Alterations of The P53 Gene Are Associated With The Progression Of A Human Prostate Carcinoma

0022-534 7/92/14 70-0789$03.00/0

VoL 147, 789-793, March 1992 Printed in US.A

THE JOURNAL OF UROLOGY

Copyright© 1992 by AMERICAN UROLOGICAL ASSOCIATION, INC.

ALTERATIONS OF THE P53 GENE ARE ASSOCIATED WITH THE PROGRESSION OF A HUMAN PROSTATE CARCINOMA PETER J. EFFERT, ANDREAS NEUBAUER,* PHILIP J. WALTHER

AND

EDISON T. LIUt

From the Department of Medicine and Curriculum in Genetics, Lineberger Cancer Research Center, University of North Carolina, Chapel Hill, and Departments of Surgery (Urology) and Pathology, Duke University School of Medicine and Comprehensive Cancer Center, Durham, North Carolina

ABSTRACT

P53 is a tumor suppressor gene that has been implicated in the molecular genetics of many human malignancies. Nucleotide alterations, most commonly single point mutations, have been shown not only to abrogate the p53 suppressor function but also to contribute to the transformed phenotype. We report the detection of a p53 gene mutation in clinical specimens of a patient with relapsing prostate adenocarcinoma 14 years after definitive external beam radiation. The techniques of single strand conformation polymorphism analysis and direct sequencing of polymerase chain reaction generated products were used for this study. Analysis of tissue from different locations of the primary tumor revealed intratumoral molecular heterogeneity; the mutation was absent in 1 area but present in another. Tumor from a regional lymph node metastasis harbored the identical p53 mutation. Furthermore, an additional genetic alteration, an allelic loss on chromosome l 7p but not including the p53 gene, was observed only in the metastatic tissue. These observations in clinical specimens of primary and metastatic sites provide evidence for the association of the p53 gene in the progression of human prostate carcinoma. KEY WORDS:

prostatic neoplasms, alleles, genes, mutation

Correlates of molecular genetic alterations with clinical disease progression have been an increasing focus of attention in the study of human prostate adenocarcinoma. While the biological behavior of an individual tumor often remains unpredictable, alterations in the deoxyribonucleic acid (DNA) ploidy status provide prognostic stratification of clinical outcome; increased DNA content when determined by flow cytometry can predict an adverse treatment outcome even in localized disease. 1 Despite the detection of alterations in specific genes in other tumor systems, little is known about the genetic lesions associated with prostate cancer. Limited analyses for the presence of altered oncogenes in prostatic carcinoma have been reported. A Ki-ras mutation was observed in a prostatic adenocarcinoma 2 and an activated Ha-ras oncogene has been seen in 1 of 24 prostate cancer specimens. 3 Higher levels of cmyc expression were found in prostate cancers compared to benign hypertrophy samples. 4 Another class of genes, commonly referred to as tumor suppressor genes (or "anti-oncogenes"), may be important in carcinogenesis. Although altered tumor suppressor genes are involved in many malignancies, little direct evidence exists for alterations in these genes in clinical prostate cancer. However, observations of chromosomal deletions have been noted that suggest the possibility of loss of critical genes (potentially tumor suppressor genes). Loss of chromosome 10 as well as changes in the long arm of chromosome 10 in prostate cancers have been observed. 5 Carter et al studied loss of heterozygosity at 11 different chromosomal arms and identified allelic loss on at least 1 chromosome in the majority of 24 localized and all 4 advanced primary prostate Accepted for publication August 16, 1991. Supported in part by Grants from the Deutsche Forschungsgemeinschaft (Ef 9/1-1 and Ne 310/4-1), Deutsche Krebsgesellschaft, Foundation for the Carolinas-Carolinas Cancer Research Fund, the American Cancer Society PDT-395 and National Institutes of Health R01CA49240-02. * Current address: Universitaetsklinikum RudolfVirchow, Abteilung Innere Medizin, Spandauer Damm 130, 1000 Berlin 19, Federal Republic of Germany. t Requests for reprints: CB#7295, Lineberger Cancer Research Center, University of North Carolina at Chapel Hill, Chapel Hill, North Carolina 27599. 789

tumors. 6 Recently, Bookstein et al identified a mutation in the promoter region of the Rb gene in 1 in 7 primary prostate tumors suggesting that specific tumor suppressor genes are involved in prostate carcinogenesis. 7 The p53 gene is a tumor suppressor gene that has been implicated in the molecular genetics of several common human malignancies. P53 mutations have been identified in colon and breast adenocarcinomas, small cell and nonsmall cell carcinomas of the lung, and brain tumors. 8- 10 These mutations, most commonly single point mutations, substantially alter the normal function of wild type p53. While the wild type p53 can inhibit transformation, 11 the mutant p53 is able to contribute in the transformation of primary rat embryo fibroblasts. 12 Consistent with the notion that p53 is a tumor suppressor is the finding of a frequent loss of genes on chromosome 17p in many common adult tumors, such as those of the colon, 8 breast, 13 lung14 and bladder. 15 Mutations of 1 allele coupled with loss of the remaining wild type allele is considered to be the genetic sequence of events involving tumor suppressor genes in malignant progression. For this study we had the opportunity to analyze tumor material retrieved from a primary prostate adenocarcinoma as well as its metastatic deposit in a regional lymph node. We report the detection of a point mutation in an evolutionarily conserved region in the fifth exon of the p53 gene. To our knowledge our case represents the first demonstration of an alteration of the p53 gene in a primary, clinical specimen of prostate cancer. The heterogeneity of this somatic mutation in the primary specimen and the additional loss of heterozygosity on chromosome 17p in the lymph node metastasis suggest that these events may participate in the progression of human prostate cancer. CASE HISTORY

A 67-year-old man was first evaluated at our medical center for the management of persistent hematuria and dysuria 4 months in duration from locally advanced prostate carcinoma. Prostate cancer (moderately well differentiated) had been diagnosed 14 years earlier by needle biopsy. The patient under-

790

EFFERT AND ASSOCIATES

went external beam teletherapy (6,500 rad) and was administered 1 mg. diethylstilbestrol daily simultaneously. Acid phosphatase and bone scan were negative before therapy. Transurethral resection was performed 8 years later for symptoms of urethral obstruction. Histological analysis of the chips showed persistent moderately differentiated adenocarcinoma comprising 50 to 65 % of the specimen and evidence of necrosis. A bone scan and acid phosphatase levels remained normal, and the patient was maintained on hormonal therapy in the interim until he again suffered intractable local symptoms. At the time of presentation to our institution staging studies revealed no evidence of metastasis by either bone scan or abdominal/pelvic computerized tomography. Enzymatic serum acid phosphatase and prostate specific antigen (PSA) levels were normal {:3;-SfL2 units per 1. and Hybritech 2.2 ng./ml., respectively). A nodule was palpable immediately adjacent to the bladder neck and irregular necrotic tumor was identified in the prostatic urethra. The patient elected to undergo radical cystoprostatectomy. The PSA was 0.6 ng./ml. 2 months postoperatively. A bone scan 8 months after surgery demonstrated new development of metastatic disease. Pathology. Grossly, tumor was found infiltrating the bladder base as well as the seminal vesicles. Diffuse infiltration of the prostate gland was noted (T4N1MO). The specimen was nearly completely involved with tumor; at the sites where tissue was removed for genetic analysis tumor area determination by grid analysis 16 showed 91 % of the area involved. Histologically, a Gleason 4/3 pattern was noted (fig. 1, a). All 3 regional nodes

identified adherent to the specimen had microscopic evidence of metastasis, including 1 that was completely replaced by undifferentiated tumor (100% by tumor area analysis) when bivalved (fig. 1, b), a portion of which was immediately preserved for subsequent DNA extraction. GENETIC ANALYTIC METHODOLOGY

Tumor tissue. Tissues were processed in the operating room within 5 minutes after removal. Samples were placed immediately in 10% buffered formalin as well as in liquid nitrogen ("snap frozen"). Formalin-fixed tissue was paraffin embedded and frozen tissue was stored at SOC. DNA was subsequently extracted from frozen tissue using cesium chloride purification as described. 17 DNA from peripheral blood of the patient was obtained by standardproceoures:17 Single strand conformation polymorphism analysis. Fragments (2.9 kb.) of genomic DNA containing exons 4 to 9 of the p53 gene were preamplified under standard polymerase chain reaction conditions18 using primers Pl and P2 (see table). Amplified fragments were recovered from 1 % agarose gels after electrophoresis and ethidium bromide staining. For subsequent single strand conformation polymorphism analysis polymerase chain reactions were performed with a fraction of the preamplified 2.9 kb. fragments, 200 µM. each deoxyadenosine triphosphate, deoxyguanosine triphosphate and deoxythymidine triphosphate; 2 µM. deoxycytidine triphosphate; 0.5 µM. each primer; 50 mM. potassium chloride; 10 mM. tris hydrogen chloride pH 8.3; 1.5 mM. magnesium chloride; 0.001 % (weight by volume) gelatin; 0.25 units Taq polymerase, and 1 µl. radioactive isotope of phosphorus (32 P) deoxycytidine triphosphate (3,000 Ci./mmol., 10 mCi./ml., New England Nuclear) in 10 µM. total volume. Using several different primer pairs 139 to 209 base pair sequences within exons 5, 7 and 8 of the p53 gene were amplified in separate polymerase chain reactions for 30 cycles at 94, 55 and 72C in a thermocycler. One µl. of the polymerase chain reaction product mixture was withdrawn and diluted 100-fold in 0.1% sodium dodecyl sulfate and 10 mM. ethylenediaminetetraacetic acid. 19 Two µM. of this solution were mixed with 2 M. 95% formamide, 20 mM. ethylenediaminetetraacetic acid, 0.05% bromphenol blue and 0.05% xylene cyanol, heated for 5 minutes at 94C and loaded (1.5 ml. per lane) onto a 6% nondenaturing polyacrylamide gel (49:l·ratio of acrylamide to methylene-bis-acrylamide). Electrophoresis was performed at 4C at 35 W (constant power). The gel was dried on Whatman 3 mM. paper and exposed to XAR-film at -SOC for 12 to 48 hours using an intensifying screen. For single strand conformation polymorphism analysis of paraffin embedded tissue 10 µ. tissue sections were deparaffinized by 1 extraction in xylene and 2 washes in 95% ethanol. Fragments (139 to 209 bp.) of exons 5, 7 and 8 were then preamplified under standard polymerase chain reaction conditions17 in a 100 µl. reaction (equal concentrations of deoxynucleotidyl triphosphates). A fraction of these preamplified fragments served as a template for the aforementioned Sequences of the oligonucleotides used as polymerase chain reaction and sequencing primers

Fm. 1. Hematoxylin and eosin stained tissue sections from paraffin blocks. a, primary prostate carcinoma. b, lymph node metastasis. Moderate differentiation can be detected in primary tumors. Undifferentiated tumor cells populate metastatic tissue. Reduced from X250.

Primer

Sequence (5' to 3')*

Pl P2 P3 P4 P5 P6 P7 P8

GACGGAATTCGTCCCAAGCAATGGATGAT GTCAGTCGACCTTAGTACCTGAAGGGTGA TTCCTCTTCCTGCAGTACT AGCTGCTCACCATCGCTAT TGTTGTCTCCTAGGTTGGCT CAAGTGGCTCCTGACCTGGA CCTATCCTGAGTAGTGGTAA TCCTGCTTGCTTACCTCGCT

Fragment Length 2.9kb. 209 bp. 139 hp. 164 hp.

* The sequence for the p53 primers was taken from the published coding and intron p53 sequence (Buchman, v: L., Chumakov, C. L., Ninkina, N. N., Samarina, 0. P. and Georgiev, G. P.: Gene, 70: 245, 1988). Primers Pl and P2 contain restriction sites (Eco RI; Sall).

P53

polymerase chain reaction with incorporation of 32 P-cytidine triphosphate. It is noteworthy that the migration and banding pattern obtained by single strand conformation polymorphism analysis of the same DNA samples is subject to variation. Subtle changes in the amount of input DNA and gel running conditions result in different electrophoretic mobility as seen in figure 2. However, a mutant sequence consistently results in a distinctly different banding pattern when compared to the normal control samples that are included in every experiment. Sequence analysis. For polymerase chain reaction a 2.9 kb. fragment of the p53 gene containing exons 4 to 9 was amplified as described (primers Pl and P2, see table). Amplified fragments were isolated from a preparative 1 % agarose gel after ethidium bromide staining. Of the yield 5 to 10% was subjected to a second asymmetric polymerase chain reaction 20 using primer pairs P4/P5 (exon 5), P6/P7 (exon 7) and P8/P9 (exon 8). The concentration of the primers was 0.5 µM. and 0.01 µM., respectively. Both strands were sequenced for each exon. The respective primers were then used in the sequencing reactions. Sequencing reaction. The product of the asymmetric polymerase chain reaction was purified and dissolved in 15 µl. water. A 7.5 µI. aliquot was taken for each sequencing reaction. The modification of the method of Sanger, as optimized for United States Biochemical Sequence, was used for sequencing. After electrophoresis on 8% polyacrylamide 5 M. urea gels (2 hours at 55 W.) and drying, exposure to XAR film was done overnight. Detection of allelic loss. Probe YNZ22 detects a highly polymorphic variable number of tandem repeats segment on chromosome l 7p. 21 Oligonucleotide primers, directing amplification across the p YNZ22 region, were recently described. 22 Using these primers, amplification was performed with 1 µg. genomic DNA under standard conditions 18 for 28 cycles (55C annealing) in 100 µI. total volume. Ten µl. of the amplification products were electrophoresed on 8% polyacrylamide gels and visualized by ethidium bromide staining. RESULTS

Single strand conformation polymorphism analysis. Since mutations in the p53 gene have been reported to occur in several different exons, we chose to adapt single strand conformation polymorphism analysis 19 as a rapid and sensitive screening tool for the detection of nucleotide alterations. It has recently been used successfully for the detection of mutations in the ras-gene family and the neurofibromatosis type 1 gene. 23 • 24 After stand-

a

b

L N

C

r~

L P N

791

IN HUMAN PROSTATE CARCINOMA

B p

L

ardizing the conditions analysis was found to be suitable for the detection of single-base substitutions in the p53 gene not shown). We performed the initial analysis on tissues corresponding exactly to areas containing mainly tumor cells in the hematoxylin and eosin stained paraffin sections by obtaining 10 µ. sections from the same tissue blocks. When the amplified fragments of exon 5 were subjected to analysis, a significant alteration of the electrophoretic mobility of the single stranded DNA fragments and the appearance of a prominent extra band were noted in the lymph node metastasis (fig. 2, a). An abnormal pattern was reproducible in a second analysis, as compared to the DNA fragments from the primary prostatic tumor showing normal migration (fig. 2, b ). To confirm this suspicion for a nucleotide alteration in the p53 gene of the metastatic carcinoma, genomic DNAs from frozen tissue of primary and metastatic tumor were extracted and subjected to single strand conformation polymorphism analysis. Genomic DNA from peripheral blood cells also was obtained from the same patient and coanalyzed to exclude the possibility of a germ-line mutation. Abnormal migration and the appearance of extra bands again were observed in the metastatic tissue (fig. 2, c). However, the abnormal pattern was unexpectedly also present in the primary tumor (fig. 2, c), whereas no abnormality had been detected in the paraffin embedded sample of the primary tumor. Sequencing analysis. To confirm the presence of the mutations the p53 genes of the various samples were subjected to direct sequencing. A mutation (GTT to GCT) at codon 172, substituting valine by alanine in the p53 protein sequence, was identified in the primary tumor and the lymph node metastasis (fig. 3, a). No mutation was found in DNA from peripheral blood, which confirmed that a mutation in p53 existed in the frozen primary and metastatic tissues. However, the initial single strand conformation polymorphism analysis from paraffin embedded primary prostate tissue showed no mutation in p53. Two possible explanations could account for these diverging findings: either the single strand conformation polymorphism analysis had given false negative results for the primary tumor or those areas of the primary tumor that had been paraffin embedded truly did not contain tumor cells with mutant p53. Clarification was obtained by direct sequencing of the same 209 bp. fragment that had been used for single strand conformation polymorphism analysis from the paraffin embedded tissue. As shown in figure 3, b no mutation was identified in the archival specimen, which indicates that the primary tumor was composed of a heterogeneous population of tumor cells with an area of the tumor populated by cells harboring a mutant p53 allele (frozen primary tumor tissue) and other areas

a

FIG. 2. Single strand conformation polymorphism analysis. a and b, analysis of paraffin embedded tissue. Abnormal migration and appearance of extra bands are detectable in metastatic tissue. Banding and migration pattern is subject to variation in different single strand conformation polymorphism analyses, although samples containing mutant sequence show consistently different pattern from normal controls incorporated in every experiment. c, genomic DNA was analyzed by single strand conformation polymorphism. Primary and metastatic tumor tissues display an abnormal pattern. N, normal spleen (normal control). L, lymph node metastasis. P, primary prostate carcinoma. B, peripheral blood.

b.

B

p

L

GTAC

GT AC

G TAC

G T

A C

FIG. 3. Sequencing analysis. a, genomic DNA was sequenced. Mutation (arrows) can be detected in primary and metastatic tissues. b, sequencing of paraffin embedded primary tissue is consistent with data obtained from single strand conformation polymorphism analysis. No mutation can be detected. B, peripheral blood. P, primary prostate carcinoma. L, lymph node metastasis.

792

EFFERT AND ASSOCIATES

containing cells without p53 mutations (paraffin block). Furthermore, the cancer cells in the primary tumor bearing the aberrant p53 gene were destined to populate the lymph node metastasis. Detection of allelic loss. Since deletions of the short arm of chromosome 17 have frequently been described in human tumors and allelic deletions coupled with mutation of the remaining allele are considered to be a hallmark of tumor suppressor genes, 25 we sought to analyze genomic DNA from primary and metastatic tumor tissue for somatic allelic loss of chromosome 17p sequences by means of amplification of a highly polymorphic variable number of tandem repeats segment. 22 As shown in figure 4, 2 alleles were present in the peripheral blood cells and primary tumor. However, in the lymph node metastasis---thel'e-was-l0ss-0f-he-t0I"ozygosity. with the upper-band.being barely detectable. The presence of DNA from some stromal cells and a few remaining lymphocytes in the lymph node metastasis (which would retain both alleles) most likely accounts for this weak upper band. These polymerase chain reaction data have been confirmed by Southern blot analysis and hybridization with the YNZ22 probe (data not shown). DISCUSSION

Alterations in tumor suppressor genes are increasingly recognized to be important in the initiation and progression of human malignancies. Often several genetic alterations appear to be involved; a well characterized example is the multistep

1 2 3

BPL

Fm. 4. Detection of allelic loss. Highly polymorphic variable number of tandem repeats segment on chromosome 17p was polymerase chain reaction-amplified from genomic DNA. Allelic loss (arrow) can be detected in metastatic tissue. 1, size markers. 2, unrelated heterozygous individual. 3, K562 cell line that has previously been shown to be homozygous. B, peripheral blood. P, primary prostate carcinoma. L, lymph node metastasis.

process of colorectal tumorigenesis. 26 Our study extends the list of tumors with reported p53 alterations to prostate cancer. We have detected a mutant p53 allele in a clinical specimen of a primary prostate cancer and in its associated lymph node metastases; in addition to this mutation a second genetic alteration, namely 17p allelic loss, was detected in a nodal metastasis. The distribution of p53 mutations does not appear to be random; many mutations have been mapped to highly conserved sequences in exons 5, 7 and 8. 10 Our findings are in agreement with these observations: the mutation we identified (codon 172) is located within an evolutionarily conserved region that is also part of the large T antigen binding site, suggesting an important functional role for these regions. The primary tumor appeared to harbor distinct regions populated_b~.cellsJ1earing~ithe.rthe~ormaI p53. allele. alone o:r: the normal and the mutant p53 alleles together. Only the normal allele was detected in paraffin sections of tumor tissue immediately adjacent to those used for hematoxylin and eosin staining (fig. 1, a). Although there is an increased amount of stromal cells in this area of the primary tumor compared to the metastatic tissue, tumorous areas still account for about 90% of the tissue section. Since the sensitivity of sequencing analysis is approximately 1 in 4, that is a mutation is still detectable if 1 in every 4 cells contains a mutant allele, it is unlikely that a p53 mutation went undetected in this area of the primary tumor because of the presence of normal stromal cells. However, in a different portion of the tumor the malignant cells appeared to be heterozygous for the mutant and wild type p53 alleles. The same mutation was found in the metastatic lymph node, thus, defining a cancerous clone destined to populate the metastatic deposit. Although the p53 mutation may mark cells that later acquire metastatic behavior, perturbation of p53 alone did not appear to have induced the metastasis. The single strand conformation polymorphism and sequencing analysis of the metastatic tissue showed the same abnormal p53 configuration, that is the wild type p53 allele coexisting with the mutant allele, as the affected primary tissue. However, a further genetic alteration, an allelic loss on the short arm of chromosome 17p defined by the YNZ22 probe but not including the p53 gene, was identified only in the metastasis and not in either of the primary tumor samples studied. Therefore, it is possible that a gene different from p53 but linked to YNZ22 potentially was lost in the metastatic process. Two recent publications have also implicated a gene or genes linked to the YNZ22 locus, other than p53 on the short arm of chromosome 17, in human breast carcinogenesis. 27· 28 Perturbations of this locus, which is associated with a high labeling index in breast cancer cells, 28 now appear to be associated with a more virulent phenotype in our patient, that is the development of metastases. Whatever the final explanation, it appears that these concurrent processes (p53 mutation and 17p allelic loss) may be associated with the progression of prostate carcinoma. The therapeutic radiation received by the patient 14 years before the radical prostatectomy can cause a variety of genetic abnormalities. Therefore, it is possible that the mutation in p53 found in this patient was radiation-induced and is not part of the natural progression of prostatic cancer. However, if this were the case the p53 abnormality should have been present in all samples of the tumor. Instead, the codon 172 mutation was seen only in a portion of the primary, suggesting that the recurrent tumor was established before generation of the p53 mutations. Therefore, it is unlikely that the p53 aberration seen in our patient was due to radiation exposure. In conclusion, we identified 2 genetic alterations in a patient whose prostate cancer subsequently rapidly progressed systemically: a point mutation in the p53 gene and l 7p allelic loss at the YNZ22 locus that appear to be associated with clinical tumor progression. The determination of the prevalence of p53 mutations as well as the assessment of allelic loss on 17p and

P53

!N HUlv:!AN PROSTATE CARCINOiVIA

the association of these parameters with grade and stage of prostatic adenocarcinomas appear to be warranted and may prove to determine valuable parameters for stratification of disease outcome. Dr. Peter Humphrey performed the tumor area determinations on the histological slides.

15.

REFERENCES

16.

1. Lee, S. E., Currin, S. M., Paulson, D. F. and Walther, P. J.: Flow cytometric determination of ploidy in prostate adenocarcinoma: a comparison with seminal vesicle involvement and histopathologic grading as a predictor of clinical recurrence. J. Urol., 140: 769, 1988. 2. Peehl, D. M., Wehner, N. and Stamey, T. A.: Activated Ki-ras oncogene in human prostatic adenocarcinoma. Prostate, 10: 281, 1987. 3. Carter, B. S., Epstein, J. R. and Isaacs, W. B.: Ras gene mutations in human prostate cancer. Cancer Res., 50: 6830, 1990. 4. Fleming, W. H., Hamel, A., MacDonald, R., Ramsey, E., Pettigrew, N. M., Johnston, B., Dodd, J. G. and Matusik, R. J.: Expression of the c-myc protooncogene in human prostatic carcinoma and benign prostatic hyperplasia. Cancer Res., 46: 1535, 1986. 5. Atkin, N. B. and Baker, M. C.: Chromosome study of five cancers of the prostate. Hum. Genet., 70: 359, 1985. 6. Carter, B. S., Ewing, C. M., Ward, W. S., Treiger, B. F., Aalders, T. W., Schalken, J. A., Epstein, J. I. and Isaacs, W. B.: Allelic loss of chromosomes 16q and lOq in human prostate cancer. Proc. Natl. Acad. Sci., 87: 8751, 1990. 7. Bookstein, R., Rio, P., Madreperla, S. A., Hong, F., Allred, C., Grizzle, W. E. and Lee, W.-H.: Promoter deletion and loss of retinoblastoma gene expression in human prostate carcinoma. Proc. Natl. Acad. Sci., 87: 7762, 1990. 8. Baker, S. J., Fearon, E. R., Nigro, J.M., Hamilton, S. R., l;'reisinger, A. C., Jessup, J. M., van Tuinen, P., Ledbetter, D. H., Barker, D. F., Nakamura, Y., White, R. and Vogelstein, B.: Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science, 244: 217, 1989. 9. Takahashi, T., Nau, M. M., Chiba, I., Birrer, M. J., Rosenberg, R. K., Vinocour, M., Levitt, M., Pass, H., Gazdar, A. F. and Minna, J. D.: p53: a frequent target for genetic abnormalities in lung cancer. Science, 246: 491, 1989. 10. Nigro, J.M., Baker, S. J., Preisinger, A. C., Jessup, J.M., Hostetter, R., Cleary, K., Eigner, S. H., Davidson, N., Baylin, S., Devilee, P., Glover, T., Collins, F. S., Weston, A., Modalli, R., Harris, C. C. and Vogelstein, B.: Mutations in the p53 gene occur in diverse human tumour types. Nature, 342: 705, 1989. 11. Finlay, C. A., Hinds, P. W. and Levine, J.: The p53 proto-oncogene can act as a suppressor of transformation. Cell, 57: 1083, 1989. 12. Parada, L. F., Land, H., Weinberg, R. A., Wolf, D. and Rotter, V.: Cooperation between gene encoding p53 tumour antigen and ras in cellular transformation. Nature, 312: 649, 1984. 13. Prosser, J., Thompson, A. M., Cranston, G. and Evans, H. J.: Evidence that p53 behaves as a tumour suppressor gene in sporadic breast tumours. Oncogene, 5: 1573, 1990. 14. Weston, A., Willey, J.C., Modali, R., Sugimura, H., McDowell, E.

17. 18.

19. 20.

21.

22. 23.

24.

25. 26. 27.

28.

793

M., Resau, J., Light, B., Haugen, A., Mann, D.-L., Trump, B. F. and Harris, C. C.: Differential DNA sequence deletions from chromosomes 3, 11, 13, and 17 in the squamous-cell carcinoma, large-cell carcinoma, and adenocarcinoma of the human lung. Proc. Natl. Acad. Sci., 86: 5099, 1989. Tsai, Y. C., Nichols, P. W., Hiti, A. L., Williams, Z., Skinner, D. G. and Jones, P.A.: Allelic losses of chromosome 9, 11 and 17 in human bladder cancer. Cancer Res., 50: 44, 1990. Humphrey, P.A. and Vollmer, R. T.: Intraglandular tumor extent and prognosis in prostatic carcinoma: application of a grid method to prostatectomy specimens. Hum. Path., 21: 799, 1990. Maniatis, T., Fritsch, E. F. and Sambrook, J.: Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 1982. Neubauer, A., Neubauer, B. and Liu, E.: Polymerase chain reaction based assay to detect allelic loss in human DNA: loss of betainterferon gene in chronic myelogenous leukemia. Nucleic Acids Res., 18: 993, 1990. Orita, M., Suzuki, Y., Sekiya, T. and Hayashi, K.: Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics, 5: 874, 1989. Dicker, A. P., Volkenandt, M., Adamo, A., Barreda, C. and Bertino, J. R.: Sequence analysis of a human gene responsible for drug resistance: a rapid method for manual and automated direct sequencing of products generated by the polymerase chain reaction. Biotechniques, 7: 830, 1989. Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm, T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E. and White, R.: Variable number of tandem repeat (VNTR) markers for human gene mapping. Science, 235: 1616, 1987. Horn, G. T., Richards, B. and Klinger, K. W.: Amplification of a highly polymorphic VNTR segment by the polymerase chain reaction. Nucleic Acids Res., 17: 2140, 1989. Suzuki, Y., Orita, M., Shiraishi, M., Hayashi, K. and Sekiya, T.: Detection of ras gene mutations in human lung cancers by singlestrand conformation polymorphism analysis of polymerase chain reaction products. Oncogene, 5: 1037, 1990. Cawthon, R. M., Weiss, R., Xu, G. F., Viskochil, D., Culver, M., Stevens, J., Robertson, M., Dunn, D., Gesteland, R., O'Connell, P. and White, R.: A major segment of the neurofibromatosis type 1 gene: cDNA sequence, genomic structure, and point mutations. Cell, 62: 193, 1990. Knudson, A. G.: Hereditary cancer, oncogenes, and antioncogenes. Cancer Res., 45: 1437, 1985. Fearon, E. R. and Vogelstein, B.: A genetic model for colorectal tumorigenesis. Cell, 61: 759, 1990. Coles, C., Thompson, A. M., Edler, P.A., Cohen, B. B., Mackenzie, I. M., Cranston, G., Chetty, U., Mackay, J., Macdonald, M., Nakamura, Y., Hoyheim, B. and Steel, C. M.: Evidence implicating at least two genes on chromosome 17p in breast carcinogenesis. Lancet, 336: 761, 1990. Chen, L.-C., Neubauer, A., Kurisu, W., Waldman, F., Ljung, B. M., Goodson, W., III, Goldman, E. S., Moore, D., II, Balazs, M., Liu, E., Mayall, B. and Smith, H. S.: Loss of heterozygosity on the short arm of chromosome 17 is associated with high proliferative capacity and DNA aneuploidy in primary human breast cancer. Proc. Natl. Acad. Sci., 88: 3847, 1991.