Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants

G Model ETP-50880; No. of Pages 10

ARTICLE IN PRESS Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Experimental and Toxicologic Pathology journal homepage: www.elsevier.de/etp

Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants Samy A. Abdel Azim a , Hebatallah A. Darwish a,∗ , Maha Z. Rizk b , Sanaa A. Ali b , Mai O. Kadry b a b

Biochemistry Department, Faculty of Pharmacy, Cairo University, Cairo, Egypt Therapeutic Chemistry Department, National Research Center, Dokki, Gizza, Egypt

a r t i c l e

i n f o

Article history: Received 30 September 2014 Accepted 12 February 2015 Keywords: Titanium dioxide nanoparticles Liver Antioxidants Oxidative stress Inflammation Apoptosis

a b s t r a c t This study investigates the efficacy of idebenone, carnosine and vitamin E in ameliorating some of the biochemical indices induced in the liver of titanium dioxide nanoparticles (TiO2 NPs) intoxicated mice. Nano-anatase TiO2 (21 nm) was administered (150 mg/kg/day) for 2 weeks followed by the aforementioned antioxidants either alone or in combination for 1 month. TiO2 NPs significantly increased serum liver function enzyme activities, liver coefficient and malondialdehyde levels in hepatic tissue. They also suppressed hepatic glutathione level and triggered an inflammatory response via the activation of macrophages and the enhancement of tumor necrosis factor-␣ and interleukin-6 levels. Moreover, the mRNA expression of nuclear factor-erythroid-2-related factor 2, nuclear factor kappa B and Bax was up-regulated whereas that of Bcl-2 was down-regulated following TiO2 NPs. Additionally, these NPs effectively activated caspase-3 and caused liver DNA damage. Oral administration of idebenone (200 mg/kg), carnosine (200 mg/kg) and vitamin E (100 mg/kg) alleviated the hazards of TiO2 NPs with the combination regimen showing a relatively higher effect. The histopathological examination reinforced these findings. In conclusion, oxidative stress could be regarded as a key player in TiO2 NPs-induced liver injury. The study also highlights the anti-inflammatory and the anti-apoptotic potentials of these antioxidants against the detrimental effects of TiO2 NPs. © 2015 Elsevier GmbH. All rights reserved.

1. Introduction Owing to the advantageous combination of physicochemical and biological properties of titanium dioxide nanoparticles (TiO2 NPs), they are extensively used for a wide range of implanted medical devices as cardiovascular stents, dental implants, joint replacements and spinal fixation devices. However, under mechanical stress or altered physiological conditions such as low pH, titanium (Ti)-based implants can release large amounts of nanoparticles (NPs) debris (Cunningham et al., 2002). The distinct properties of NPs, such as small size, high number per given mass, large specific surface area, have aroused global concern regarding their fate in biological systems. Previous studies have indicated that NPs can penetrate cell nuclei and directly

∗ Corresponding author. Tel.: +0020 1112550300; fax: +0020 222752735. E-mail addresses: dr.samy [email protected] (S.A.A. Azim), [email protected] (H.A. Darwish), maha-zaki [email protected] (M.Z. Rizk), Sanaa [email protected] (S.A. Ali), [email protected] (M.O. Kadry).

interfere with DNA structure, causing several adverse effects represented in increased production of reactive oxygen species (ROS), induction of apoptosis, genotoxicity and DNA damage (Wang et al., 2007). Additionally, NPs can be accumulated in liver, kidney, spleen, lung, heart, and brain, generating various inflammatory responses (Borm et al., 2002). According to Ma et al. (2009), TiO2 NPs stimulate hepatocytes and induce inhibitory proteins, such as inhibitory kappa B (I␬B), which is phosphorylated and degraded, leading to activation of nuclear factor-kappa B (NF-␬B) with subsequent gene transcription of proinflammatory cytokines in the mouse liver. Beforehand, high doses of nano-TiO2 (25 and 80 nm) were reported to increase the ratio of alanine aminotransferase (ALT) to aspartate aminotransferase (AST), the activity of lactate dehydrogenase (LDH) and the liver weight, and to mediate necrosis of hepatocytes (Wang et al., 2007). Nowadays, antioxidants have gained great interest because of their potential role as therapeutic agents in many diseases (Lakho and Rohra, 2006). Idebenone (ID) [2,3-dimethoxy-5-methyl-6(10-hydroxydecyl)-1,4 benzoquinone] is a synthetic analogue of coenzyme Q10, the vital cell membrane antioxidant and the

http://dx.doi.org/10.1016/j.etp.2015.02.001 0940-2993/© 2015 Elsevier GmbH. All rights reserved.

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model ETP-50880; No. of Pages 10

ARTICLE IN PRESS S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

2

essential constituent of the ATP-producing mitochondrial electron transport chain. Idebenone has the ability to operate under low oxygen tension. It protects cell membranes and mitochondria from oxidative damage by inhibiting lipid peroxidation. Idebenone has been proved to be an effective remedy against cerebral ischemia, nerve damage in the central nervous system (Parnetti, 1995) and bile acid-induced hepatocellular injury in rats (Shivaram et al., 1998). Carnosine (CR) [␤-alanyl-l-histidine] is a dipeptide of the amino acids ␤-alanine and histidine. Carnosine is considered as a mobile organic pH-buffer. It can chelate divalent metal ions and scavenge ROS as well as unsaturated aldehydes formed from the peroxidation of cell membrane fatty acids during oxidative stress (Reddy et al., 2005). Carnosine was also found to inhibit mRNA expression of apoptosis-inducing factor (AIF) and caspase-3, to increase superoxide dismutase (SOD) activity and to decrease malondialdehyde (MDA) level when given to mice (Renner et al., 2010). Vitamin E (␣-tochopherol) is a well-known chain breaking antioxidant that precludes the propagation of oxidative stress especially in biological membranes (Schaffer et al., 2005). It is able to modulate the activity of several enzymes involved in signal transduction via its antioxidant properties (Zingg, 2007). It is worthy noted that the anti-inflammatory and the anti-carcinogenic activities of vitamin E in the lung and colon are associated with the reduction of oxidative damage and trapping of reactive nitrogen species (Qureshi et al., 2011). Likewise, vitamin E could protect from lipid peroxidation and oxidative DNA damage in human hepatocellular carcinoma cell lines (Fantappiè et al., 2004). Based on this background, the present study was conducted to further stretch the confirmatory role of these antioxidants (idebenone, carnosine and vitamin E), either alone or in combination, against TiO2 NPs-induced liver injury in mice. 2. Materials and methods 2.1. Chemicals Nano-anatase TiO2 (particle size 21 nm), idebenone, carnosine and vitamin E were purchased from Sigma-Aldrich Co (St. Louis, MO, USA). Kits used for the determination of liver function and oxidative stress biomarkers were obtained from Randox Company (UK). ELISA kits of caspase-3, tumor necrosis factor alpha (TNF-␣) and interleukin-6 (IL-6) were provided from R&D Systems (MN, USA). Primers used in real time-PCR were purchased from Shine Gene (China). All other chemicals are of highest analytical grade. TiO2 NPs were suspended in 1% Tween 80 and dispersed by ultrasonic vibration for 15 min. The size distribution of the NPs in the suspension (hydrodynamic size) and the zeta potential were analyzed with a Brookhaven 90 Plus particle size analyzer. Scanning electron microscopy (SEM) was used to evaluate the size of TiO2 NPs.

2.3. Experimental design After 1 week of acclimatization, animals were randomly divided into six groups (each group ranges from 10 to 14 animals) according to the following schedule: Group1: animals received Tween 80 and served as a normal control group. Groups from 2 to 6: animals were given a daily oral dose of TiO2 NPs (150 mg/kg) for 2 weeks, then the following regimen was applied: • Group 2: the TiO2 NPs-intoxicated animals were left untreated. • Group 3: theTiO2 NPs-intoxicated animals were treated with a daily oral dose of idebenone (200 mg/kg) (Seznec et al., 2004). • Group 4: the TiO2 NPs-intoxicated animals were treated with a daily oral dose of carnosine (200 mg/kg) (Zhang et al., 2011). • Group 5: the TiO2 NPs-intoxicated animals were treated with a daily oral dose of vitamin E (100 mg/kg) (Ishrat et al., 2009). • Group 6: the TiO2 NPs-intoxicated animals were given idebenone (200 mg/kg), carnosine (200 mg/kg) and vitamin E (100 mg/kg) in daily oral doses. Treatment was carried throughout a period of 1 month after TiO2 NPs-intoxication. It is worthy to note that the selected dose of TiO2 NPs was previously reported to be the most effective in inducing liver damage (Ma et al., 2009; Li et al., 2010a). 2.4. Blood sampling and liver tissue preparation At the end of the experimental period, mice were weighed, slightly anesthetized and blood samples were collected from the sublingual vein. Sera were separated by centrifugation at 4000 rpm for 10 min and were kept at −80 ◦ C for subsequent estimation of aminotransferases activities. Animals were then sacrificed by cervical dislocation and liver tissues were carefully separated, blotted dry, weighed and then divided into four portions. The first portion was homogenized in 4 volumes of phosphate buffer, pH 7.4, using Teflon homogenizer (Glass-Col homogenizer, Terre Haute, USA). An aliquot of this homogenate (20% w/v) was centrifuged at 4000 rpm at 4 ◦ C for 15 min and the supernatant was used for MDA analysis. Another aliquot was mixed with 7.5% sulfosalicylic acid, centrifuged at 3000 rpm for 15 min, and the resulting protein-free supernatant was used for the estimation of reduced glutathione (GSH) level. The last aliquot was used for the determination of TNF-␣ and IL-6 levels as well as caspase-3 activity. The second portion of the liver was used for the estimation of Nrf2, NF-␬B, Bax and Bcl-2 mRNA expression levels, whereas the third portion was used for the detection of DNA damage. The remaining portion was kept in 10% formaldehyde, and then embedded in paraffin for subsequent immnunohistochemical and histopathological examinations.

2.2. Animals

2.5. Measured parameters

Male albino mice, weighing 20–25 g, obtained from the animal house of National Research Center were used in this study. Animals were housed in cages kept at standardized conditions (22 ± 5 ◦ C, 55 ± 5% humidity, and 12 h light/dark cycle). They were allowed free access to water and pelleted standard chow diet. All procedures relating to animal care and treatments strictly adhered to the ethical procedures and policies approved by Animal Care and Use Committee of National Research Center (12-038) and Faculty of Pharmacy, Cairo University, and complied with the Guide for Care and Use of Laboratory published by the US National Institute of Health.

2.5.1. Coefficient of liver After weighing the body and liver, the coefficient of liver to body weight was calculated as the ratio of tissue (wet weight, mg) to body weight (BW, g) (Peters et al., 2006). 2.5.2. Serum alanine and aspartate aminotransferases (ALT & AST) activities ALT and AST activities were estimated spectrophotometrically using commercially available kits provided from Randox Company. In brief, l-alanine reacts with oxoglutarate in presence of ALT to form pyruvate and l-glutamate. On the other hand, in presence of

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model ETP-50880; No. of Pages 10

ARTICLE IN PRESS S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

AST, l-aspartate forms oxaloacetate and l-glutamate. In alkaline solution, the formed pyruvate or oxaloacetate reacts with 2,4dinitrophenyl hydrazine to give the hydrazone derivative that can be measured at 540 nm (Reitman and Frankle, 1957). 2.5.3. Hepatic malondialdehyde (MDA) level MDA, as an index of lipid peroxidation, was measured using kit provided by Randox Company. MDA reacts with thiobarbituric acid (TBA) in acid medium giving a pink-colored complex that can be measured spectrophotometrically at 520 nm and 535 nm, using 1,1,3,3-tetramethoxy propane as standard (Ohkawa et al., 1979). 2.5.4. Hepatic glutathione (GSH) level GSH level was estimated using kit provided by Randox company. In brief, the GSH content was determined using 5, 5-dithiobis(2-nitrobenzoicacid) (Ellman’s reagent), which produces a stable yellow color that can be measured colorimetrically at 412 nm (Moron et al., 1979). 2.5.5. Immunohistochemical detection of CD68 Paraffin embedded tissue sections of 4 ␮m thickness were rehydrated in xylene and then in graded ethanol solutions. Microwave antigen retrieval was performed for 5 min prior to peroxidase quenching with 3% H2 O2 in phosphate buffered saline (PBS) for 15 min. Subsequently, sections were preblocked with 5% bovine serum albumin for 30 min and incubated with a primary antibody (anti-CD68) overnight at 4 ◦ C. A negative control was treated as for the other samples except that primary antibodies were replaced with PBS and no staining took place. After washing in PBS, sections were incubated with biotinylated secondary antibody for 30 min and then stained with 3,3 -diaminobenzidine (Vector Laboratories, Burlingame, CA, USA) for 2–5 min. Slides were finally counterstained with hematoxylin for 2–3 min, mounted, and examined. The areas of CD68 stained cells in individual sections were traced and measured using an image analysis system (Image-Pro Plus; Media Cybernetics, Silver Spring, MD, USA). 2.5.6. Hepatic tumor necrosis factor-alpha (TNF-˛) and interleukin-6 (IL-6) levels The hepatic levels of TNF-␣ and IL-6 were measured using ELISA kits (R&D Systems MN, USA). All the procedures were performed according to the manufacturer’s instructions. The assays of these cytokines employ the quantitative sandwich enzyme immunoassay technique. Specific antibodies were pre-coated onto the microplate. The standards, and samples were pipetted into the wells and the cytokines were bound by the immobilized antibody. After washing away any unbound substances, an enzyme-linked secondary antibody specific for TNF-␣ or IL-6 was added to the wells. Following color development, the assay was stopped, and the absorbance was read at 450 nm. The intensity of the color was proportional to the amount of the corresponding TNF-␣ or IL-6 (Tracey and Cerami, 1993) bound in the initial step. 2.5.7. Caspase-3 activity The activity of caspase-3 was assayed using ELISA kits (R&D Systems MN, USA) according to the manufacturer’s instructions. Caspase-3 in both standards and samples was sandwiched by the immobilized antibody and a biotinylated polyclonal antibody specific for caspase-3, which was recognized by a streptavidin–peroxidase conjugate. All unbound material was then washed away, and a peroxidase enzyme substrate was added. The color development was stopped with an acid stop solution that converts the end point color to yellow. The intensity of the color was measured at 450 nm using a microtitration plate reader (Fernandes-Alnemri et al., 1994).

3

Table 1 RT-PCR primers used in the gene expression analysis. Gene name

Primer sequence

Primer size (bp)

␤-Actin

F GAGACCTTCAACACCCCAGC R ATGTCACGCACGATTTCCC F GGACATGGATTACTCCCAGGTACACTT R AGGTTGCCCACGACCATGAGGTATA F CATGAAGAGAAGACACTGACCATGGAAA R TGGATAGAGGCTAAGTGT AGACACG F GGATGCGTCCACCAAGAAG R CAAAGTAGAAGAGGGCAACCAC F TGTGGTCCATCTGACCCTCC R ACATCTCCCTGTTGACGCTCT

263

Nrf2 NFk-B Bax Bcl-2

267 329 194 224

2.5.8. Quantitative real time-polymerase chain reaction (qRT-PCR) for analysis of hepatic nuclear factor-erythroid-2-related factor2 (Nrf2), nuclear factor-kappa B (NF-B), Bcl-2-associated X (Bax) and Beta cell lymphoma-2 (Bcl-2) mRNA expression The liver tissues were homogenized using QIAzol lysis reagent with a Tissue Ruptor (Roche). Total RNA was isolated using Tripure Isolation Reagent (Roche) according to the manufacturer’s instructions. Complementary DNA (cDNA) was generated using Superscript Choice Systems (Life Technologies, Breda, Netherlands) according to the manufacturer’s instructions. To assess the mRNA expression of Nrf2, NF-␬B, Bax and Bcl-2, quantitative real-time PCR was performed using SYBR green PCR Master Mix (Applied Biosystems, CA, USA) as described by the manufacturer. Briefly, in a 25 ␮l reaction volume, 5 ␮l of cDNA were added to 12.5 ␮l of 2× SYBR green Master Mix and 200 ng of each primer. The sequences of primers are described in Table 1. The temperature profile was as follows: 94 ◦ C for 3 min, 94◦ C for 20 s, 60 ◦ C for 20 s and 72◦ C for 20 s for 35 cycles. The expression level was calculated from the PCR cycle number (CT) where the increased fluorescence curve passes across a threshold value. The relative expression of target genes was obtained using comparative CT (CT) method. The CT was calculated by subtracting ␤-actin CT from that of target gene whereas CT was obtained by subtracting the CT of calibrator sample (control group) from that of test sample. The relative expression was calculated from the 2−CT formula (Livak and Schmittgen, 2001). 2.5.9. Detection of DNA damage by comet assay Single cell gel electrophoresis assay (also known as comet assay) was performed as previously described by Singh et al. (1988). This test is a rapid, sensitive and simple method for detecting DNA damage. With increasing number of breaks, DNA pieces migrate freely into the tail of the comet. The tail length and the percentage of total DNA in the tail reflect DNA damage, which is directly related to the frequency of breaks over a wide range of damage. Liver tissues were minced and homogenized in 50 mmol/l cold sodium phosphate buffer (pH 7.0) containing 0.1 mmol/l EDTA to produce 10% homogenates (w/v). The homogenates were then centrifuged at 1000 rpm for 10 min at 4 ◦ C. Two hundred and fifty microliter of the resulting supernatant were embedded in low-melting agarose (0.65%) that was layered onto fully frosted microscope slides coated with a layer of 0.75% normal agarose (diluted in Ca2+ and Mg2+ free phosphate buffer saline [PBS]). A final layer of 0.65% low-melting agarose was placed on top. Slides were immersed in a jar containing cold lysate solution (1% Triton X-100, 10% DMSO and 89% of 10 mmol/l Tris, 1% sodium lauryl sarcosine, 2.5 mol/l NaCl, 100 mmol/l Na2 EDTA, pH 10) at 4 ◦ C for 1–2 h. Then, slides were pretreated for 15 min in electrophoresis buffer (300 mmol/l NaOH, 1 mmol/l Na2 EDTA, pH 12) and exposed to 25 V/300 mA for 20 min. Pre-incubation and electrophoresis were performed in ice-bath. Slides were neutralized for 3–5 min in 0.4 M

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model ETP-50880; No. of Pages 10

ARTICLE IN PRESS S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

4

Tris, pH 7.5, and DNA was stained by adding 50 ml of ethidium bromide (20 mg/ml) onto each slide. After staining for 5 min, slides were rinsed in distilled water and covered again for microscopic examination. All steps were conducted under dimmed light to prevent additional DNA damage. Image analysis was performed with a Leitz Orthoplane Pi fluorescence microscope (magnification 2009) equipped with an excitation filter of 515–560 nm and a barrier filter of 590 nm. The microscope was connected through a camera to a computer-based image analysis system (Comet Assay IV software, Perspective Instruments). One hundred randomly selected cells per slide were scored. 2.5.10. Histopathological examination After deparaffinization and dehydration, sections of 4 ␮m thickness were stained with hematoxylin and eosin (H&E) and examined under the light microscope (Bancroft and Stevens, 1996). All histopathologic processing and assessment of specimens were performed by an experienced observer unaware of the identity of the sample being examined to avoid any bias. 2.6. Statistical analysis Data were expressed as means ± S.E.M. Statistical analysis was performed using Instat-3 computer program (Graph pad software Inc, San Diego, CA, USA). One way analysis of variance (ANOVA) by SPSS 12 program followed by Post HOC test was used to determine the differences between means of different groups. The level of significance was set at P < 0.05 using Tukey’s test. 3. Results 3.1. Inhibition of TiO2 NPs-induced liver injury As shown in Table 2, TiO2 NPs intoxication increased significantly the coefficient of the liver as well as the serum levels of ALT and AST by 16.8%, 57.2% and 41.35%, respectively, as compared to the control values. On the other hand, in groups given idebenone, carnosine, vitamin E, the coefficient of the liver and the levels of liver enzymes were comparatively lower than the TiO2 NPs intoxicated group, implying their possible protective effects on hepatocytes. Interestingly, the tested parameters were reverted back to near normal when the three antioxidants were administered in combination. 3.2. Modulation of oxidative stress biomarkers TiO2 NPs intoxication induced a state of oxidative stress evidenced by increment of MDA levels and reduction of GSH levels in hepatic tissue as compared to the control (Table 3). Administration of idebenone, carnosine and vitamin E significantly suppressed MDA values with the combination regimen displaying the most pronounced effect (almost 3-fold reduction) relative to TiO2 NPs intoxicated group. In the meantime, idebenone, carnosine, vitamin E and their combination elevated GSH values by 14.1%, 42.25%, 15.5% and 39.4%, respectively, as compared to animals treated with

TiO2 NPs alone. It is worthy noted that carnosine exhibited the most pronounced effect in this regard. The data presented in Fig. 1 revealed that TiO2 NPs intoxication up-regulated the mRNA level of Nrf2 by almost 8-fold as compared to the control value. Administration of idebenone, carnosine, and vitamin E noticeably down-regulated its expression level with the combination regimen showing the most significant effect in comparison to animals treated only with TiO2 NPs. 3.3. Effect of idebenone, carnosine, vitamin E and their combination on CD68 expression pattern Fig. 2 revealed that the highest CD68-positive cells density was in TiO2 NPs group whereas the least immunoreactivity was in the idebenone and the combination groups. On the other hand, both carnosine and vit.E groups displayed slight immunoreactivity with relatively low areas of cells stained for CD68. 3.4. Effect of idebenone, carnosine, vitamin E and their combination on NF-B expression and inflammatory cytokines levels The data in Fig. 1 indicated that TiO2 NPs intoxication caused a significant up-regulation in mRNA level of NF-␬B by almost 3-fold as compared to the control value. Nevertheless, a significant downregulation was apparent in mice treated with idebenone, carnosine, vitamin E. Besides, the combination regimen considerably reversed the level of NF-␬B back near to the normal value. As shown in Table 4, the hepatic levels of TNF-␣ and IL-6 were significantly increased in TiO2 NPs group, reaching 174.7 and 250.6%, respectively, as compared to the normal control. Administration of idebenone, carnosine, vitamin E reduced significantly these levels compared to TiO2 NPs intoxicated group. These reductions were amounted to 18.8% and 10.06% for idebenone group, 6.4% and 26.75% for carnosine group, and 17.8% and 21.9% for vitamin E group. Meanwhile, when the three antioxidants were combined, the amount of decrease was augmented to about 33% for both TNF␣ and IL-6. 3.5. Effect of idebenone, carnosine, vitamin E and their combination on apoptosis and DNA damage As shown in Table 4, TiO2 NPs intoxication produced a significant elevation in hepatic caspase-3 activity (167.3%) as compared to the control value. Moreover, there was a significant up-regulation of mRNA Bax level along with a significant down-regulation of mRNA Bcl-2 level by almost 20- and 5-fold, respectively, as compared to the control values (Fig. 3) Administration of idebenone, carnosine, vitamin E either alone or in combination counteracted these changes by causing a significant reduction in caspase-3 activity that reached 71.1%, 68.08%, 74.2% and 63.5%, respectively, as compared to TiO2 NPs group. Additionally, they significantly reduced Bax level and elevated Bcl-2 level with the vit. E and the combination groups displaying the most significant effect.

Table 2 Effect of idebenone (ID), carnosine (CR), vitamin E (Vit.E) and their combination on the coefficient of liver and serum aminotransferases activities in TiO2 NPs-induced liver damage. Parameter

Control

TiO2

TiO2 + ID

TiO2 + CR

TiO2 + Vit.E

TiO2 + ID + CR + Vit.E

Liver/BW (mg/g) ALT (U/l) AST (U/l)

54.2 ± 0.16* 14.5 ± 0.25* 32.4 ± 0.2*

63.3 ± 0.24# 22.8 ± 0.75¶ 45.8 ± 0.17@

54.6 ± 0.2* 16.2 ± 0.28@ 42.2 ± 0.16#

58.3 ± 0.19* 18.1 ± 0.18$ 41.3 ± 0.14#

55.4 ± 0.22* 20.01 ± 0.14§ 42.279 ± 0.09#

54.3 ± 0.18* 15.1 ± 0.15# 32.9 ± 0.14*

Data were expressed as means ± S.E.M. (n = 10). Groups having similar symbols are not significantly different from each other; and those having different symbols are significantly different from each other. Liver/BW: coefficient of liver (liver weight/body weight), ALT: alanine aminotransferase, AST: aspartate aminotransferase.

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model

ARTICLE IN PRESS

ETP-50880; No. of Pages 10

S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

5

Table 3 Effect of idebenone (ID), carnosine (CR), vitamin E (Vit.E) and their combination on hepatic malondialdehyde and glutathione levels in TiO2 NPs-induced liver damage. Parameter

Control

TiO2

TiO2 + ID

TiO2 + CR

TiO2 + Vit.E

TiO2 + ID + CR + Vit.E

MDA (nmol/mg protein) GSH (mmol/g tissue)

8.36 ± 0.17* 1.154 ± 0.09@

27.5 ± 0.16$ 0.71 ± 0.01*#

18.92 ± 0.12$ 0.81 ± 0.01*

13.21 ± 0.09# 1.01 ± 0.03#

16.84 ± 0.1@ 0.82 ± 0.02*

8.96 ± 0.17* 0.99 ± 0.03*

Data are expressed as means ± S.E.M. (n = 10), Groups having similar symbols are not significantly different from each other; and those having different symbols are significantly different from each other. GSH: glutathione, MDA: malondialdehyde.

Fig. 1. Effect of idebenone, carnosine, vitamin E and their combination on mRNA expression of Nrf2 and NF␬B following TiO2 NPs administration. ␤-Actin was used as an internal control for calculating mRNA fold changes. Data are expressed as means ± S.E.M. (n = 10). P-Value <0.05 is considered significant. Groups having the same symbols are not significantly different from each other, while those having different symbols are significantly different from each other.

Fig. 2. Detection of CD68 in TiO2 NPs treated groups. TiO2 NPs group showing extensive expression, whereas idebenone, carnosine, vit.E and combination groups attenuated CD68 expression. No expression was detected in the control group and thus not represented. P-Value <0.05 is considered significant. Groups having the same symbols are not significantly different from each other, while those having different symbols are significantly different from each other.

Table 4 Effect of idebenone (ID), carnosine (CR), vitamin E (Vit.E) and their combination on hepatic tumor necrosis factor and interleukin-6 levels as well as caspase-3 activity in TiO2 NPs-induced liver damage. Parameter

Control

TiO2

TiO2 + ID

TiO2 + CR

TiO2 + Vit.E

TiO2 + ID + CR + Vit.E

TNF-␣ (␳g/g tissue) IL-6 (␳g/g tissue) Caspase-3 (ng/g tissue)

16.36 ± 0.14* 15.95 ± 0.04* 3.52 ± 0.16*

28.5 ± 1.1@ 39.97 ± 1.1$ 5.89 ± 0.01@

23.15 ± 2.6# 35.95 ± 2.4@ 4.19 ± 0.07#

26.68 ± 0.5@ 29.28 ± 0.1# 4.01 ± 0.09#

23.42 ± 0.17# 31.22 ± 0.6# 4.37 ± 0.49#

19.17 ± 0.1* 26.78 ± 0.3# 3.74 ± 0.95*

Data are expressed as means ± S.E.M. (n = 10). Groups having similar symbols are not significantly different from each other; Groups having different symbols are significantly different from each other. TNF-␣: tumor necrosis factor, IL-6: interleukin-6.

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model ETP-50880; No. of Pages 10 6

ARTICLE IN PRESS S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

Fig. 3. Effect of idebenone, carnosine, vitamin E and their combination on mRNA expression of Bax and Bcl-2 following TiO2 NPs administration. ␤-Actin was used as an internal control for calculating mRNA fold changes. Data are expressed as means ± S.E.M. (n = 10). P-Value <0.05 is considered significant. Groups having the same symbols are not significantly different from each other, while those having different symbols are significantly different from each other.

Furthermore, comet assay revealed a remarkable DNA damage in the hepatic tissue following TiO2 NPs administration (Fig. 4 and Table 5). These antioxidants significantly reversed DNA damage by almost 50% as compared to TiO2 NPs group. It is worthy noted that the combination regimen exhibited a relatively higher effect in this respect.

3.6. Histopathological findings Fig. 5 and Table 6 showed that TiO2 NPs intoxicated group displayed massive focal degeneration of hepatocytes with mononuclear cellular infiltration (B). Idebenone group showed regeneration of many of degenerated hepatocytes with some cellular infiltration

Fig. 4. Effect of idebenone (ID), carnosine (CR), vitamin E (Vit.E) and their combination on percentage of DNA damage following TiO2 NPs administration. Slides (1 and 2): the control group with no significant DNA damage. Slides (3 and 4): the TiO2 NPs intoxicated group with a marked percent of DNA damage. Slides (5 and 6), (7 and 8) and (9 and 10) showed lesser percent of DNA damage in TiO2 NPs + ID, TiO2 NPs + CR and TiO2 NPs + Vit.E groups, respectively, than TiO2 group. Slides (11 and 12): TiO2 NPs+ the combined therapy showing the most significant reduction in the percent of DNA damage.

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model

ARTICLE IN PRESS

ETP-50880; No. of Pages 10

S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

7

Table 5 Percentage of DNA damage in groups treated with TiO2 NPs, idebenone (ID), carnosine (CR), vitamin E (Vit.E) and their combination. Groups

Tailed cell (%)

Control TiO2 TiO2 + ID TiO2 + CR TiO2 + Vit.E TiO2 + ID + CR + Vit.E

5 15 12 10 11 9

± ± ± ± ± ±

Untailed (%)

0.01 0.02 0.03 0.09 0.09 0.08

95 85 88 90 89 91

± ± ± ± ± ±

Tail length (␮m)

0.04 0.01 0.1 0.03 0.02 0.09

2.08 5.28 4.05 4.02 4.52 3.39

± ± ± ± ± ±

0.02 0.01 0.0.1 0.01 0.02 0.01

DNA (%)

Tail moment

2.54 6.08 3.98 3.88 4.42 3.88

5.28 32.10 16.12 15.60 19.98 13.15

± ± ± ± ± ±

0.02* 0.09$ 0.02@ 0.03@ 0.03@ 0.01#

Data are expressed as means ± S.E.M (n = 6). Groups having similar symbols are not significantly different from each other; and those having different symbols are significantly different from each other.

Table 6 Histopathological alterations in in hepatic tissues of different experimental groups. Histopathological alterations

Control

TiO2 NPs

ID

CAR

Vit.E

COMB

Congestion Inflammatory cells infiltration in portal area Focal necrosis in hepatic parenchyma Karyocytomegaly Fibroblastic cells proliferation in portal area

− − − − −

+++ + ++ − −

+ − − − −

+++ ++ − − −

− + − − −

− − − − −

+++ Extensive, ++ moderate, + mild, − Nil. TiO2 NPs; titanium dioxide nanparticles, ID; idebenone, CR; carnosine, Vit.E; vitamin E, COMB; combination.

(C) whereas in carnosine group, cellular infiltration and congestion of the portal vein were still noticed (D). Meanwhile, liver section of mice treated with vitamin E showed healing of degenerated hepatocytes with very few cellular infiltration (E). Finally, apparently normal liver architecture was seen in the group receiving the combination regimen.

4. Discussion Despite the many benefits of nanotechnology, studies have indicated that certain NPs may cause adverse effects because of their small size and unique properties (Sayes et al., 2007). TiO2 NPs may cause more inflammatory tissue damage than larger particles of the same material and at the same mass dose delivery (Xiong et al., 2011). High toxicity of ultrafine particles has been reported to be associated with respiratory, cardiovascular and liver diseases (Pekkanen et al., 2002). The current study showed that TiO2 NPs intoxication increased significantly the coefficient of the liver as well as ALT and AST serum levels, compared to the control group (Table 2). Increased liver enzymes pointed to cellular leakage and loss of functional integrity of liver cell membranes (Liu et al., 2010). Liver injury was also confirmed histopathologically by the appearance of massive focal degeneration of hepatocytes with mononuclear cellular infiltration in TiO2 NPs group. Previous researches have noticed liver dysfunction, inflammatory cascade and histopathological changes of liver and brain as a result of intraperitoneal injection and/or intragastric administration of TiO2 NPs in mice and these concur with our findings (Ne et al., 2006; Liu et al., 2009). Treatment with idebenone, carnosine, vitamin E and their combination exhibited a significant reduction in liver function enzymes activities as compared to TiO2 NPs group. This reduction reflected the hepatoprotective effect of these agents. In harmony, Shivaram et al. (1998) have found that idebenone protected against bile acid-induced hepatocellular injury in isolated rat hepatocytes. Moreover, carnosine mitigated thioacetamide-induced liver cirrhosis and prevented liver ischemia in rats by attenuating the increased ALT, AST, myeloperoxidase and GSH levels (Baykara et al., 2009; Aydin et al., 2010). Similarly, the protective effect of vitamin E against hepatic tissue injury has been formerly documented by several investigators (Fantappiè et al., 2004; Giakoustidis et al., 2006).

Disturbances in the normal redox state of cells can cause toxic effects through the production of peroxides and free radicals that damage cell components including proteins, lipids and DNA. Studies have demonstrated that the pathogenic mechanisms initiated by NPs are dominated by inflammation-driven effects such as oxidative stress, apoptosis and DNA damage (Pekkanen et al., 2002; Asuku et al., 2011). In this context, the present study elucidated that the oral administration of TiO2 NPs caused a significant elevation in the hepatic levels of MDA along with a significant reduction in GSH levels, indicating that livers of TiO2 NPs-treated mice underwent severe oxidative stress. According to Ma et al. (2010), TiO2 NPs enhanced the formation of lipid peroxides in mice brain and liver, prompting an oxidative attack that was activated by a reduction of the antioxidative defense mechanism. In fact, TiO2 NPs could release ROS (•OH and O2 •− ) and cause apoptosis (Long et al., 2007; Li et al., 2010b). Interaction between H2 O2 and O2 •− creates •OH and 1O2 , which are far more destructive and can peroxidize the unsaturated lipid of the cell membrane (Fridovich, 1978). Idebenone, carnosine, vitamin E or their combination ameliorated the encountered oxidative damage (Table 3). This effect might be related to the radical scavenging and the antioxidant boosting potentials of these agents. Indeed, idebenone reduced the generation of ROS in mitochondria during hydrophobic bile acid toxicity (Shivaram et al., 1998). Also, the pre-intake of carnosine significantly alleviated acetaminophen-induced oxidative stress by increasing GSH content, decreasing MDA and ROS formations, and retaining the activity of glutathione peroxidase, catalase, and SOD in liver (Yan et al., 2009). Likewise vitamin E, owing to its hydrophobicity, is incorporated into cell membranes protecting them from oxidative damage (Traber and Stevens, 2011) Under normal conditions, Nrf2 is inactive in cytoplasm because it is bound to Kelchlike ECH-associated protein 1 (keap1). Increased ROS production activates Nrf2 transcription factor by freeing it from Nrf2/keap1 complex. The free Nrf2 is then translocated into the nucleus where it binds to the antioxidant responsive element (ARE), and transcriptionally activates downstream target genes including those of antioxidant enzymes. Thus, Nrf2 confers cytoprotection against oxidative stress- or chemical-induced cellular damage (Okuda et al., 1989). In this study, amelioration of TiO2 NPs-induced over expression of Nrf2 by idebenone, carnosine and vitamin E might be related to their ROS quenching effects (Fig. 1). Activation of Kupffer cells, the resident hepatic macrophage population, is a key component of the pathogenesis of liver injury

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model ETP-50880; No. of Pages 10 8

ARTICLE IN PRESS S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

Fig. 5. Light photomicrograph of hematoxylin and eosin-stained liver sections. (A) Control group with normal histological structure of the central vein (CV) and surrounding hepatocytes (h). (B) TiO2 NPs intoxicated group showing massive focal necrosis (n) in hepatic parenchyma with inflammatory cells infiltration (m) surrounding the dilated portal vein (PV). (C) TiO2 NPs + ID group showing regeneration of many of degenerated hepatocytes with some cellular infiltration in the portal area. (D) TiO2 NPs + CR group showing congestion in the portal vein associated with periductal inflammatory cells infiltration (arrows) surrounding the bile ducts (bd). (E) Liver section of mice receiving TiO2 NPs + Vit.E showing healing of degenerated hepatocytes with very few cellular infiltration although a dilatation was noticed in the central vein. (F) Liver section of mice receiving TiO2 NPs+ the combined therapy having apparently normal liver architecture with diffuse proliferation (arrow)×40 magnification.

(Gadd et al., 2013). The pattern of expression of membrane receptors and antigens like CD68 has been shown to reflect their state of activation. Activated macrophages express a range of cytokines, such as TNF-␣, IL-6, and chemokines which would strengthen the continuation of inflammatory response and further encourage the migration of macrophages/monocytes and T cells to the inflammatory site (McGuinness et al., 2000). Herein, the significant increase in CD68-positive cells in TiO2 group supported the role of these cells in progressive liver injury (Fig. 2). Moreover, the activation of the pluripotent transcription factor NF-␬B is a pivotal molecular event in response to injury. In its latent form, NF-kB is bound to its inhibitor I␬B-␣. Activation of NF␬B involves the proteolytic cleavage of I␬B-␣ from NF-␬B (Henkel et al., 1993). NF-␬B then translocates to the nucleus and stimulates the transcription of target genes encoding inflammatory cytokines, chemokines, growth factors, cell adhesion proteins, and cytokine

receptors (Baeuerle and Henkel, 1994). Oxidative stress has been proposed to play a key role in NF-␬B activation by diverse agents. This hypothesis is based on the observations that oxidants such as H2 O2 can activate NF-␬B (Schreck et al., 1991), and that drugs with antioxidant properties have strong inhibitory effects on NF-␬B activation (Schreck et al., 1992). In line, treatment with idebenone, carnosine, vitamin E or their combination suppressed macrophage activation in the liver (Fig. 2) and attenuated the elevated levels of NF-␬B, TNF-␣ and IL-6 detected in TiO2 group (Fig. 1 and Table 4), implying that the anti-inflammatory role of these agents is associated with the amelioration of oxidative damage (Nagaki et al., 2000; Yano et al., 2000; Calfee-Mason et al., 2002; Sha et al., 2014). Apoptosis maintains the cellular homeostasis between cell division and cell death. Apoptosis is triggered via two principal signaling pathways; the death receptor-mediated extrinsic apoptotic pathway and the mitochondrion-mediated intrinsic

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model ETP-50880; No. of Pages 10

ARTICLE IN PRESS S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

apoptotic pathway. In this later, cells respond to various stressful stimuli by prompting apoptosis through Bax/Bcl-2/caspase-9 cascade where caspase-9 cleaves and activates the apical effector caspases such as caspase-3. Caspase-3 is thus regarded as one of the key executioners of apoptosis, being responsible either partly or totally for the proteolytic cleavage of many key proteins (Kandasamy et al., 2003). In the current investigation, oral administration of TiO2 NPs caused a significant elevation in caspase-3 activity along with an up-regulation of Bax level and a downregulation of Bcl-2 level. These findings coincide with the previous report of Li et al. (2010b), which highlighted the involvement of the mitochondrion-mediated pathway in TiO2 NPs-induced apoptosis of splenocytes. TiO2 NPs were also found to be potent inducers of Bax and inhibitors of Bcl-2 (Yao et al., 2008). Treatment with idebenone, carnosine, vitamin E, and their combination alleviated these changes (Fig. 3 and Table 4). These results confirmed that the apoptotic cell death, induced by these NPs, was at least in part related to ROS formation. Actually, Fadda (2013) has demonstrated that the protective effect of idebenone was mediated via the reduction of ROS production and the attenuation of apoptosis. Carnosine was also found to be effective in preventing apoptosis via its ability to bind to metals such as copper and zinc (Yan et al., 2009). Additionally, it has been indicated that vitamin E supplementation reduced oocytes apoptosis in nicotine-treated mice, owing to its antioxidant and radical scavenging properties (Asadi et al., 2012). Penetration of NPs into the nucleus has been reported in a number of studies. Once inside the nucleus, NPs may cause several biological responses including DNA strand breaks (Collins et al., 1996; Vinzents et al., 2005). As shown in Fig. 4 and Table 5, TiO2 NPs induced liver DNA damage, whereas idebenone, carnosine, vitamin E or their combination mitigated this damage. These data were reinforced by the study of Xiong et al. (2011), which suggested that TiO2 NPs-induced DNA damage is oxidative stress-dependent. Virtually, ROS react with DNA molecule, causing damage to purine and pyrimidine bases of DNA backbone, apoptosis and thereby cell death (Martinez et al., 2003; Trouiller et al., 2009). Thus, it is plausible that these agents could prevent DNA damage via their antioxidative effects. In harmony, H2 O2 -elicited severe damage to nuclear DNA was down-regulated by idebenone (Palumbo et al., 2002). Carnosine prevented ferritin/H2 O2 -mediated DNA strand breakage by inhibiting ferritin/H2 O2 -mediated •OH generation and decreasing the mutagenicity of DNA (Auroma et al., 1989). Moreover, the role of vitamin E in inhibiting 2-nitropropane-induced liver DNA damage in rats has been related to its ability to intercept ROS generation before being diffused to nucleus, causing DNA damage (Cadenas et al., 1997; Makpol et al., 2011). 5. Conclusion Taken together, the results of this study revealed that TiO2 NPs trigger oxidative stress, inflammatory cascade, and potentially enhance the apoptotic machinery and DNA damage, resulting in severe liver injury. Idebenone, carnosine and vitamin E alleviated the hazards associated with TiO2 NPs administration, with the combination regimen showing a relatively more potent effect. The hepatoprotective effects of these agents seem to be mediated via their antioxidant, anti-inflammatory and anti-apoptotic activities. Eventually, the study supports the use of these antioxidants as a protective approach against the toxic effects of NPs. Acknowledgement The authors acknowledge the financial assistance provided by The National Research Center, Gizza, Egypt.

9

References Asadi E, Jahanshahi M, Golalipour MJ. Effect of vitamin E on oocytes apoptosis in nicotine-treated mice. Iran J Basic Med Sci 2012;15(3):80–4. Asuku O, Atawodi SE, Onyike E. Antioxidant, hepatoprotective and ameliorative effects of methanolic extract of leaves of Grewia mollis Juss. on carbon tetrachloride-treated albino rats. J Med Food 2011;15(1):83–8. Auroma OI, Laughton MJ, Halliwell B. Carnosine, homocarnosine and anserine: could they act as antioxidants in vivo? Biochem J 1989;264:863–9. Aydin AF, Küskü-Kiraz Z, Do˘gru-Abbaso˘glu S, Güllüo˘glu M, Uysal M, Koc¸ak-Toker N. Effect of carnosine against thioacetamide-induced liver cirrhosis in rat. Peptide 2010;31(1):67–71. Baeuerle PA, Henkel T. Function and activation of NF-B in the immune system. Annu Rev Immunol 1994;12:141–79. Bancroft JD, Stevens A. Theory and practice of histological techniques. 4th ed. London: Churchill Livingstone; 1996. p. 163. Baykara B, Tekmen I, Pekcetin C, Ulukus C, Tuncel P, Sagol O, et al. The protective effects of carnosine and melatonin in ischemia–reperfusion injury in the rat liver. Acta Histochem 2009;111(1):42–51. Borm PJ, Robbins D, Haubold S, Kuhlbusch T, Fissan H, Donaldson K, et al. Ultrafine particle deposition and clearance in the healthy and obstructed lung. Am J Respir Crit Care Med 2002;166(9):1240–7. Cadenas S, Barja1 G, Poulsen HE, Loft S. Oxidative DNA damage estimated by oxo8dG in the liver of guinea-pigs supplemented with graded dietary doses of ascorbic acid and ␣-tocopherol. Carcinogenesis 1997;18:2373–7. Calfee-Mason KG, Spear BT, Glauert HP. Vitamin E inhibits hepatic NF-kappa B activation in rats administered the hepatic tumor promoter, phenobarbital. J Nutr 2002;132(10):3178–85. Collins AR, Dusinska M, Gedik CM, Stetina R. Oxidative damage to DNA: do we have a reliable biomarker? Environ Health Perspect 1996;104:465–9. Cunningham BW, Orbegoso CM, Dmitriev AE, Hallab NJ, Sefter JC, McAfee PC. The effect of titanium particulate on development and maintenance of a posterolateral spinal arthrodesis: an in vivo rabbit model. Spine 2002;27:1971–81. Fadda LM. Ameliorative effect of quercetin and idebenone against oxidative stress, inflammation, DNA damage and apoptosis induced in rat livers after oral exposure to titanium dioxide nanoparticles. In: OMICS group conference of toxicology; 2013. Fantappiè O, Lodovici M, Fabrizio P, Marchettia S, Fabbroni V, Solazzo M, et al. Vitamin E protects DNA from oxidative damage in human hepatocellular carcinoma cell lines. Free Radical Res 2004;38(7):751–9. Fernandes-Alnemri T, Litwack G, Alnemri ES. CPP32, a novel human apoptotic protein with homology to Caenorhabditis elegans cell death protein Ced-3 and mammalian interleukin-1 beta-converting enzyme. J Biol Chem 1994;269(49):30761–4. Fridovich I. The biology in oxygen radical. Science 1978;201:875–88. Gadd VL, Melino M, Roy S, Horsfall L, O’Rourke P, Williams MR, et al. Portal, but not lobular, macrophages express matrix metalloproteinase-9: association with the ductular reaction and fibrosis in chronic hepatitis C. Liver Int 2013;33(4):569–79. Giakoustidis D, Papageorgiou G, Iliadis S, Giakoustidis A, Kostopoulou E, Kontos N, et al. The protective effect of alpha-tocopherol and GdCl3 against hepatic ischemia/reperfusion injury. Surg Today 2006;36(5):450–6. Henkel T, Machleidt T, Alkalay I, Kronke M, Ben-Neriah Y, Baeuerle P. Rapid proteolysis of IkB-␣ is necessary for activation of the transcription factor NF-kB. Nature 1993;365:182–5. Ishrat T, Parveen K, Hoda MN, Khan MB, Yousuf S, Ansari MA, et al. Effects of pycnogenol and vit E on cognitive deficits and oxidative damage induced by intracerebroventricular streptozotocin in rats. Behav Pharmacol 2009;20(7):567–75. Kandasamy K, Srinivasula SM, Alnermri ES, Thompson CB, Korsmeyer SJ, Bryant JL, et al. Involvement of proapoptotic molecules Bax and Bak in tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-cytochrome c and Smac/DIABLO release. Cancer Res 2003;63:1712–21. Lakho GR, Rohra DK. Targeting apoptosis with compounds from commonly used medicinal plants: a possible aid in the fight against cancer. Med Hypotheses Res 2006;3:643–50. Li N, Duan Y, Hong M, Zheng L, Fei M, Zhao X, et al. Spleen injury and apoptotic pathway in mice caused by titanium dioxide nanoparticles. Toxicol Lett 2010b;195:161–8. Li N, Ma L, Wang J, Zheng L, Liu J, Duan Y, et al. Interaction between nano-anatase TiO2 and liver DNA from mice in vitro. Nanoscale Res Lett 2010a;5:108–15. Liu HT, Ma LL, Liu J, Zhao JF, Yan JY, Hong F. Toxicity of nano-anatase TiO2 to mice: liver injury, oxidative stress. Toxicol Environ Chem 2010;92(1):175–86. Liu HT, Ma LL, Zhao JF, Liu J, Yan JY, Ruan J. Biochemical toxicity of mice caused by nano-anatase TiO2 particles. Biol Trace Elem Res 2009;129(1):170–80. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2 (−Delta Delta C (T)) Method. Methods 2001;25:402–8. Long TC, Tajuba J, Sama P, Sale N, Swartz J. Nano-TiO2 stimulates ROS in brain microglia and damages neurons in vitro. Environ Health Perspect 2007;115:1631–7. Ma LL, Liu J, Li N, Wang J, Duan YM, Yan JY, et al. Oxidative stress in the brain of mice caused by translocated nanoparticulate TiO2 delivered to the abdominal cavity. Biomaterials 2010;31:99–105. Ma LL, Zhao JF, Wang J, Duan YM, Liu J, Li N, et al. The acute liver injury in mice caused by nano-anatase TiO2 . Nanoscale Res Lett 2009;4:1275–85.

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001

G Model ETP-50880; No. of Pages 10 10

ARTICLE IN PRESS S.A.A. Azim et al. / Experimental and Toxicologic Pathology xxx (2015) xxx–xxx

Makpol S, Durani LW, Chua KH, Yusof YAM, Ngah WZW. Tocotrienol-rich fraction prevents cell cycle arrest and elongates telomere length in senescent human diploid fibroblasts. J Biomed Biotechnol 2011;2011:1–11, http://dx.doi.org/10.1155/2011/506171. Martinez GR, Loureiro AP, Marques SA, Miyamoto S, Yamaguchi LF, Onuk J, et al. Oxidative and alkylating damage in DNA. Mutat Res 2003;544:115–27. McGuinness PH, Painter D, Davies S, McCaughan GW. Increases in intrahepatic CD68 positive cells, MAC387 positive cells, and proinflammatory cytokines (particularly interleukin 18) in chronic hepatitis C infection. Gut 2000;46(2):260–9. Moron MS, Depierre J, Mannervik B. Levels of glutathione, glutathione reductase and glutathione-S-transferase activities in rat lung and liver. Biochem Biophys Acta 1979;582:67–78. Nagaki M, Naiki T, Brenner DA, Osawa Y, Imose M, Hayashi H, et al. Tumor necrosis factor ␣ prevents tumor necrosis factor receptor-mediated mouse hepatocyte apoptosis, but not fas-mediated apoptosis: role of nuclear factor-␬B. Hepatology 2000;32:1272–9. Ne A, Xia T, Madler L, Li N. Toxic potential of materials at the nanolevel. Science 2006;311:622–7. Ohkawa H, Ohishi N, Yagi K. Assay for lipid peroxides in animal tissues by thiobarbituric acid reaction. Anal Biochem 1979;95:351–8. Okuda A, Imagawa M, Maeda Y, Sakai M, Muramatsu M. Structural and functional analysis of an enhancer GPEI having a phorbol 12-O-tetradecanoate 13-acetate responsive element-like sequence found in the rat glutathione transferase P gene. J Biol Chem 1989;264:16919–26. Palumbo M, Russo A, Cardile V, Renis M, Paolino D, Puglisi G, et al. Improved antioxidant effect of idebenone-loaded polyethyl-2-cyanoacrylate nanocapsules tested on human fibroblasts. Pharm Res 2002;19(1):71–8. Parnetti L. Clinical pharmacokinetics of drugs for Alzheimers disease. Clin Pharmacokinet 1995;29(2):110–29. Pekkanen J, Peters A, Hoek G, Tiittanen P, Brunekreef B, de Hartog J, et al. Particulate air pollution and risk of ST-segment depression during repeated submaximal exercise tests among subjects with coronary heart disease: the exposure and risk assessment for fine and ultrafine particles in ambient air [ultra] study. Circulation 2002;106:933–8. Peters A, Veronesi B, Calderon-Garciduenas L, Gehr P, Geiser M. Translocation and potential neurological effects of fine and ultrafine particles a critical update. Part Fibre Toxicol 2006;3:13. Qureshi AA, Reis JC, Qureshi N, Papasian CJ, Morrison DC, Schaefer DM. ␦-Tocotrienol and quercetin reduce serum levels of nitric oxide and lipid parameters in female chickens. Lipids Health Dis 2011;10:39–58. Reddy VP, Garrett MR, Perry G, Smith MA. Carnosine a versatile antioxidant and antiglycating agent. Sci Aging Knowl Environ 2005;18:pe12. Reitman S, Frankle S. A colorimetric method for determination of serum glutamic oxaloacetic and glutamic pyruvic transaminases. Am J Clin Path 1957;28(1):56–63. Renner C, Zemitzsch N, Fuchs B, Geiger KD, Hermes M, Hengstler J, et al. Carnosine retards tumor growth in vivo in an NIH3T3-HER2/neu mouse model. Mol Cancer 2010;9:2, http://dx.doi.org/10.1186/1476-4598-9-2. Sayes CM, Reed KL, Warheit DB. Assessing toxicity of fine and nanoparticles: comparing in vitro measurements to in vivo pulmonary toxicity profiles. Toxicol Sci 2007;97:163–80.

Schaffer S, Muller WE, Eckert GP. Tocotrienols: constitutional effects in aging and disease. J Nutr 2005;135:151–4. Schreck R, Meier B, Mannel DN, Droge W, Baeuerle BA. Dithiocarbamates as potent inhibitors of nuclear factor kB activation in intact cells. J Exp Med 1992;175:1181–94. Schreck R, Rieber P, Baeuerle PA. Reactive oxygen intermediates as apparently widely used messengers in the activation of NF-kB transcription factor and HIV-1. EMBO J 1991;10:2247–58. Seznec H, Simon D, Monassier L, Criqui-Filipe P, Gansmuller A, Rustin P, et al. Idebenone delays the onset of cardiac functional alteration without correction of Fe–S enzymes deficit in a mouse model for Friedreich ataxia. Hum Mol Genet 2004;13:1017–24. Sha B, Gao W, Wang S, Gou X, Li W, Liang X, et al. Oxidative stress increased hepatotoxicity induced by nano-titanium dioxide in BRL-3A cells and Sprague-Dawley rats. J Appl Toxicol 2014;34(4):345–56. Shivaram KN, Winklhofer-Roob BM, Straka MS, Devereaux MW, Everson G, Mierau GW, et al. The effect of idebenone, a coenzyme Q analogue, on hydrophobic bile acid toxicity to isolated rat hepatocytes and hepatic mitochondria. Free Radical Biol Med 1998;25(4–5):480–92. Singh NP, McCoy MT, Tice RR, Schneider EL. A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 1988;175:184–91. Traber MG, Stevens JF. Vitamins C and E: beneficial effects from a mechanistic perspective. Free Radical Biol Med 2011;51(5):1000–13. Tracey KJ, Cerami A. Tumor necrosis factor, other cytokines and disease. Annu Rev Cell Biol 1993;9:317–43. Trouiller B, Reliene R, Westbrook A, Solaimani P, Schiest RH. Titanium dioxide nanoparticles induce DNA damage and genetic instability in vivo in mice. Cancer Res 2009;69(22):8784–9. Vinzents PS, Møller P, Sørensen M, Knudsen LE, Hertel O, Jensen FP, et al. Personal exposure to ultrafine particles and oxidative DNA damage. Environ Health Perspect 2005;113:1485–90. Wang JX, Zhou GQ, Chen CY, Yu HW, Wang TC, Ma YM, et al. Acute toxicity and biodistribution of different sized titanium dioxide particles in mice after oral administration. Toxicol Lett 2007;168:176–85. Xiong D, Fang T, Yu L, Sima X, Zhu W. Effects of nano-scale TiO2 , ZnO and their bulk counterparts on zebrafish: acute toxicity, oxidative stress and oxidative damage. Sci Total Environ 2011;409(8):1444–52. Yan SL, Wu ST, Yin MC, Chen HT, Chen HC. Protective effects from carnosine and histidine on acetaminophen-induced liver injury. J Food Sci 2009;74(8): H259–65. Yano M, Kishida E, Iwasaki M, Kojo S, Masuzawa Y. Docosahexaenoic acid and vitamin E can reduce human monocytic U937 cell apoptosis induced by tumor necrosis factor. J Nutr 2000;130(5):1095–101. Yao JC, Jiang ZZ, Duan WG, Huang JF, Zhang LY, Hu L, et al. Involvement of mitochondrial pathway in triptolide induced cytotoxicity in human normal liver L-02 cells. Biol Pharm Bull 2008;31:592–7. Zhang X, Song L, Cheng X, Yang Y, Luan B, Jia L, et al. Carnosine pretreatment protects against hypoxia-ischemia brain damage in the neonatal rat model. Eur J Pharmacol 2011;667(1–3):202–7. Zingg JM. Modulation of signal transduction by vitamin E. Mol Aspects Med 2007;28:481–506.

Please cite this article in press as: Azim SAA, et al. Amelioration of titanium dioxide nanoparticles-induced liver injury in mice: Possible role of some antioxidants. Exp Toxicol Pathol (2015), http://dx.doi.org/10.1016/j.etp.2015.02.001