albumin mouse to study the pharmacokinetics of albumin-linked drugs

Journal of Controlled Release 223 (2016) 22–30

Contents lists available at ScienceDirect

Journal of Controlled Release journal homepage: www.elsevier.com/locate/jconrel

Generation of a double transgenic humanized neonatal Fc receptor (FcRn)/albumin mouse to study the pharmacokinetics of albumin-linked drugs Dorthe Viuff a, Filipa Antunes b, Leslie Evans b, Jason Cameron b, Hans Dyrnesli c, Birgitte Thue Ravn a, Magnus Stougaard d, Kader Thiam e, Birgitte Andersen a, Søren Kjærulff a, Kenneth A. Howard c,⁎ a

Novozymes Biopharma, Novozymes A/S, Brudelysvej 32, 2880 Bagsværd, Denmark Novozymes Biopharma UK Ltd., Castle Court, 59 Castle Boulevard, NG7 1FD Nottingham, United Kingdom c Interdisciplinary Nanoscience Center (iNANO), Department of Molecular Biology and Genetics, Aarhus University, 8000 Aarhus C, Denmark d Pathology Institute, Aarhus University Hospital, 8000 Aarhus C, Denmark e genOway, 69362, Lyon, Cedex 07, France b

a r t i c l e

i n f o

Article history: Received 6 November 2015 Received in revised form 9 December 2015 Accepted 12 December 2015 Available online 14 December 2015 Keywords: Albumin Drug delivery Neonatal Fc receptor Protein engineering Animal model Drug development

a b s t r a c t Human serum albumin (HSA) is a natural carrier protein possessing multiple ligand binding sites with a plasma half-life ~19 days, facilitated by interaction with the human neonatal Fc receptor (FcRn), that promotes it as a highly attractive drug delivery technology. A lack of adequate rodent models, however, is a major challenge in the preclinical development of albumin-linked therapeutics. This work describes the first double transgenic mouse model bearing both human FcRn and HSA genes (hFcRn+/+, hAlb+/+) under the control of an endogenous promoter. Human FcRn was shown by immunohistochemical and qPCR analysis to be ubiquitously expressed in the major organs. Physiological levels of HSA were detected in the blood that exhibited similar FcRn binding kinetics to recombinant or human serum-derived HSA. The circulatory half-life (t1/2) was shown to be dependent on FcRn binding affinity that increased from low affinity (t1/2 29 h), to wild type (t1/2 50 h), to high affinity (t1/2 80 h) variants, that validates the application of the model for optimizing the pharmacokinetics of drug carriers who's circulatory half-life is dependent in some manner upon interaction with endogenous FcRn. This study presents a novel mouse model that better mimics the human physiological conditions and, thus, has potential wide applications in the development of albumin-linked drugs or conventional drugs whose action is influenced by reversible binding to endogenous HSA. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Human serum albumin (HSA) is a natural carrier protein possessing multiple ligand binding sites and a plasma half-life ~ 19 days [1] that promotes it as a highly attractive drug delivery technology [2–4]. The ability of albumin to reversibly bind to conventional drugs such as warfarin and diazepam [5], has been further exploited in the specific design of albumin-binding drugs such as the insulin analog detemir (Levemir®) [6] and glucagon-like type-1 (GLP-1) agonist liraglutide (Victoza®) for extended therapeutic effects in diabetes. As an alternative strategy, a nanoparticle albumin bound paclitaxel (nab-paclitaxel) system has been approved for the treatment of cancer [7]. As a genetic fusion to HSA, albiglutide (Eperzan®, Tanzeum®) has been successfully employed as is a once-weekly GLP-1 receptor agonist approved for the treatment of type 2 diabetes in several regions, including the EU and the USA [8]. Ligand binding sites, the availability of a available

⁎ Corresponding author.

http://dx.doi.org/10.1016/j.jconrel.2015.12.019 0168-3659/© 2015 Elsevier B.V. All rights reserved.

free thiol at cysteine 34 (Cys34), and recombinant albumin fusions allow physical, chemical and genetic engineered drug attachment strategies, respectively, offering extreme versatility of designs and therapeutic approaches. The long circulatory half-life of albumin is thought to be facilitated by Megalin–Cubilin receptor-mediated renal rescue [9] and engagement with the endothelial and epithelial cellular recycling neonatal Fc receptor (FcRn) [10]. FcRn is a heterochimeric receptor, comprising of a major histocompatibility class I (MHC-I) heavy α-chain (referred to as the Fc receptor, IgG, α-chain transporter (FCGRT)) and a noncovalent associated β2-microglobulin (β2m) light chain. It has been shown to be responsible for immunoglobulin G (IgG) protection from lysosomal degradation by diversion within an endosomal cellular recycling pathway following a pH-dependent FcRn-interaction [11–13]. Similarly, the FcRn-engagement of albumin has been shown to exhibit increased binding and recycling at the endosomal pH range with subsequent protection from degradation [10]. Furthermore, recombinant human albumins engineered for enhanced FcRn binding [14] exhibit extended blood circulation profiles in mice and non-human

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30

primates [15] that strongly supports a FcRn-mediated recycling mechanism, and offers, an elegant approach to tune the therapeutic profile of albumin-linked drugs. Murine models are a preferred choice for earlyphase drug development due to ease of handling, cost, defined genetic background and ethical concerns in the use of primates. Wild type mice have traditionally been used as a convenient first-line model for investigating the pharmacokinetics (PK) of HSA-linked drugs. The reported weak interaction of HSA for murine FcRn [16], however, suggests strong competition between endogenous MSA and HSA-linked test compounds and a concomitant reduction in circulatory half-life of the latter. A range of transgenic mouse models expressing the human FcRn α-chain have been generated for determining the PK of mAbs, Fc- and HSA-based therapeutics, with Tg276 and Tg32 the most commonly used [17]. Both models maintain the mouse β2m gene but have the endogenous mouse FcRn α gene replaced by its human counterpart, either under the control of the native human promoter, in the case of Tg32, or the chicken β-actin promoter for Tg276. The usefulness of these models for studying the PK of HSA-based drugs, however, has been questioned, based on possible competition from the endogenous MSA pool for the human FcRn receptor due to increased affinity of MSA for hFcRn [16]. Furthermore, a lack of an endogenous mouse promoter-driven FcRn expression could lead to non-native distribution. Moreover, the absence of an endogenous HSA pool, known to reversibly bind to multiple ligands, reduces the relevance to human physiological conditions encountered by a potential therapeutic. Motivated by a lack of suitable models, in this work for the first time, we have generated a double transgenic humanized FcRn α-chain and albumin (hFcRn+/+, hAlb+/+) mouse that offers a more physiologically relevant model for the preclinical study of HSA-based drugs. Analysis of transgenic progenitor animals showed ubiquitous expression of human FcRn, whilst, mature HSA was detected in the mouse and exhibited similar FcRn binding kinetics to that observed with recombinant and serum-derived HSA. The use of this model for investigation and optimization of FcRn-dependent pharmacokinetics was validated using engineered albumins with differing FcRn affinities that promote its application for preclinical development of albumin-linked drugs.

2. Materials and methods 2.1. Generation of a double humanized FcRn and albumin (hFcRn+/+, hAlb+/+) mouse The model design and generation was performed by genOway (Lyon, France). Generation of two independent humanized mouse lines, one targeting FcRn α-chain (referred throughout the text as hFcRn) located on chromosome 7, and the other, targeting albumin located on chromosome 5 was performed. The humanization of the FcRn was performed by using in-frame insertion of the hFcRn cDNA into the mouse exon 2 so as to keep it under the control of the mouse endogenous promoter (Fig. 1A). Homologous recombination in embryonic stem cells was performed and recombined embryonic stem cells were injected into mouse blastocysts. Male chimeras were breed with C57BL/6 females generating F1 generation. Genotyping using PCR, sequencing and Southern blot ensured the insertion of the hFcRn cDNA in the mouse locus under the control of the mouse promoter and 5′ UTR. The expression analysis performed by RT-qPCR validates the expression of hFcRn. The humanization of albumin was performed by in-frame insertion of the human albumin cDNA into the mouse albumin gene where the human albumin is under control of the endogenous promoter (Fig. 1B). The mouse signal peptide was conserved for enhanced expression and correct maturation of the human albumin protein. Breeding of the 2 lines was performed to obtain a double homozygous humanized line. All mice were genotyped using PCR and Southern blot analysis (Fig. 1C).

23

2.2. Targeting vector constructs The hFcRn gene-targeting vector was constructed from a genomic C57BL/6 mouse strain DNA. Human FcRn cDNA was inserted into mouse FcRn exon 2 with a Neomycin cassette (selection marker flanked by FRT sites for its further Flp-mediated excision). This strategy is based on an in-frame fusion of the human coding sequences with the murine ATG methionine codon located in the exon 2. This results in the deletion of the murine exon 2 coding sequence and leads to the disruption of the murine gene (Fig. 1A). Moreover, the exon 1 and the humanized exon 2 were flanked by loxP sites enabling the access to their constitutive or conditional deletion through Cre-recombinase action. The HSA gene-targeting vector was constructed from genomic C57BL/6 mouse strain DNA. The humanized HSA cDNA was inserted in frame with mouse ATG translation initiation site in exon 1. The humanized cDNA contains a chimeric sequence corresponding to mouse signal peptide, conserved to enhance expression and enable the correct processing of human albumin, followed by the human sequence corresponding to the whole mature protein. A FRT flanked Neomycin cassette (selection marker) was inserted upstream from exon 1 and further removed using Flp-mediated excision (Fig. 1B).

2.3. Screening of humanized FcRn and humanized HSA targeted ES cell clones Linearized targeting vectors were transfected into C57BL/6 ES cells (genOway, Lyon, France) according to genOway's electroporation procedures (40 × 106 ES cells in presence of 100 μg of linearized plasmid, 260 Volt, 500 μF). Positive selection was started 48 h after electroporation, by addition of 200 μg/mL of G418 (150 μg/mL of active component, Life Technologies, Inc.). Resistant clones were isolated and amplified in 96-well plates. Duplicates of 96-well plates were made. The set of plates containing ES cell clones amplified on gelatine were genotyped by both PCR and Southern blot analysis. For PCR analysis of humanized FcRn and HSA clones, 2 primer pairs were designed to amplify sequences spanning the 3′ homology regions: Humanized FcRn clones: A primer pair was designed to specifically amplify the targeted FcRn locus: 0067-Neo-10143sa: 5′-GAACTTCCTGACTAGGGGAGGAGTAGAAGG-3′ 91849sa-VIU1: 5′-ATGAGCACACACACAACTCAGATCCAGA-3′ Humanized HSA clones: A primer pair was designed to specifically amplify the targeted Albumin locus. 37138sa-KOS10a: 5′-ACATTTGAGTTGCTTGCTTGGCACTG-3′. 37139sa-KOS10a: 5′-AAGAAAATCTGTCCGGTCTTAGCATCTAGCTAC-3′. Targeted loci were confirmed by Southern blot analysis using internal and external probes on both 5′ and 3′ ends. 2 clones were identified as correctly targeted at the mouse FcRn and MSA locus, respectively.

2.4. Generation of chimeric mice and breeding In both cases, clones were microinjected into C57BL/6 blastocysts and the resulting male chimeras were bred to C57BL/6 mice expressing Flprecombinase to remove the Neomycin cassette (Fcgrt tm1(hFCGRT)geno and Albtm1(hALB)genomouse lines). FcRn humanized animals were validated by Southern blot analysis using a 3′ external probe: wild type allele gave rise to a 10.6-kb signal while Fcgrt tm1(hFCGRT)geno allele gave rise to a 5.9-kb signal (Fig. 1). HSA humanized mice were also validated by Southern blot analysis using a 3′ external probe: wild type allele gave rise to a 3.9-kb signal while Albtm1(hALB)geno allele gave rise to a 7-kb signal (Fig. 1). Animals were interbred to generate the double humanized FcRn/HSA mouse model.

24

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30

Fig. 1. A) Schematic representation of the humanized FcRn locus and Southern blot screening strategy. B) Schematic representation of the humanized HSA mouse model and Southern blot screening strategy. Diagrams are not depicted to scale. Hatched rectangles represent coding sequences, gray rectangles indicate non-coding exon portions, solid lines represent chromosome sequences. FRT and LoxP sites are represented by double red triangles and blue triangles, respectively. C) Representative Southern blot screening of the homozygous humanized FcRn/HSA Knock-in mice (FcRn/HSA Hum/Hum). The genomic DNA of the tested animals was compared to wild type DNA (C57BL/6). The NsiI or AflII digested DNAs were blotted on nylon membrane and hybridized with 2 external probes.

2.5. RNA isolation and cDNA synthesis from the double transgenic (hFcRn+/+, hAlb+/+) and wild type mice

2.6. Quantitative PCR analysis of the double transgenic (hFcRn+/+, hAlb+/+) and wild type mice

Mice tissue sections were RNAlater (Life Technologies Europe, Naerum, Denmark) treated and frozen until RNA extraction was performed. Pinhead sized tissue pieces were added to tubes containing 300 μL RTL buffer (Qiagen), cooled to 4 °C and homogenized using a MagNA Lyser bead mill (Roche) for 20 s at 6500 rpm. The samples were then spun at maximum speed and the supernatant removed for RNA extraction using the QIAsymphony SP with the QIAsymphony RNA Kit (Qiagen) according to the manufacturer's instructions. The purified RNA was further DNase treated by adding 3 u DNaseI (Life technologies) and 1 μL 10 × DNaseI reaction buffer per 10 μL RNA. The samples were incubated for 15 min at 37 °C, after which, 1 μL EDTA 25 mM was added and the samples incubated for 10 min at 65 °C before storage at − 80 °C until used. cDNA synthesis was performed using SuperScript II cDNA synthesis kit (Life technologies) using random hexamers and 40 ng RNA in 20 μL reactions according to the manufacturer's instructions.

Quantitative PCR was performed using a LightCycler 480 (Roche) using the LightCycler 480 SYBR Green I Master (Roche) reagent system. The primers were purchased from Sigma-Aldrich and the sequences of the primers used were hFcRn-Fw: 5′-AAACCTGGAGTGGAAGGAGC and hFcRn-Rv: 5′-GGTAGAAGGAGAAGGCGCTG for amplification of hFcRn and moHPRT-Fw: 5′-CAGTCCCAGCGTCGTGATT and moHPRT-Rv: 5′GAGCAAGTCTTTCAGTCCTGTC for amplification of moHPRT. The program used for the amplification was: initial denaturation 10 min at 95 °C (ramp rate 4.4 °C/s) followed by 45 cycles of denaturation for 10 s at 95 °C (ramp rate 4.4 °C/s) and combined annealing and extension for 30 s at 68 °C (ramp rate 2.2 °C/s). After a final prolonged extension of 2 min at 68 °C, melting curve analysis was performed from 68 °C to 99 °C (ramp rate 0.08 °C/s). A six step dilution series of the cDNA pool was performed with five-fold dilutions with a starting amount of cDNA corresponding to 80 ng RNA and used for internal standard curves in all runs. For all samples, cDNA corresponding to 4 ng RNA was used as template in the qPCR in a total volume of 20 μL.

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30

2.7. Immunohistochemical analysis of the double transgenic (hFcRn+/+, hAlb+/+) and wild type mice Mouse tissue was formalin fixed and paraffin embedded (FFPE). FFPE mice tissue sections were dewaxed (Tissue Clear Xylene substitute, Tissue-Tek/Sakura Finetek), rehydrated through graded alcohols to water before antigen retrieval in citrate buffer pH 6 by heating in MW at 800 W for 8 min, and followed by MW at 640 W for 2 × 14 min and finally cooling for 20 min. Subsequently the sections was blocked using protein block (Dako) and stained using the polyclonal antihFcRn (HPA012122, Atlas) in dilution 1:200. For visualization EnVision + System-HRP (DAB) (Dako) was used as the detection system. The staining was performed using an Autostainer Link 48 (Dako). 2.8. Construction and production of human recombinant albumin and albumin variants HSA and albumin variants LB (with low binding affinity to hFcRn; HSA K500A), and HB (with high binding affinity to hFcRn; HSA K573P) were constructed with N-terminal fusions of a c-Myc tag (EQKLISEEDL) and a linker sequence (GGSGGSGGS) before the albumin essentially as previously described [18]. Protein samples were produced by secretion from yeast followed by a 2 step purification using AlbuPure® and diethylaminoethyl weak anion exchange Sepharose Fast Flow (GE Healthcare) as described previously [15]. 2.9. Determination of blood chemical composition and albumin levels Serum was collected from 3 non-fasting females (hFcRn+/+, hAlb+/+) and 2 females and 1 male (C57BL/6) at 15–21 weeks of age, performed at Research Animals Diagnostic Services of Charles River RADS Bioanalytic, Wilmington, MA, USA for blood chemical analysis using an Olympus AU640e Clinical Chemistry Analyzer. Bioanalysis of serum samples for albumin was performed employing polyclonal antibodies against cMyc (ab9132, Abcam) and biotinylated monoclonal antibodies against human serum albumin ([AL01] ab81426 Abcam). ELISA plates were coated with cMyc antibodies overnight, washed and blocked with 5% (w/v) skimmed milk powder (Sigma) and 1% (v/v) Tween-20 in PBS. Samples, calibrators and controls were prepared in a 10% serum matrix in PBS, added to the plates and incubated for 1 h. Detection was performed using anti-human serum albumin antibodies along with a streptavidin-HRP complex. The signal was developed using 3,3′,5,5′-tetramethylbenzidine (TMB) and the plates were read at 450 nm. 2.10. Albumin–FcRn binding kinetics Albumin from human serum (Sigma H4522), mouse serum (Sigma M5905) and serum from the transgenic mouse (hFcRn+/+, hAlb+/+) were isolated by AlbuPure® matrix (ProMetic BioSciences) chromatography, and the albumins were eluted with 50 mM ammonium-acetate, 10 mM octanoate pH 7.0 essentially as described previously [18]. Biolayer interferometry on an Octet Red96 system (PALL/ForteBio) was used to characterize the binding kinetics of albumin purified from serum as well as the recombinant albumins used for the PK study. Biotinylated soluble human-FcRn, mouse-FcRn and the chimeric human– mouse heterodimer FcRn receptor, consisting of the α-chain and the β2m, were purchased from Immunitrack, Denmark, and immobilized on streptavidin coated biosensors (PALL/ForteBio) in PBS pH 7.4 supplemented with 0.01% Tween-20. The sensors were pre-blocked to minimize non-specific binding by 5 min soaking in albumin diluted to 0.5 mg/mL in PBS pH 7.4, followed by 5 min rinse in the same buffer without albumin, and subsequently in Milli Q water. The sensors were prepared for storage by soaking in 15% sucrose and air drying. For kinetic characterization a 7-step two fold dilution series was prepared in 25 mM Na-acetate, 25 mM NaH2PO4, 150 mM NaCl, 0.01%

25

Tween-20 at pH 5.5. Binding kinetics were performed at 30 °C with a 120 s association phase and 300 s dissociation phase. The sensors were regenerated with PBS pH 7.4 supplemented with 0.01% Tween20 and equilibrated in 25 mM Na-acetate, 25 mM NaH2PO4, 150 mM NaCl, 0.01% Tween-20 pH 5.5 between samples. All data were referenced with FcRn–streptavidin sensors in buffer without albumin. Data analysis was performed using the Octet data analysis software ver. 8.0 (PALL/ForteBio) using curve fitting to a 1–1 model for estimation of kinetic parameters. 2.11. Immunoglobulin G (IgG)–FcRn binding kinetics IgG from human serum (Sigma I4506) and mouse serum (Sigma I5381) were purchased for kinetic characterization of the IgG–FcRn interaction. The assay was performed essentially as described for the albumin-interaction assay, except that pH for association and dissociation was changed to pH 6.0 and the dissociation phase was prolonged to 15 min. Data analysis was performed using the Octet data analysis software ver. 8.0 (PALL/ForteBio) using curve fitting to a 2–1 model for estimation of kinetic parameters for the human and chimeric human–mouse-FcRn, while a 1–1 model was used for the mouse-FcRn as the two very high affinities were impossible to model in this assay set-up. 2.12. Albumin pharmacokinetics in hFcRn+/+, hAlb+/+ and wild type mice The pharmacokinetic (PK) study performed at Charles River Laboratories (Lyon, France) was approved by the ethical committees at both Charles River (Lyon, France) and Novozymes A/S. The PK of wild type albumin, LB and HB were investigated in the hFcRn+/+, hAlb+/+ mice (not blinded, males and females, 15–21 weeks, N 17 g body weight on day of dosing). Three groups of 5 mice were included in the study. The mice were acclimatized for more than 2 weeks before the pre-dose sampling procedure was performed on day 7 and randomized to the treatment groups ensuring a similar pattern of sex, age and weight in each group. At day 0, test compounds were injected intravenously in the tail vein at a dose of 10 mg/kg with a volume of 5 mL/kg body weight. Blood sampling was performed on submandibular vein on non-anesthetized mice at 10 min, 12 h, 120 h, 192 h, 264 h and 504 h post-dosing. Vasodilation was obtained by heating the animal under a light source for ten minutes prior to injection. Thirty microliters of full blood were drawn at each sample point except for the blood chemistry procedure, where the mice were bled by intracardiac puncture after being anesthetized with isoflurane and euthanized by increasing CO2 concentration. Upon collection, the blood samples were kept at cool temperature for a maximal duration of 3 h followed by centrifugation at 14,000 g for 15 min at 20 °C and stored at −20 °C prior to bioanalysis. For PK evaluation, albumin serum concentrations were determined by ELISA as described above, plotted for each animal, and individual profiles were subjected to Non-Compartmental Analysis using PhoenixWinNonLin software (version 6.3). 3. Results 3.1. Molecular characterization of the double transgenic model The expression of hFcRn in double transgenic (hFcRn+/+, hAlb+/+), and wild type was determined in the duodenum, jejunum, ileum, liver, large intestine, kidney, and lung at the RNA and protein level by qPCR and immunohistochemistry (IHC) analysis, respectively. RNA was extracted from frozen tissue biopsies, reverse transcribed, and used as a template in a qPCR hFcRn-specific reaction. The obtained data was normalized to the large intestine and depicted as mean hFcRn expression (Fig. 2). hFcRn was transcribed in all tissues, with highest levels exhibited in the duodenum and kidney. The specificity of the human primers towards hFcRn was demonstrated by no signal detected in wildtype

26

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30

Fig. 2. Molecular characterization of the hFcRn+/+, hAlb+/+ mice. hFcRn expression in tissue samples from the hFcRn+/+, hAlb+/+ mice analyzed by qPCR (upper panel). Tissues assayed are duodenum (Du), jejunum (Je), ileum (iLe), large intestine (Li), liver (H), kidney (K), and lung (Lu). Expression is normalized to HPRT and arbitrarily normalized to expression in large intestine (Li). Primers used were specific to hFcRn, with no signal was detected in wild type mice. Data presented as mean ± SD, n = 3. Lower panel: Immunohistochemical staining for hFcRn in hFcRn+/+, hAlb+/+ mice (large image) and wild type (small insert) mice. A–G is representative pictures from the staining of sections from different organs A) duodenum, B) jejunum, C) ileum, D) large intestine, E) liver, F) kidney, and G) lung. No cross reactivity to mouse FcRn was seen in the wild type mice (small insert). Scale bar = 500 µm.

mice. IHC of the hFcRn+/+, hAlb+/+, showed hFcRn expression in the duodenum, jejunum, ileum, liver, large intestine, kidney, whereas, minimal was detected in the lung (Fig. 2). Furthermore, hFcRn protein was primarily observed as a granular cytoplasmic or membranous staining in the duodenum, the jejunum, the ileum, and the colon predominantly in the epithelium, in the tubules of the kidney, and in the lung, predominantly in the mesothelium and bronchiole but not alveoli, and in the liver restricted to the hepatocytes. In contrast, none or very weak hFcRn staining was found in the wild type counterparts (Fig. 2 inserts). Faint detection in the wild type tissue is most probably due to non-specific staining. The clinical blood chemical evaluation involved 31 parameters for which the mean values ± SD from wild type mice and hFcRn+/+, hAlb+/+ mice are given in Table 1. All parameters for hFcRn+/+, hAlb+/+ mice were showed to be comparable to wild type, within the normal physiological range. The human albumin levels in the hFcRn+/ + , hAlb+/+ and mouse albumin in the wild type were within the normal range of 1.5–6 g/dL (1.7+/−0.1 and 2.8+/−0.2 g/dL, respectively). 3.2. Binding kinetics and pharmacokinetics The binding kinetics of recombinant albumin variants, mouse and human serum-derived albumins to soluble recombinant human FcRn,

chimeric human–mouse heterodimer FcRn and mouse FcRn were determined (Table 2). HSA harvested from the hFcRn+/+, hAlb+/+ (hFcRn+/+, hAlb+/+, sHSA) mouse showed similar binding affinity to serum-derived HSA (sHSA) and recombinant native sequence HSA (rHSA) for the human FcRn receptor, 501.9 ± 101.2 (nM), 641.1 ± 89.7 (nM), 797.9 ± 155.0 (nM), respectively. Both the serum-derived mouse serum albumin (sMSA) and recombinant MSA (rMSA) binding affinities were greater against the human FcRn receptor (87.8 ± 5.8 (nM) and 74.6 ± 13.4 (nM), respectively, than the aforementioned human variants. As expected, binding of the sMSA and rMSA to the human receptor was greater than to the mouse FcRn receptor (383.0 ± 56.1 and 314.9 ± 12.1 (nM), respectively) in accordance with previous reports [16]. Surprisingly, no major difference was observed between binding kinetics of HSA (sHSA (hFcRn+/+, hAlb+/+), sHSA, rHSA) or sMSA to the chimeric human–mouse FcRn (498.4 ± 55.6, 672.4 ± 116.8, 701.2 ± 136.5, 657.7 ± 56.7 (nM), respectively). The low affinity for all the human variants to the mouse FcRn substantiates the necessity for a model expressing human FcRn. With regard to the engineered albumins, the LB mutant showed poor binding against all the receptors, whereas, high binding was observed for the HB mutant, to both human (31.5 ± 9.8 (nM)) and human-mouse FcRn receptors (50.2 ± 12.4 (nM)). Mouse IgG bound with a weaker affinity to human FcRn and human–mouse

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30 Table 1 Blood chemistry analysis of hFcRn+/+, hAlb+/+ and wild type mice. Clinical chemical parameters of wild type mice (N = 25) and the double transgenic mice (N = 22). Serum concentrations are given as mean ± standard deviations. Standard range provided by Charles River, Lyon, France. hFcRn+/+/hAlb+/+ Wild type mouse

Parameter

Unit

Cholesterol. total Triglycerides Cholesterol. high density lipoprotein Cholesterol. low density lipoprotein Free fatty acid (non-esterified fatty acid. NEFA) Alanine aminotransferase Aspartate aminotransferase Alkaline phosphatase Amylase Lactose dehydrogenase Lipase Glutamate dehydrogenase Creatine kinase Glucose Phosphorus Calcium. total Magnesium Iron Iron binding capacity. total Bilirubin. total Bilirubin. direct Bicarbonate Protein. total Albumin Globulin IgG Urea nitrogen Creatinine Sodium Potassium Chloride

mg/dL mg/dL

159 ± 36 177 ± 52

78 ± 16 108 ± 33

mg/dL

88 ± 22

52 ± 14

2–200

mg/dL

11 ± 3

8±1

7–400

mEq/L

1.3 ± 0.6

1.5 ± 0.4

Standard range 25–700 10–1000

0–4

U/L

69 ± 52

39 ± 35

3–500

U/L

163 ± 76

137 ± 142

3–1000

U/L U/L U/L U/L

86 ± 32 584 ± 245 594 ± 203 109 ± 237

54 ± 16 483 ± 158 563 ± 390 48 ± 20

5–1500 10–2000 25–1200 3–600

μg/dL

48.9 ± 73.1

10.9 ± 11.2

0–50

U/L mg/dL mg/dL mg/dL mg/dL μg/dL

177 ± 120 226 ± 24 6.3 ± 0.7 8.7 ± 0.4 3 ± 0.2 162 ± 58

486 ± 1023 226 ± 39 7.1 ± 1 8.9 ± 0.4 2.8 ± 0.2 114 ± 27

10–2000 10–800 1–20 4–18 0.5–8 10–1000

μg/dL

573 ± 111

242 ± 121

77–694

0.3 ± 0.1 0.05 ± 0.02 12.8 ± 2.8 4.7 ± 0.3 2.8 ± 0.2 1.9 ± 0.2 0.25 ± 0.13 24 ± 3 0.2 ± 0.0 146.1 ± 6.1 4.9 ± 0.7 113.3 ± 5.3

0.1–30 0–10 2–45 3–12 1.5–6 0–10.5 − 2–130 0.2–25 50–200 1–10 50–200

mg/dL 0.2 ± 0.1 mg/dL 0.04 ± 0.02 mEq/L 12.9 ± 3.4 g/dL 3.9 ± 0.2 g/dL 1.7 ± 0.1 g/dL 2.2 ± 0.2 g/dL 0.063 ± 0.036 mg/dL 24.2 ± 3.6 mg/dL 0.2 ± 0.0 mEq/L 152.7 ± 3.5 mEq/L 4.86 ± 0.4 mEq/L 110.7 ± 4.5

receptor than to mouse FcRn (Table 3). Interestingly, both mouse and human IgG bound efficiently to the mouse receptor. A pharmacokinetic (PK) study of native sequence albumin, engineered high (HB) and low (LB) albumin FcRn binders was performed to determine the capability of this model to discriminate between variants based on FcRn affinity and to identify any effect of an endogenous pool of HSA on the pharmacokinetic behavior. Purified native sequence rHSA, LB and HB albumin variants were injected Table 2 Binding kinetics of albumin derived from human serum (sHSA), hFcRn+/+, hAlb+/+ (sHSA (hFcRn+/+, hAlb+/+)), recombinant albumin (rHSA), mouse serum (sMSA), recombinant mouse serum (rMSA) and low and high binder albumin (LB, HB) to human, human– mouse and mouse FcRn. The KD's are average of 3–6 measurements and each measurement consists of a 7-step dilution series for evaluation of kinetic parameters. KD (nM) average Human FcRn +/+

sHSA (hFcRn hAlb+/+) sHSA rHSA sMSA rMSA LB HB

Human–mouse FcRn

Mouse FcRn

, 501.9 ± 101.2 641.1 ± 89.7 797.9 ± 155.0 87.8 ± 5.8 74.6 ± 13.4

498.4 ± 55.6 672.4 ± 116.8 701.2 ± 136.5 657.7 ± 56.7 334.6 ± 87.0

– – 5391.0 ± 367.7 383.0 ± 56.1 314.9 ± 12.1 11,050.0 ±

7244.3 ± 2899.4 4106.3 ± 838.4 749.5 31.5 ± 9.8 50.2 ± 12.4 764.3 ± 17.5

27

intravenously at 10 mg/kg into five age and sex-matched hFcRn+/ + , hAlb+/+ mice. Serum samples were collected and albumin concentrations were determined by ELISA. The data is summarized in Fig. 3 and Table 4. The circulatory half-life of the engineered HB variant in the blood was ~1.5 times that of the rHSA (80 ± 18 and 57 ± 13 h, respectively) with the shortest half-life exhibited by the engineered LB (29 ± 3 h) that supports dependency on FcRn recycling. The mean blood residence time for the HB was 92 h, that decreased for the rHSA (63 h) and LB (23 h), reflected in the reverse trend observed for blood clearance, with LB N rHSA N HB (2.99 ± 0.18, 2.10 ± 0.18 and 1.64 ± 0.21 mL/ h/kg, respectively). Similar volume distribution for HB (188 mL/kg) and rHSA (173 mL/kg) was observed that were greater than the LB (125 mL/kg). 4. Discussion The use of albumin offers drug developers an attractive delivery option due to its extended half-life facilitated by cellular recycling after FcRn engagement. One of the main challenges in developing albumin-linked drugs, however, is large cross-species differences in the albumin/FcRn interaction that limits the usefulness of rodents as a pre-clinical model system. It is, therefore, crucial that both FcRn and albumin are humanized to maintain an autologous receptor/ligand interaction for evaluating albumin-linked drugs. In this work, we present for the first time, a murine model co-expressing human albumin and the human FcRn receptor (hFcRn+/+, hAlb+/+) that better mimics the physiological conditions encountered by albumin-linked drugs. Furthermore, this model was successfully used to discriminate between albumin variants that exhibit different FcRn affinities. Compelling evidence supports a prominent role of FcRn in albumin half-life extension as a consequence of diversion from lysosomal degradation by an endosomal FcRn-mediated cellular recycling mechanism. Early work by Chaudhury et al. [10] demonstrated endosomal pH-dependent engagement of HSA to soluble human Fc receptor, furthermore, a shorter half-life of injected radiolabelled albumin and lower endogenous albumin plasma levels were observed in β2m- and FcRn α-deficient knockout mice, suggestive of a FcRndependent salvage mechanism. More recently, engineered albumins with single point amino acid mutations in the FcRn binding region shown to alter FcRn-engagement [14], have been used to validate the role of FcRn in albumin recycling with the demonstration of extended blood circulation for engineered high binders in murine and non-human primates [15]. In the study by Andersen et al. [15], the circulatory half-life of native sequence albumin increased ~ 3-fold in an hFcRn transgenic model compared to wild type NMRI mice that further supports FcRn involvement. Studies in Cynomolgus monkeys revealed a prolonged serum half-life from 5.4 to 8.8 days of a high binding variant compared to native sequence HSA. The higher affinity of Cynomolgus serum albumin (CSA) compared to HSA for the Cynomolgus FcRn (1.8 μM and 2.4 μM, respectively), most probably due to a proline at position 573 in CSA, highlights the challenges for PK investigations even in non-human primates without endogenous human albumin to maintain an autologous albumin/FcRn interaction. In an attempt to overcome these limitations, we generated, in this work, a humanized double transgenic FcRn/albumin mouse. Male chimeras formed by blastocyte implantation following injection with an humanized embryonic stem cell line, either targeting FcRn α-chain, or human albumin, were crossed with C57BL/6 females to generate F1 progeny used to generate the homozygous hFcRn+/+, hAlb+/+ double transgenic. The endogenous mouse β2m was retained in our model to form a heterodimeric human–mouse FcRn to avert possible interference with β2m obligate heterodimer interactions and the functions of conventional MHC class I molecules. This approach is supported by β2m

28

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30

Table 3 Binding kinetics of human and mouse IgG to human, human–mouse and mouse FcRn receptor. The KD's are average of 4–8 measurements and each measurement consists of a 7-step dilution series for evaluation of kinetic parameters. KD (nM) Human FcRn

Human IgG Mouse IgG 1

Human–mouse FcRn

High affinity

Low affinity

High affinity

Low affinity

Mouse FcRn1

0.68 ± 0.23 10.60 ± 1.93

15.24 ± 7.52 47.96 ± 11.01

0.62 ± 0.17 16.54 ± 2.09

8.16 ± 2.42 86.62 ± 13.63

0.1 ± 0.03 0.4 ± 0.05

The binding data for mouse FcRn is fitted to a 1–1 model as the two very high affinities were impossible to resolve in the current set-up.

cross-species conservation, and previous reports that the endogenous mouse β2m forms a functional FcRn receptor with the human FcRn αchain [10,12,17]. In contrast to presently available hFcRn mouse models driven by cross-species promoters, humanization of the FcRn was performed by using in-frame insertion of the hFcRn cDNA into the mouse exon 2 so as to keep it under the control of the mouse endogenous promoter, as a strategy to ensure a more native-state expression pattern. Molecular characterization of hFcRn expression in all the major organs, at both RNA and protein level, was carried out in the C57BL/6 wild type and the hFcRn+/+, hAlb+/+ double transgenic model. No detection of hFcRn RNA was found in any of the organs from the wild type mice. In contrast, significant levels were found in the tissues of the hFcRn+/+, hAlb+/+ model. High levels were found in the duodenum that reached almost 2× that of the other tissues that had comparable amounts. Low levels, however, were detected in the lung. The similar hFcRn distribution pattern for hFcRn+/+, hAlb−/− and hFcRn+/+, hAlb+/+ (data not shown) suggested no detrimental influence from additional insertion of the human albumin gene. Mouse FcRn has been previously shown to be predominately expressed in the skin and muscle, and to a lesser extent the liver and adipose tissue, with minimal detection in the lungs in Swiss and C57BL/6 mice following injection of radiolabelled FcRn-binding proteins [19]. Akilesh et al. detected high levels in the skin and muscle, and a lower degree in the kidney, liver and spleen, but absent in the lung of B6.PL-Thy1a/CyJ mice by immunohistochemical analysis using FcRn-specific antiserum staining [20]. Expression was detected in the enterocytes within the duodenum that was restricted to the cell body. In both these studies, FcRn was detected within the endothelial vasculature, strategically positioned for recycling and maintaining IgG and albumin blood homeostasis. We similarly observed low expression in the lung, and detection in the duodenum that supports a native-state expression using a mouse endogenous promoter. Ubiquitous hFcRn expression has been proposed for the available Tg276

Fig. 3. Pharmacokinetic profiles of wild type rHSA and hFcRn reduced binder variant (LB) and hFcRn improved binding variant (HB) in hFcRn+/+, hAlb+/+, the curves represent the mean serum human albumin concentration ± SD of 5 mice.

model driven by a human/chicken (CAG) promoter, whilst, a restrictive pattern observed for the human FcRn promoter-driven Tg32 model [21]. The absence of published experimental evidence, however, limits direct comparisons to be made with our endogenous-driven promoter model. The ideal FcRn expression profile should match that found in humans. Once thought restricted to the perinatal state, due to its primary role in the passive transfer of maternal humoral immunity to the fetus [22], Israel et al. [23], were one of the first to show expression in human adults. The authors detected FcRn in adult human small intestine at apical regions that suggested an immunosurveillance role in adults, supported by FcRn-mediated transport of IgG/antigen complexes to underlying immune cells in the lamina propria of hFcRn/ hß2m transgenic mice [24]. Ward et al. [13] showed expression of hFcRn in a HULEC-5A human microvasculature endothelial cell line. Furthermore, expression in the central nervous system endothelium and choroid plexus, kidneys and lungs has been reported [reviewed in [11]]. There is, therefore, strong evidence for widespread FcRn expression in the human adult that is represented in our model. Physiological levels of HSA in our mouse offer the appropriate competition from endogenous human albumin which is lacking in existing human FcRn transgenic mice [17]. This is crucial, not only for the study of albumin linked drugs whose pharmacokinetics is dependent on FcRn engagement, such as the high binding engineered albumin variants [15], but also drugs that bind reversibly with endogenous HSA either by design, such as the insulin analog detemir [6], or, as a consequence of native structure, such as warfarin and diazepam that fit into albumins Sudlows site I and II, respectively [5]. This is of utmost importance for extrapolating half-life and distribution data from the animal model for predicting drug performance in humans, whilst the global architecture of the mouse and human albumins may be expected to be conserved, amino acid differences will impact the binding pockets and on–off kinetics of albumin-binding drugs. Numerous studies have indeed shown inter-species differences in the binding affinity of drugs, including warfarin, to albumin using a range of techniques [25–28]. In the study by Day and Myszka surface plasmon resonance was used to investigate cross-species differences using a panel of drugs. A correlation matrix identified major differences between mouse and human albumin binding, e.g. dicumarol (N 10 fold), digitoxin (4- N 10-fold), quinine (4- N 10-fold) less binding to mouse relative to HSA, with naproxen and warfarin exhibiting a higher affinity to mouse albumin [27]. Given the quantities of albumin present in the bloodstream, the presence of human albumin in the plasma, therefore, provides the most appropriate context for assessing therapeutic molecules. The level of HSA in the double transgenic was less than the MSA in the wild type counterpart, 1.7 and 2.8 g/dL, respectively. This could reflect the higher recycling of MSA due to the higher binding affinity of sMSA (383 nM) than sHSA (hFcRn+/+, hAlb+/+) (498.4 nM) to their respective mouse FcRn and human–mouse FcRn receptors (Table 2). The sHSA value in the double transgenic, however, was within the standard range 1.5–6 g/dL that provides physiological relevant levels and adequate competition for binding both endogenous molecules and the FcRn receptor. All clinical chemical parameters were within a standard range for the transgenic and wild type that further supports the application of this model. Moreover, no visible host immune

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30

29

Table 4 NCA analysis of wild type HSA and hFcRn reduced binder variant (LB) and hFcRn improved binding variant (HB) in hFcRn+/+, hAlb+/+ mice.

Compound

Cmax (μg/mL)

AUC (h μg/mL)

t 1/2 (h)

MRT (h)

Vz (mL/kg)

Cl (mL/h/kg)

rHSA LB HB

142.2 ± 30.0 111.3 ± 16.2 120 ± 13

4779.7 ± 408.1 3357.4 ± 218.9 6152 ± 701

57 ± 13 29 ± 3 80 ± 18

63 ± 6 23 ± 6 92 ± 18

173 ± 40 125 ± 15 188 ± 33

2.10 ± 0.18 2.99 ± 0.20 1.64 ± 0.21

Cmax: the maximum concentration reached after administration. t1/2: the elimination phase half-life. AUC: area under the curve. VZ: volume of distribution. MRT: mean residence time. Cl: clearance. SD: standard deviation.

reactions were observed that indicates recognition of HSA as an endogenous molecule that may be relevant for multiple/repeat dosing with human albumins. Binding kinetics studies revealed a similar range of binding of human albumin independent of the source (either HSA purified from the hFcRn+/+, hAlb+/+ mouse, human serum or recombinant albumin) to the soluble human FcRn receptor (human FcRn α/human β2m (hFcRn/h β2m) and the human–mouse heterodimer (human FcRn α/ mouse β2m (hFcRn/m β2m) (Table 2). We, therefore, believe this model to offer the most adequate level of competition and to be more suitable for studying the PK of albumin-linked drugs. Previous work by Andersen et al. [16], has demonstrated a higher MSA binding to hFcRn/h β2m than the mouse receptor, and the capability for MSA to inhibit binding of HSA to hFcRn. We similarly demonstrate up to a 5-fold increase in MSA binding for the human receptor. Interestingly, this was not the case for MSA for the human–mouse hFcRn/m β2m heterodimer, with lower binding observed at affinities comparable to human albumin. To our knowledge this is the first report of binding affinities for the heterodimer commonly used in existing transgenic mouse models As expected, human FcRn and the human–mouse heterodimer receptor binds human IgG ~8–10 times stronger than mouse IgG (Table 3), that may account for the lower IgG level in the double transgenic mouse, also shown in alternative hFcRn mouse models [29]. Interestingly, in our work, both mouse and human IgG showed similar high affinity to the mouse receptor. Mouse FcRn that had a higher affinity for human IgG compared with human FcRn has also been shown in other studies [30]. This suggests a requirement for hFcRn models to study IgG-based therapeutics. The validity of our model for discriminating between compounds based on FcRn affinities in the presence of an endogenous pool of HSA was tested with albumins engineered for high (HB) and low (LB) binding. Previous studies have shown that substitution of a single lysine for proline at position 573 within the C-terminal helix of domain III results in an increased binding to FcRn [15], whilst a substitution of alanine for lysine at position 500 diminished binding [14]. This translated to correspondingly high and low blood circulation times in non-human primates [15]. Binding kinetic studies revealed a maintained high affinity of the HB to both soluble human and human–mouse FcRn. Interestingly; the LB showed higher binding to the human–mouse than the human receptor, however, with a KD of ~4000 nM, an extremely low affinity was still observed. In the double transgenic mouse, the recombinant HSA half-life was almost 3 times greater (t 1/2 57 h), whilst, the LB circulatory half-life increased by one half compared to previously reported data of HSA in wild type mice [15] that may reflect improved engagement with the mouse–human receptor and consequent greater recycling. HB variant exhibited significantly prolonged half-life of ~ 80 h, i.e. 2.7 times the half-life previously reported in wild type mice [15] indicating that even in the presence of endogenous HSA, enhanced hFcRn affinity translates into significantly prolonged circulation which is anticipated to translate into a human setting. This work introduces a novel double transgenic humanized FcRn/ albumin mouse that maintains an autologous receptor/ligand interaction required for studying HSA-based drugs. The model was used successfully to discriminate PK profiles from albumins with different FcRn affinities in the presence of an endogenous pool of HSA. The model better mimics the human physiological conditions and, thus, has potential

wide applications in the development of albumin-linked drugs or conventional drugs whose action is influenced by reversible binding to endogenous HSA. Author contributions KAH, LE, SK, and DV provided conception of research and drafted the manuscript; DV, KT, and KAH, planned the studies; FA, JC, HD, MS, KT, BTR, and BA performed experiments, analyzed and interpreted data. All authors read and approved the final manuscript. Acknowledgments The authors are most grateful to Helle Knakkergaard, Camilla Løngaa, Lotte Holmbo Arentoft and Jeanette Bæhr Georgsen for excellent technical assistance, and Tine Meyer for coordination of the molecular characterization work at the Pathology Institute, Aarhus University Hospital. We would also like to thank Michael Lykke Hvam for assistance in the preparation of the graphical abstract. References [1] T. Peters, All About Albumin: Biochemistry, Genetics, and Medical Applications, Academic Press, San Diego, 1996. [2] K.A. Howard, Albumin: the next-generation delivery technology, Ther. Deliv. 6 (2015) 265–268. [3] D. Sleep, J. Cameron, L.R. Evans, Albumin as a versatile platform for drug half-life extension, Biochim. Biophys. Acta 1830 (2013) 5526–5534. [4] F. Kratz, A clinical update of using albumin as a drug vehicle — a commentary, J. Control. Release 190 (2014) 331–336. [5] U. Kragh-Hansen, V.T. Chuang, M. Otagiri, Practical aspects of the ligand-binding and enzymatic properties of human serum albumin, Biol. Pharm. Bull. 25 (2002) 695–704. [6] P. Home, P. Kurtzhals, Insulin detemir: from concept to clinical experience, Expert. Opin. Pharmacother. 7 (2006) 325–343. [7] N. Desai, V. Trieu, Z. Yao, L. Louie, S. Ci, A. Yang, C. Tao, T. De, B. Beals, D. Dykes, P. Noker, R. Yao, E. Labao, M. Hawkins, P. Soon-Shiong, Increased antitumor activity, intratumor paclitaxel concentrations, and endothelial cell transport of cremophorfree, albumin-bound paclitaxel, ABI-007, compared with cremophor-based paclitaxel, Clin. Cancer Res. 12 (2006) 1317–1324. [8] H.A. Blair, G.M. Keating, Albiglutide: a review of its use in patients with type 2 diabetes mellitus, Drugs 75 (2015) 651–663. [9] K. Koral, H. Li, N. Ganesh, M.J. Birnbaum, K.R. Hallows, E. Erkan, Akt recruits Dab2 to albumin endocytosis in the proximal tubule, Am. J. Physiol. Renal Physiol. 307 (2014) F1380–F1389. [10] C. Chaudhury, S. Mehnaz, J.M. Robinson, W.L. Hayton, D.K. Pearl, D.C. Roopenian, C.L. Anderson, The major histocompatibility complex-related Fc receptor for IgG (FcRn) binds albumin and prolongs its lifespan, J. Exp. Med. 197 (2003) 315–322. [11] D.C. Roopenian, S. Akilesh, FcRn: the neonatal Fc receptor comes of age, Nat. Rev. Immunol. 7 (2007) 715–725. [12] D.C. Roopenian, G.J. Christianson, T.J. Sproule, A.C. Brown, S. Akilesh, N. Jung, S. Petkova, L. Avanessian, E.Y. Choi, D.J. Shaffer, P.A. Eden, C.L. Anderson, The MHC class I-like IgG receptor controls perinatal IgG transport, IgG homeostasis, and fate of IgG–Fc-coupled drugs, J. Immunol. 170 (2003) 3528–3533. [13] E.S. Ward, J. Zhou, V. Ghetie, R.J. Ober, Evidence to support the cellular mechanism involved in serum IgG homeostasis in humans, Int. Immunol. 15 (2003) 187–195. [14] J.T. Andersen, B. Dalhus, J. Cameron, M.B. Daba, A. Plumridge, L. Evans, S.O. Brennan, K.S. Gunnarsen, M. Bjoras, D. Sleep, I. Sandlie, Structure-based mutagenesis reveals the albumin-binding site of the neonatal Fc receptor, Nat. Commun. 3 (2012) 610. [15] J.T. Andersen, B. Dalhus, D. Viuff, B.T. Ravn, K.S. Gunnarsen, A. Plumridge, K. Bunting, F. Antunes, R. Williamson, S. Athwal, E. Allan, L. Evans, M. Bjoras, S. Kjaerulff, D. Sleep, I. Sandlie, J. Cameron, Extending serum half-life of albumin by engineering neonatal Fc receptor (FcRn) binding, J. Biol. Chem. 289 (2014) 13492–13502. [16] J.T. Andersen, M.B. Daba, G. Berntzen, T.E. Michaelsen, I. Sandlie, Cross-species binding analyses of mouse and human neonatal Fc receptor show dramatic

30

[17] [18]

[19]

[20]

[21] [22]

[23]

D. Viuff et al. / Journal of Controlled Release 223 (2016) 22–30 differences in immunoglobulin G and albumin binding, J. Biol. Chem. 285 (2010) 4826–4836. G. Proetzel, D.C. Roopenian, Humanized FcRn mouse models for evaluating pharmacokinetics of human IgG antibodies, Methods 65 (2014) 148–153. L. Evans, M. Hughes, J. Waters, J. Cameron, N. Dodsworth, D. Tooth, A. Greenfield, D. Sleep, The production, characterisation and enhanced pharmacokinetics of scFv– albumin fusions expressed in Saccharomyces cerevisiae, Protein Expr. Purif. 73 (2010) 113–124. J. Borvak, J. Richardson, C. Medesan, F. Antohe, C. Radu, M. Simionescu, V. Ghetie, E.S. Ward, Functional expression of the MHC class I-related receptor, FcRn, in endothelial cells of mice, Int. Immunol. 10 (1998) 1289–1298. S. Akilesh, G.J. Christianson, D.C. Roopenian, A.S. Shaw, Neonatal FcR expression in bone marrow-derived cells functions to protect serum IgG from catabolism, J. Immunol. 179 (2007) 4580–4588. G. Proetzel, M.V. Wiles, D.C. Roopenian, Genetically engineered humanized mouse models for preclinical antibody studies, BioDrugs 28 (2014) 171–180. M. Firan, R. Bawdon, C. Radu, R.J. Ober, D. Eaken, F. Antohe, V. Ghetie, E.S. Ward, The MHC class I-related receptor, FcRn, plays an essential role in the maternofetal transfer of gamma-globulin in humans, Int. Immunol. 13 (2001) 993–1002. E.J. Israel, S. Taylor, Z. Wu, E. Mizoguchi, R.S. Blumberg, A. Bhan, N.E. Simister, Expression of the neonatal Fc receptor, FcRn, on human intestinal epithelial cells, Immunology 92 (1997) 69–74.

[24] M. Yoshida, S.M. Claypool, J.S. Wagner, E. Mizoguchi, A. Mizoguchi, D.C. Roopenian, W.I. Lencer, R.S. Blumberg, Human neonatal Fc receptor mediates transport of IgG into luminal secretions for delivery of antigens to mucosal dendritic cells, Immunity 20 (2004) 769–783. [25] R.A. Henry, W.D. Wosilait, Drug displacement of warfarin from human serum albumin: a fluorometric analysis, Toxicol. Appl. Pharmacol. 33 (1975) 267–275. [26] T. Kosa, T. Maruyama, M. Otagiri, Species differences of serum albumins: I. Drug binding sites, Pharm. Res. 14 (1997) 1607–1612. [27] Y.S. Day, D.G. Myszka, Characterizing a drug's primary binding site on albumin, J. Pharm. Sci. 92 (2003) 333–343. [28] M. Pistolozzi, C. Bertucci, Species-dependent stereoselective drug binding to albumin: a circular dichroism study, Chirality 20 (2008) 552–558. [29] C. Stein, L. Kling, G. Proetzel, D.C. Roopenian, M.H. de Angelis, E. Wolf, B. Rathkolb, Clinical chemistry of human FcRn transgenic mice, Mamm. Genome 23 (2012) 259–269. [30] R.J. Ober, C.G. Radu, V. Ghetie, E.S. Ward, Differences in promiscuity for antibodyFcRn interactions across species: implications for therapeutic antibodies, Int. Immunol. 13 (2001) 1551–1559.