.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
22. Isbrucker R, Edwards J, Wolz E, Davidovich A, Bausch J: Safety studies on epigallocatechin gallate (EGCG) preparations. Part 2: dermal, acute and short-term toxicity studies. Food Chem Toxicol, 2006, 44, 636-50. 23. Dvorakova K, Dorr RT, Valcic S, Timmermann B, Alberts DS: Pharmacokinetics of the green tea derivative, EGCG, by the topical route of administration in mouse and human skin. Cancer Chemother Pharmacol, 1999, 43, 331-5. 24. Yang CS, Maliakal P, Meng X: Inhibition of Carcinogenesis by Tea*. Annu Rev Pharmacol Toxicol, 2002, 42, 25-54. 25. Yeh C, Chen W, Chiang C, Lin-Shiau S, Lin J: Suppression of fatty acid synthase in MCF7 breast cancer cells by tea and tea polyphenols: a possible mechanism for their hypolipidemic effects. The pharmacogenomics J, 2003, 3, 267-76. 26. Zhang G, Wang Y, Zhang Y, Wan X, Li J, Liu K, et al.: Anti-cancer activities of tea epigallocatechin-3-gallate in breast cancer patients under radiotherapy. Curr Mol Med, 2012, 12, 163-76. 27. Sartippour MR, Pietras R, Marquez-Garban DC, Chen H-W, Heber D, Henning SM, et al.: The combination of green tea and tamoxifen is effective against breast cancer. Carcinogenesis, 2006, 27, 2424-33. 28. Sakata M, Ikeda T, Imoto S, Jinno H, Kitagawa Y: Prevention of mammary carcinogenesis in C3H/OuJ mice by green tea and tamoxifen. Asian Pac J Cancer Prev, 2011, 12, 567-71. 29. Scandlyn M, Stuart E, Somers-Edgar T, Menzies A, Rosengren R: A new role for tamoxifen in oestrogen receptor-negative breast cancer when it is combined with epigallocatechin gallate. Br J Cancer, 2008, 99, 1056-63. 30. Chisholm K, Bray B, Rosengren R: Tamoxifen and epigallocatechin gallate are synergistically cytotoxic to MDA-MB-231 human breast cancer cells. Anticancer Drugs, 2004, 15, 889-97. 31. Qiao J, Gu C, Shang W, Du J, Yin W, Zhu M, et al.: Effect of green tea on pharmacokinetics of 5-fluorouracil in rats and pharmacodynamics in human cell lines in vitro. Food Chem Toxicol, 2011, 49, 1410-5. 32. Shin S-C, Choi J-S: Effects of epigallocatechin gallate on the oral bioavailability and pharmacokinetics of tamoxifen and its main metabolite, 4-hydroxytamoxifen, in rats. Anticancer Drugs, 2009, 20, 584-8. Figure legends
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
Figure 1A,B. Anti-proliferative effect of Epigallocatechin-3-gallate (EGCG) and tamoxifen on human breast cancer (T47D) and normal foreskin fibroblast cells (HFF). (A) T47D cells were treated with increasing concentrations of EGCG (10-80 µM) and tamoxifen (2.5-20 µM) for 24-72 h. (B) HFF cells were treated with increasing concentrations of EGCG (10-80 µM) and tamoxifen (2.5-20 µM) for 48 and 72 h. The percentage cell viability (quantitated by MTT assay) was normalized against the control. Mean and SEM of the three independent experiments were shown. *p < 0.05, **p < 0.01,
***
p < 0.001 as compared with coresponding
control value. Figure 2: Apoptotic effect of Epigallocatechin-3-gallate (EGCG) and tamoxifen on human breast cancer cell (T47D). Cells were treated with increasing concentrations of EGCG(10-80 µM) and tamoxifen (20 µM) for 24, 48 and 72 h. Then, expression level of apoptotic and survival genes (p53, p21, PTEN, CASP3, CASP9, PI3K, Bax, Bcl-2, AKT and hTERT) determined using real time PCR. Mean and SEM of the three independent experiments were shown. *p < 0.05, **p < 0.01, ***p < 0.001 as compared with coresponding control value. Table 1. GENE
BAX
FORWARD PRIMER
GCCTCCTCTCCTACTTTG
REVERSE PRIMER
CTCAGCCCATCTTCTTCC
GENBAK
PRODUT
CODE
SIZE (BP)
NM_0012
102
91428.1 BCL2
CCAAGAAAGCAGGAAACC
GGATAGCAGCACAGGATT
NM_0006
170
33.2 P21
AACGGCGGCAGACCAGCAT
GAGACTAAGGCAGAAGATGTA GAGCG
P53
GGAACTCAAGGATGCCCAG
CAAGAAGTGGAGAATGTCAGTC
NM_0003
150
89.4 NM_0011 26113.2
155
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells AKT
GCACCTTCATTGGCTACA
CCGCTCCGTCTTCATCAG
NM_0010
104
14431.1 PI3K
TGCGGAAACTGACGGACGA
CGGAGCGGAGGTGCCAGAA
TGA CASP3
NM_0050
162
26.3
AGAACTGGACTGTGGCATT
GCTTGTCGGCATACTGTTT
NM_0043
191
46.3 CASP9
CTTTGTGTCCTACTCTACTT
AACAGCATTAGCGACCCTA
TCC PTEN
NM_0329
151
96.3
AGTAGAGGAGCCGTCAAAT
ATCAGAGTCAGTGGTGTCAG
C
NM_0003
109
14.4
HTER
TGTACTTTGTCAAGGTGG
GCTGGAGGTCTGTCAAGGTA
NM_001
T
ATGTGA
GAG
193376.1
GAPD
GAAGTCAGGTGGAGCGAGG
TGGGTGGAATCATATTGGAACA
NM_0012
T
H
195
200
56799.2
Table 2. HFF
Cell lines
T47D
Treatments
48 h
72 h
24 h
48 h
72 h
EGCG (µM)
284.7
193.1
46.88
22.31
14.17
Tamoxifen (µM)
44.97
32.75
12.11
7.09
3.39
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
Figure 3A,B: The effect of Epigallocatechin-3-gallate (EGCG) and tamoxifen on expression of Bax/Bcl-2 ratio in human breast cancer cell (T47D). (A) The graph shows the gene expression of Bax/Bcl-2 in EGCG(10-80 µM)- and TAM(20 µM)- treated T47D cells during 24-72 h. (B) This panel shows the protein expression of Bax/Bcl-2 that determined by western blot and Quantitative analysis was done by Image J software. Mean and SEM of the three independent experiments were shown. *p < 0.05, ***p < 0.001 as compared with coresponding control value.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells Figr-1
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells Figr-2
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells Figr-3
S1734-1140(16)30135-9 http://dx.doi.org/doi:10.1016/j.pharep.2017.04.008 PHAREP 704
To appear in: Received date: Accepted date:
31-8-2016 11-4-2017
Please cite this article as: Maliheh Moradzadeh, Azar Hosseini, Saiedeh Erfanian, Hadi Rezaei, Epigallocatechin-3-gallate promotes apoptosis in human breast cancer T47D cells through down-regulation of PI3K/AKT and Telomerase (2010), http://dx.doi.org/10.1016/j.pharep.2017.04.008 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
Epigallocatechin-3-gallate promotes apoptosis in human breast cancer T47D cells through down-regulation of PI3K/AKT and Telomerase Maliheh Moradzadeh1, Azar Hosseini2, Saiedeh Erfanian*3, Hadi Rezaei4 1
Department of New Sciences and Technology, School of Medicine, Mashhad University of Medical
Sciences, Mashhad, Iran. 2
Pharmacological Research Center of Medicinal Plants, School of Medicine, Mashhad University of
Medical Sciences, Mashhad, Iran. 3
Research center for non-Communicable Diseases, Jahrom University of Medical Sciences, Jahrom,
Iran. 4
Department of Microbiology, Jahrom University of Medical Sciences, Jahrom, Iran.
*
Corresponding author:
Saiedeh Erfanian Research Center for non.Communicable Diseases, Jahrom University of Medical Sciences, Motahari Avenue, Jahrom, Iran. Tel: +989178912489
Fax: +987154340405
E-mail: [email protected]
Abstract Background: Green tea has antioxidant, anti-tumor and anti-bacterial properties. Epigallocatechin-3-gallate (EGCG) in green tea is highly active as a cancer chemopreventive agent. In this study, we designed a series of experiments to examine the effects of EGCG on proliferation and apoptosis of estrogen receptor α-positive breast cancer (T47D) cells. Methods: Cells were treated with EGCG (0-80 µM) and tamoxifen (0-20 µM), as the positive control, up to 72 h. Cell viability was determined by MTT assay. Apoptosis investigated by
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
real time PCR of apoptosis and survival (Bax, Bcl-2, p21, p53, PTEN, PI3K, AKT, caspase3 and caspase9 and hTERT) genes and by western blot of Bax/Bcl-2 proteins expressions. Results: The results showed that EGCG decreased cell viability as concentration- and timedependently. IC50 values were 14.17 µM for T47D and 193.10 µM for HFF cells, as compared with 3.39 µM and 32.75 µM for tamoxifen after 72 h treatment, respectively. Also, EGCG (80 µM) significantly increased the genes of PTEN, CASP3, CASP9 and decreased AKT approximately equal to tamoxifen. In gene expression, EGCG (80 µM) significantly increased Bax/Bcl-2 ratio to 8-fold vise 15-fold in tamoxifen (20 µM)–treated T47D cells during 72 h. In protein expression of Bax/Bcl-2, EGCG significantly increased 6-fold while this ratio augmented 10-fold in tamoxifen group. EGCG significantly decreased 0.8, 0.4 and 0.3 gene expression of hTERT in 24, 48 and 72 h, respectively. Conclusions: This study suggests that EGCG may be a useful adjuvant therapeutic agent for the treatment of breast cancer. Keywords: Breast cancer; ; ; ; , epigallocatechin-3-gallate, telomerase, apoptosis, PI3K/AKT signaling cascade Introduction The most common cancer among women is breast cancer (17.1 per 100,000 person-year), which has mainly affected Iranian women about a decade earlier than western countries [1, 2]. Presently, common treatments for breast cancer are chemotherapy, radiotherapy and surgery. Current systemic therapies for breast cancer are often limited by major organ damage, shortterm efficacy due to the emergence of drug resistance and poor prognosis [3]. So, the search for new antitumor agent’s development with improved efficacy and side-effect profile has been continued. Researchers believe that dietary phytochemical agents may influence chemotherapy treatment and help cure patients with cancer. Different natural compounds can improve the efficiency of chemotherapeutic agents, decrease resistance of chemotherapeutic drugs, and
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
lower as well as alleviate adverse side-effects of chemotherapy [4]. As a result, researchers attempt to employ different herbs and their effective agents both in vitro and in vivo for cancer therapy. Most herbs contain antioxidant agents that could be consumed to prevent cancer or potentiate chemotherapy. Experimentally, several medicinal plants and herbal ingredients have been reported to have anticancer effects [5]. Also, a number of phytochemicals isolated from medicinal plants have been shown to decrease cell proliferation, induce apoptosis, retard metastasis and inhibit angiogenesis [6]. Currently, some of these plant-derived compounds are widely used for the chemotherapy of patients with cancer. For example, taxol analogues, vinca alkaloids (vincristine, vinblastine), and podophyllotoxin analogues have played an important role in the treatment of such patients [7]. Green tea is a popular beverage in Asia. Epidemiological studies have suggested that drinking green tea is effective in the treatment of different diseases. Based on many in vivo and in vitro studies, the biological activity of green tea is mediated by its major polyphenolic constituent, epigallocatechin gallate (EGCG), which is a potent antioxidant [8]. The beneficial effects of EGCG are reported in the treatment of cancer, cardiovascular diseases, diabetes, neurodegenerative diseases, and liver diseases. It reduces the risk of cancer developing in the prostate, bladder, stomach, oesophagus and lung [9-13]. In the pioneer study confirmed that EGCG affected the ERα-positive cells more than ERα-negative breast cancer cells [14]. Therefore, we chose T47D cells (as estrogen receptor α-positive breast cancer cell model) to evaluate the effects of EGCG on proliferation and apoptosis compared with tamoxifen (as positive control). It was also aimed to determine whether antitumor effects of EGCG are associated with altering of PI3K/AKT and telomerase genes expressions. Materials and Methods Cell lines and reagents
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
The estrogen receptor positive human breast cancer cell line T47D and normal Human Foreskin Fibroblast cell line HFF were obtained from Pasteur Institute of Iran. Dulbecco’s Modified Eagle’s Medium (DMEM), fetal bovine serum, trypsin, penicillin and streptomycin were obtained from Gibco BRL Life Technologies (USA). The 3-(4, 5-dimethylthiazol-2-yl)-2, 5diphenyl tetrazolium (MTT) 4-, OH-tamoxifen and EGCG (> 95%) were purchased from Sigma-Aldrich company (USA). Tripure was purchased from Invitrogen (USA). Real-time PCR Master Mix and cDNA synthesis Kit were obtained from Roche Diagnostic (Switzerland) and Fermentas (Lithuania), respectively. The enhanced chemiluminescence (ECL) detection kit and polyvinylidene difluoride (PVDF) membranes were purchased from GE Healthcare (UK) and Millipore (USA), respectively. Primary antibodies to Bcl-2, Bax, β-actin, and secondary antibody were obtained from Cell Signaling Technology (USA). Cell culture T47D and HFF cells were maintained at 37°C in a humidified atmosphere (90%) containing 5% CO2 and DMEM with 10% (v/v) fetal bovine serum, 100 units/ml penicillin and 100 µg/ml streptomycin. The cells were seeded overnight and then, incubated with various concentrations of EGCG (10-80 µM) and tamoxifen (2.5-20 µM) for 24, 48 and 72 h. For each concentration and time course study, there was a control sample which remained untreated and received the equal volume of medium. All the different treatments were carried out in triplicate. Cell viability The cell viability was determined using a modified MTT assay. Briefly, the cells were seeded (5000 cells/well) on to the flat bottomed 96-well culture plates and allowed to growth for 24 h and then, treated with EGCG (0, 10, 20, 40 and 80 µM) and tamoxifen (0, 2.5, 5,10 and 20 µM) for 24, 48 and 72 h. After removing the medium, the cells were labeled with MTT solution
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
(5 mg/ml in PBS) for 2h and the resulting formazan dye was solubilized with DMSO (100 µl). The absorption was measured at 570 nm (620 nm as a reference) in an ELISA plate reader [15]. Real-time PCR Total RNA was extracted from EGCG (10-80 µM)- and tamoxifen (20 µM)-treated T47D cells using Tripure according to the manufacturer’s instruction. Then, 1µg of RNA was applied to cDNA synthesis using reverse transcription kit. Quality of the cDNA samples was confirmed by PCR reaction detecting glyceraldehyde phosphate dehydrogenase (GAPDH) expression. Quantitative PCR reaction was carried out on step one real time PCR system using SYBR Green PCR Master Mix. The reaction mixture consisted of 1X Q-PCR master mix and 5µM of the primers for Bax, Bcl-2, p21, p53, PTEN, PI3K, AKT, caspase3, caspase9, hTERT and GAPDH (Table 1). The primer sequences were designed by Allel ID software. Thermal cycling condition was programmed as: an initial denaturation step for 10 min at 95°C followed by 40 cycles including a denaturation step for 15 s at 95°C and annealing step for 1min at 60°C. Fluorescent data were acquired in the extension step. Finally, for each reaction, a melting curve analysis was performed from 55 to 95°C to confirm the specifity of each reaction. Each sample was analyzed in triplicate and GAPDH was applied as the normalizer gene. Fold changes in gene expression were calculated by delta-delta CT method [16]. Western blot analysis Bax and Bcl-2 protein were evaluated in treated-T47D cells with EGCG (80µM) and tamoxifen (20µM) during 72 h. Extracted proteins were separated by SDS-PAGE and then, performed immunoblotting. Briefly, after treatment T47D cells were homogenized with lysis buffer (10 mM Tris–HCl, 5 mM EDTA, 50 mM NaCl, 30 mM sodium pyrophosphate, 50 mM NaF, 1 mM Na3VO4, 1 mM PMSF, and pH 7.5) and the lysates centrifuged at 18000 × g, 1 hr, at 4°C to precipitate the particulates. Then, equal amounts of total protein extracts were separated by 10% SDS-polyacrylamide gel and transferred on to a polyvinylidene difluoride (PVDF)
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
membranes. After blocking with 2% BSA, the extracts were exposed to primary antibody for 1 h at room temperature. They were next washed and incubated with the corresponding horseradish peroxidase conjugated secondary antibody for 2 h. Bound secondary antibody was detected using an ECL detection kit. The reactions were revealed and documented by Gel-Doc (Syngene, Cambridge, UK). Images were quantified by using Image J software version 1.46r [17]. Statistical analysis All the results were expressed as mean ± SEM. The significance of the difference was evaluated by two-way or one-way analysis of variance (ANOVA) followed by Tukey’s post-hoc test for multiple comparisons. A probability level of p < 0.05 was considered statistically significant. Results EGCG decreased cell viability in a concentration-dependent manner T47D and HFF cell lines were treated with different concentrations of EGCG (10-80 µM) or tamoxifen (2.5-20 µM) for up to 72 h. Then, cell viability was measured by MTT assay. Exposure to EGCG or tamoxifen showed concentration-dependent suppression in cell survival (Fig.1A). The toxicity of EGCG and tamoxifen was significantly higher in T47D than HFF cells. The results are summarized in Table 2. The IC50 (concentration of 50% inhibition) values of EGCG in T47D cells were 46.88, 22.31 and 14.17 µM at 24, 48 and 72 h of treatment, respectively, as compared with 284.7 and 193.1 µM for the normal HFF cells at 48 and 72 h, respectively (p < 0. 05) (Fig.1B, Table 2). On the other hand, after 24, 48 and 72 h of treatment, the IC50 values of tamoxifen were found to be 12.11, 7.09 and 3.39 µM in T47D cells, respectively. These values for the normal HFF cells were reported to be about 44.97 and 32.75 µM at 48 and 72 h of exposure, respectively (p < 0.01) (Fig.1, Table 2).
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
EGCG concentration-dependently induced apoptotic cell death T47D cells were treated with different concentrations of EGCG (10-80 µM) or tamoxifen (20 µM) for up to 72 h; the expression of genes involved in survival and apoptosis (Bax, Bcl-2, p21, p53, PTEN, PI3K, AKT, caspase3, caspase9 and hTERT) was measured by real time PCR. EGCG or tamoxifen induced apoptosis as concentration-and time-dependently (Fig. 2). The highest apoptosis was related to the high concentration of EGCG (80 µM). EGCG at concentration of 80 µM significantly increased the expressions of p21, p53, PTEN, CASP9 and Bax while decreased the expressions of AKT and PI3K during 24 h (p < 0.05, Fig 2). EGCG increased the expressions of p21, p53, PTEN, CASP3, CASP9 and Bax while decreased the expressions of AKT and Bcl-2 in T47D cells during 48 and 72 h (p < 0.001 for both, Fig 2). These data showed a significant reduction in the PI3K/AKT pathway that finally increased Bax/Bcl-2 in both gene and protein expression levels. In gene expression of Bax/Bcl-2, EGCG (80 µM) significantly increased 8-fold vise 15-fold in tamoxifen (20 µM)–treated T47D cells during 72 h (p < 0.001) (Fig. 3A). In protein expression of Bax/Bcl-2, EGCG (80 µM) significantly increased 6-fold while this ratio augmented 10-fold in tamoxifen (20 µM)–treated T47D cells during 72 h (p < 0.001) (Fig. 3B). These data showed that EGCG (80 µM) significantly increased the genes of PTEN, CASP3, CASP9 and decreased AKT approximately equal to tamoxifen (p < 0.01). One of the pathways of cell aging that regulates apoptosis is telomerase pathway. In this study, the expression level of hTERT (catalytic subunit of telomerase) gene was measured in EGCGand tamoxifen-treated T47D cells for up to 72 h. EGCG (80 µM) significantly decreased 0.8, 0.4 and 0.3 gene expression of hTERT in 24, 48 and 72 h, respectively (p < 0.001). However, after 24, 48 and 72 h of treatment, gene expression of hTERT in tamoxifen (20 µM)-treated
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
cells was found to be 0.4, 0.3 and 0.3, respectively (p < 0.001). Therefore, EGCG downregulated hTERT gene as tamoxifen similar to T47D cells during 72 h of treatment (Fig. 2). Discussion Breast cancer is the most common cancer and, after lung cancer, is the second cause of cancer death in women. Defects in the apoptotic pathways are responsible for both the disease pathogenesis and its therapy resistance. It is thus a good candidate for treatment by proapoptotic agents [1]. Natural products have long been utilized to prevent and treat neoplasms; therefore, searching for natural products directed at the inducing apoptosis of cancer cells may be a great strategy for breast cancer chemoprevention [4]. EGCG as one of the most important polyphenols in green tea has been demonstrated to be a potent growth suppressor in a number of cell lines [18]. This study was the first to simultaneously investigate the effects of EGCG on ten genes involved in apoptotic and cellular aging in T47D breast cancer cell up to 72 h as compared with tamoxifen (as the positive control). We reported that EGCG effectively induced the apoptosis of T47D breast cancer cells via the up-regulation of pro-apoptotic genes such as p53, p21, casppase3, caspase9, Bax and PTEN and down-regulation of survival genes including PI3K, AKT and Bcl-2. Finally, the ratio of Bax/Bcl2 significantly increased in EGCG-treated cells, suggesting that EGCG modulates mitochondrial function to mediate cell death. In this study, we also showed that EGCG increased cellular aging via reducing of telomerase gene, this result is agreement with Meeran study [19]. The applied dose in this study is according to recent studies [20]. One thing to note is that the dose of EGCG used in this study would be considered as pharmacological therapeutic doses [21]. Previous studies have also reported the LD50 of EGCG to be 2g/kg [22].The pharmacokinetic and pharmacodynamics studies demonstrated that EGCG is safe as a chemotherapeutic agent [23].The cytotoxic effect of EGCG was more pronounced against the neoplastic cells than human normal fibroblast cells. It is noteworthy to mention that these effects are comparable with the standard anti-neoplastic
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
drug, tamoxifen, especially increasing CASP3, CASP9 and inhibiting telomerase in 72 h. Various clinical studies have revealed that treatment by EGCG inhibits tumor incidence and multiplicity in different organ sites such as the liver, stomach, skin, lung, mammary gland and colon [24-26]. In agreement with our findings, the study in 2006, EGCG increased the inhibitory effect of tamoxifen on the proliferation of human breast cancer cells [27]. Also, in animal experiments, treated groups with EGCG and tamoxifen had better effect in comparison with each group alone [27]. In another study, EGCG and tamoxifen exhibited concentrationdependent antiproliferative effects on MCF-7 cells [14, 28]. In the same study, the growthinhibitory effect of EGCG and tamoxifen was investigated on mice and the tumor incidences were decreased in the treated groups. Even more importantly, in the group treated with green tea extract and tamoxifen, no tumors were developed [28]. On the other hand, EGCG with tamoxifen investigated in a xenograft model of ER-negative breast cancer and observed tamoxifen alone was not effective in suppressing ER-negative tumor growth, whereas EGCG had a modest effect on tumor growth [29]. In contrast, EGCG had no effect of cytotoxic on T47D cells and only affected MCF-7 and HS578T cells, while in this cell line, the combination with 4-OHT did not increase cytotoxicity [14]. In MDA-MB-231 cells, EGCG produced a greater cytotoxic effect than 4-OHT and the combination of the two resulted in synergistic cytotoxicity [14, 30]. Pharmacokinetic study of EGCG and tamoxifen suggested that, since 4OHT and EGCG had a glucuronide structure, the combination of tamoxifen and EGCG might increase tamoxifen cytotoxicity [31]. In the research, this result was proven that EGCG significantly increased the AUC 0– ∞ and C max of oral tamoxifen in rats [32]. In conclusion, our results demonstrated that EGCG could induce apoptosis in a time- and concentrationdependent manner via inhibiting telomerase and PI3K/AKT pathways and increasing p53 and Bax/Bcl-2 in breast T47D cancer cell while posing no significant toxic effects on normal cells. The precise signaling pathway by EGCG that could induce apoptosis needs further research.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
EGCG has a great potential in cancer prevention because of its safety, low-cost and bioavailability. Therefore, non-toxic natural agents could be useful either alone or in combination with conventional therapeutics for the prevention of tumor progression and/or treatment of human malignancies. On the other hand, the inhibition of telomerase by EGCG could provide a safe and effective therapy for breast cancer. Funding acknowledgement This work was supported by a grant from the Vice Chancellor for Research and Technology, Jahrom University of Medical Sciences, Jahrom, Iran.
Authors and contributions Design study and collection data: M.M.; Analysis and interpretation of data: S.E., H.R.; Writing of manuscript and decision to submit the article for publication: A.H., M.M.
References: 1. Mousavi SM, Gouya MM, Ramazani R, Davanlou M, Hajsadeghi N, Seddighi Z: Cancer incidence and mortality in Iran. Ann Oncol, 2009, 20, 556-63. 2. Ahmad N, Cheng P, Mukhtar H: Cell cycle dysregulation by green tea polyphenol epigallocatechin-3-gallate. Biochem Biophys Res Commun, 2000, 275, 328-34. 3. Xiang L-P, Wang A, Ye J-H, Zheng X-Q, Polito CA, Lu J-L, et al.: Suppressive effects of tea catechins on breast cancer. Nutrients, 2016, 8, 458. 4. Surh Y-J: Cancer chemoprevention with dietary phytochemicals. Nat Rev Cancer, 2003, 3, 768-80. 5. Teiten M-H, Gaascht F, Dicato M, Diederich M: Anticancer bioactivity of compounds from medicinal plants used in European medieval traditions. Biochem Pharmacol, 2013, 86, 123947. 6. Shu L, Cheung K-L, Khor TO, Chen C, Kong A-N: Phytochemicals: cancer chemoprevention and suppression of tumor onset and metastasis. Cancer Metastasis Rev, 2010, 29, 483-502. 7. Saklani A, Kutty SK: Plant-derived compounds in clinical trials. Drug Discov Today, 2008, 13, 161-71. 8. Gupta S, Hussain T, Mukhtar H: Molecular pathway for (−)-epigallocatechin-3-gallateinduced cell cycle arrest and apoptosis of human prostate carcinoma cells. Arch Biochem Biophys, 2003, 410, 177-85.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
9. Thielecke F, Boschmann M: The potential role of green tea catechins in the prevention of the metabolic syndrome–a review. Phytochemistry, 2009, 70, 11-24. 10. Xiao J, Ho CT, Liong EC, Nanji AA, Leung TM, Lau TYH, et al.: Epigallocatechin gallate attenuates fibrosis, oxidative stress, and inflammation in non-alcoholic fatty liver disease rat model through TGF/SMAD, PI3 K/Akt/FoxO1, and NF-kappa B pathways. Eur J Nutr, 2014, 53, 187-99. 11. Yang CS, Landau JM, Huang M-T, Newmark HL: Inhibition of carcinogenesis by dietary polyphenolic compounds. Annu Rev Nutr, 2001, 21, 381-406. 12. Li M, Liu J-T, Pang X-M, Han C-J, Mao J-J: Epigallocatechin-3-gallate inhibits angiotensin II and interleukin-6-induced C-reactive protein production in macrophages. Pharmacol Rep, 2012, 64, 912-8. 13. Zhou J, Farah BL, Sinha RA, Wu Y, Singh BK, Bay B-H, et al.: Epigallocatechin-3-gallate (EGCG), a green tea polyphenol, stimulates hepatic autophagy and lipid clearance. PLoS One, 2014, 9, e87161. 14. Zeng L, Holly JM, Perks CM: Effects of physiological levels of the green tea extract epigallocatechin-3-gallate on breast cancer cells. Front Endocrinol, 2014, 5, 61. 15. Hosseini A, Shafiee-Nick R, Mousavi SH: Combination of Nigella sativa with Glycyrrhiza glabra and Zingiber officinale augments their protective effects on doxorubicin-induced toxicity in h9c2 cells. Iran J Basic Med Sci, 2014, 17, 993. 16. Pfaffl MW: Relative quantification. Real-time PCR, 2006, 63, 63-82. 17. Sedghy F, Sankian M, Moghadam M, Ghasemi Z, Mahmoudi M, Varasteh A-R: Impact of traffic-related air pollution on the expression of Platanus orientalis pollen allergens. Int J Biometeorol, 2017, 61, 1-9. 18. Braicu C, Pileczki V, Pop L, Petric RC, Chira S, Pointiere E, et al.: Dual targeted therapy with p53 siRNA and Epigallocatechingallate in a triple negative breast cancer cell model. PLoS One, 2015, 10, e0120936. 19. Meeran SM, Patel SN, Chan T-H, Tollefsbol TO: A novel prodrug of epigallocatechin-3gallate: differential epigenetic hTERT repression in human breast cancer cells. Cancer Prev Res, 2011, 4, 1243-54. 20. Belguise K, Guo S, Sonenshein GE: Activation of FOXO3a by the Green Tea Polyphenol Epigallocatechin-3-Gallate Induces Estrogen Receptor α Expression Reversing Invasive Phenotype of Breast Cancer Cells. Cancer Res, 2007, 67, 5763-70. 21. Chen L, Lee M-J, Li H, Yang CS: Absorption, distribution, and elimination of tea polyphenols in rats. Drug Metab Dispos, 1997, 25, 1045-50.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
22. Isbrucker R, Edwards J, Wolz E, Davidovich A, Bausch J: Safety studies on epigallocatechin gallate (EGCG) preparations. Part 2: dermal, acute and short-term toxicity studies. Food Chem Toxicol, 2006, 44, 636-50. 23. Dvorakova K, Dorr RT, Valcic S, Timmermann B, Alberts DS: Pharmacokinetics of the green tea derivative, EGCG, by the topical route of administration in mouse and human skin. Cancer Chemother Pharmacol, 1999, 43, 331-5. 24. Yang CS, Maliakal P, Meng X: Inhibition of Carcinogenesis by Tea*. Annu Rev Pharmacol Toxicol, 2002, 42, 25-54. 25. Yeh C, Chen W, Chiang C, Lin-Shiau S, Lin J: Suppression of fatty acid synthase in MCF7 breast cancer cells by tea and tea polyphenols: a possible mechanism for their hypolipidemic effects. The pharmacogenomics J, 2003, 3, 267-76. 26. Zhang G, Wang Y, Zhang Y, Wan X, Li J, Liu K, et al.: Anti-cancer activities of tea epigallocatechin-3-gallate in breast cancer patients under radiotherapy. Curr Mol Med, 2012, 12, 163-76. 27. Sartippour MR, Pietras R, Marquez-Garban DC, Chen H-W, Heber D, Henning SM, et al.: The combination of green tea and tamoxifen is effective against breast cancer. Carcinogenesis, 2006, 27, 2424-33. 28. Sakata M, Ikeda T, Imoto S, Jinno H, Kitagawa Y: Prevention of mammary carcinogenesis in C3H/OuJ mice by green tea and tamoxifen. Asian Pac J Cancer Prev, 2011, 12, 567-71. 29. Scandlyn M, Stuart E, Somers-Edgar T, Menzies A, Rosengren R: A new role for tamoxifen in oestrogen receptor-negative breast cancer when it is combined with epigallocatechin gallate. Br J Cancer, 2008, 99, 1056-63. 30. Chisholm K, Bray B, Rosengren R: Tamoxifen and epigallocatechin gallate are synergistically cytotoxic to MDA-MB-231 human breast cancer cells. Anticancer Drugs, 2004, 15, 889-97. 31. Qiao J, Gu C, Shang W, Du J, Yin W, Zhu M, et al.: Effect of green tea on pharmacokinetics of 5-fluorouracil in rats and pharmacodynamics in human cell lines in vitro. Food Chem Toxicol, 2011, 49, 1410-5. 32. Shin S-C, Choi J-S: Effects of epigallocatechin gallate on the oral bioavailability and pharmacokinetics of tamoxifen and its main metabolite, 4-hydroxytamoxifen, in rats. Anticancer Drugs, 2009, 20, 584-8. Figure legends
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
Figure 1A,B. Anti-proliferative effect of Epigallocatechin-3-gallate (EGCG) and tamoxifen on human breast cancer (T47D) and normal foreskin fibroblast cells (HFF). (A) T47D cells were treated with increasing concentrations of EGCG (10-80 µM) and tamoxifen (2.5-20 µM) for 24-72 h. (B) HFF cells were treated with increasing concentrations of EGCG (10-80 µM) and tamoxifen (2.5-20 µM) for 48 and 72 h. The percentage cell viability (quantitated by MTT assay) was normalized against the control. Mean and SEM of the three independent experiments were shown. *p < 0.05, **p < 0.01,
***
p < 0.001 as compared with coresponding
control value. Figure 2: Apoptotic effect of Epigallocatechin-3-gallate (EGCG) and tamoxifen on human breast cancer cell (T47D). Cells were treated with increasing concentrations of EGCG(10-80 µM) and tamoxifen (20 µM) for 24, 48 and 72 h. Then, expression level of apoptotic and survival genes (p53, p21, PTEN, CASP3, CASP9, PI3K, Bax, Bcl-2, AKT and hTERT) determined using real time PCR. Mean and SEM of the three independent experiments were shown. *p < 0.05, **p < 0.01, ***p < 0.001 as compared with coresponding control value. Table 1. GENE
BAX
FORWARD PRIMER
GCCTCCTCTCCTACTTTG
REVERSE PRIMER
CTCAGCCCATCTTCTTCC
GENBAK
PRODUT
CODE
SIZE (BP)
NM_0012
102
91428.1 BCL2
CCAAGAAAGCAGGAAACC
GGATAGCAGCACAGGATT
NM_0006
170
33.2 P21
AACGGCGGCAGACCAGCAT
GAGACTAAGGCAGAAGATGTA GAGCG
P53
GGAACTCAAGGATGCCCAG
CAAGAAGTGGAGAATGTCAGTC
NM_0003
150
89.4 NM_0011 26113.2
155
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells AKT
GCACCTTCATTGGCTACA
CCGCTCCGTCTTCATCAG
NM_0010
104
14431.1 PI3K
TGCGGAAACTGACGGACGA
CGGAGCGGAGGTGCCAGAA
TGA CASP3
NM_0050
162
26.3
AGAACTGGACTGTGGCATT
GCTTGTCGGCATACTGTTT
NM_0043
191
46.3 CASP9
CTTTGTGTCCTACTCTACTT
AACAGCATTAGCGACCCTA
TCC PTEN
NM_0329
151
96.3
AGTAGAGGAGCCGTCAAAT
ATCAGAGTCAGTGGTGTCAG
C
NM_0003
109
14.4
HTER
TGTACTTTGTCAAGGTGG
GCTGGAGGTCTGTCAAGGTA
NM_001
T
ATGTGA
GAG
193376.1
GAPD
GAAGTCAGGTGGAGCGAGG
TGGGTGGAATCATATTGGAACA
NM_0012
T
H
195
200
56799.2
Table 2. HFF
Cell lines
T47D
Treatments
48 h
72 h
24 h
48 h
72 h
EGCG (µM)
284.7
193.1
46.88
22.31
14.17
Tamoxifen (µM)
44.97
32.75
12.11
7.09
3.39
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells
Figure 3A,B: The effect of Epigallocatechin-3-gallate (EGCG) and tamoxifen on expression of Bax/Bcl-2 ratio in human breast cancer cell (T47D). (A) The graph shows the gene expression of Bax/Bcl-2 in EGCG(10-80 µM)- and TAM(20 µM)- treated T47D cells during 24-72 h. (B) This panel shows the protein expression of Bax/Bcl-2 that determined by western blot and Quantitative analysis was done by Image J software. Mean and SEM of the three independent experiments were shown. *p < 0.05, ***p < 0.001 as compared with coresponding control value.
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells Figr-1
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells Figr-2
Apoptotic effects of Epigallocatechin-3-gallate on T47D cells Figr-3