- Email: [email protected]
Amplification and cloning of infectious bursal disease virus genomic RNA segments by long and accurate PCR
Journal of Virological Methods 82 (1999) 55 – 61 www.elsevier.com/locate/jviromet
Amplification and cloning of infectious bursal disease virus genomic RNA segments by long and accurate PCR Aydemir Akin, Ching Ching Wu *, Tsang Long Lin Department of Veterinary Pathobiology, School of Veterinary Medicine, Purdue Uni6ersity, West Lafayette, IN 47907 -1175, USA Received in revised form 17 May 1999; accepted 18 May 1999
Abstract Improved methods of reverse transcription, polymerase chain reaction (PCR) amplification, and cloning of full-length coding region of both strands of infectious bursal disease virus (IBDV) variant strain E genome were developed. Denaturation of IBDV RNA by heat in the presence of primers and use of a reverse transcriptase lacking RNase-H activity produced full-length coding region and partial non-coding region cDNA copies of the viral genomic segments. Digestion of the RNA component of RNA-cDNA hybrids by RNase-H followed by long and accurate PCR (LA-PCR) amplification of IBDV cDNA in a single step resulted in the synthesis of 3182 base-pairs (bp) of segment A and 2777 bp of segment B cDNA copies of IBDV genome. The resulting amplicons were successfully cloned and sequenced revealing their identity of IBDV. The LA-PCR method can be utilized for the amplification and cloning of the other IBDV strains or isolates and will greatly enhance the availability of sequence information or infectious cDNA copies of IBDV. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Long PCR; Long and accurate PCR; LA-PCR; Infectious bursal disease virus; IBDV; Amplification; Double-stranded RNA; dsRNA
1. Introduction Infectious bursal disease virus (IBDV) is a member of the Birnaviridae family, which is divided into three main genera: Aquabirnavirus (e.g. infectious pancreatic necrosis virus), Entomobirnavirus (e.g. drosophila-X virus), and Avibirnavirus (e.g., IBDV). Classification into genera is based on the host range of the bir-
* Corresponding author. Fax: +1-765-4949181. E-mail address: [email protected] (C. Ching Wu)
navirus for efficient replication and pathogenicity. Infectious bursal disease virus is an economically important pathogen in the poultry industry. Immunosuppression caused by the IBDV makes chickens susceptible to other diseases, and interferes with effective vaccination against infectious bronchitis, Marek’s disease, and Newcastle disease (Allan et al., 1972; Giambrone et al., 1977; Jen and Cho, 1980). Two serotypes of IBDV exist; serotype 1 contains viruses that cause an acute disease in young chickens and serotype 2 contains viruses that are not known to induce disease in chickens.
0166-0934/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 9 ) 0 0 0 8 3 - X
56
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
The virus has a nonenveloped and icosohedral shaped virion. The genome of IBDV consists of two segments (large and small segments) of high molecular weight double-stranded (ds) RNA (Muller et al., 1979). A 90 kDa-polypeptide links the two segments (Spies et al., 1987). The lengths of the segments vary slightly among different strains. Large RNA and small RNA segments of Cu-1 strain of IBDV were found to be 3261 and 2827 base-pairs (bp), respectively (Mundt and Muller, 1995). Complete nucleotide sequences have been published for only a small number of IBDV strains. The main setback for the availability of complete sequence information for most IBDV strains are the lengthy processing time using traditional cloning methods and the difficulty in obtaining sequence information at the ends of the viral segments. To obtain a full-length cDNA clone of the virus, partial overlapping fragments were cloned into plasmid vectors, recombinants were screened and sequenced, and some selected plasmids were reassembled to form the complete sequence by means of restriction enzyme digestion and subcloning into plasmid vectors (Hudson et al., 1986; Baylis et al., 1990; Kibenge et al., 1990; Vakharia et al., 1992). This process is extremely time consuming and technically challenging, and failure to obtain a satisfactory sequence information is not uncommon. Recently, by using the traditional method mentioned above, infective full-length cDNA clones of IBDV were produced (Mundt and Vakharia, 1996). RNA produced from the clones was successfully transfected into cells to produce the first recombinant infectious IBDV (Lana et al., 1992; Mundt and Vakharia, 1996). Availability of full-length infectious cDNA clones would definitely expand the current knowledge of the viral genome, virus replication and its antigenic properties at the molecular level. Moreover, by modification of the viral genome, more potent IBDV vaccines could be developed. In this respect, improvement of a method that surpasses the current limitations of the cloning procedures is vital for the determination of complete nucleotide sequences of different strains of IBDV. To overcome these obstacles, polymerase chain reaction (PCR) and TA-cloning approach, where the addition of a deoxyadenosine residue at the each
3% ends of a dsDNA molecule by virtue of nonspecific terminal transferase activity of Thermus aquaticus (Taq) polymerase, were utilized to clone the PCR amplicons into a plasmid vector with 3% overhanging deoxythymidine residues. However, the benefit of such approach has been limited due to inadequacy of Taq polymerase to amplify efficiently longer than 2 kb of cDNA fragments. Recently, several modifications to PCR have been reported to enable amplification of long regions, i.e. 42 Kb pairs of DNA (Barnes, 1994; Cheng et al., 1994). These modifications included: the additions of an additional thermophylic polymerase with proof reading activity (3% –5% exonuclease) into PCR mixture to remove the mismatched bases that cause a pause in polymerization mediated by Taq, reduction of denaturation time to as low as 2 s for up to 18 kb of template, and use of a variant of Taq polymerase (KlenTaq). Some modifications in the buffer composition were also suggested to protect DNA from being nicked at elevated temperatures due to acidic conditions (alkaline tricine buffer). Digestion of the RNA portion of the RNA-cDNA hybrids that were produced by reverse transcription by treatment with RNase-H was also reported to improve amplification of long regions of cDNA from RNA templates. In the present study, reverse transcription using a reverse transcriptase lacking RNase-H activity followed by a single step of long and accurate PCR (LA-PCR) was utilized for the first time to completely amplify the full-length coding region of cDNA copies of IBDV dsRNA genome segments.
2. Materials and methods
2.1. Virus Chickens (3-week-old) were orally infected with variant E strain of IBDV. Bursae were aseptically removed from the chickens and 0.5 g of bursae were homogenized in PBS (pH 7) and used to extract and purify dsRNA of IBDV.
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
2.2. Extraction of 6iral RNA An improved RNA extraction process was used to obtain purified dsRNA of the virus from the bursal homogenates (Davis and Boyle, 1990a,b; Wu et al., 1992; Akin et al., 1998). Briefly, the bursal homogenates were freeze-thawed three times and treated with proteinase K (100 mg/ml) and 1% of sodium dodecyl sulfate SDS for 2 h at 60°C. Then 0.2% diethylpyrocarbonate (DEPC) was added and incubation was continued for additional 30 min. Afterwards, potassium acetate was added (1 M final) and total nucleic acids were precipitated with 2.5 volumes of absolute ethanol followed by centrifugation at 14 000× g for 30 min. The dsRNA of the virus was purified from the total nucleic acids by a two-step differential lithium chloride (2 and 4 M, respectively) precipitation (Diaz-Ruiz and Kaper, 1978). The viral RNA was finally dissolved in RNase-free sterile deionized water (sdH2O) and stored at −80°C. A portion of the RNA was quantified by spectrophotometry with wavelength set at 260 nm.
2.3. Oligodeoxynuclotide primers The nucleotide sequences of the oligonucleotides used in RT, LA-PCR, and sequencing are listed in Table 1. The primers AUIP, BUIP, T7N
57
and Sp6N were used for confirmation of orientation of the clones.
2.4. Re6erse transcription and LA-PCR The purified dsRNA of variant E strain of IBDV (1 mg) was heat denatured at 100°C for 3 min and slowly cooled to 22°C in 15 min in RT buffer (Superscript II system, Life Technologies, Gaithersburg, MD) which contained either primers A and C mixture, 2 ng/ml of each primer, or random hexamers, 40 ng/ml. The reverse transcription was performed at 45°C for 60 min using a mutant form of MMLV reverse transcriptase (RTase) lacking RNase-H activity (Superscript II, Life Technologies) in a 20°C reaction. At the 30th min, 1 more microliter of RTase was added. At the end, 1 ml of RNase-H was added to the cDNA preparation to degrade the RNA portion of RNA:cDNA hybrids of IBDV genome and incubated at 37°C for 15 min. The reverse transcriptase and the RNase-H was inactivated by heating the reaction for 10 min at 85°C. Then, 40 ml of sdH2O was added to the reaction. Full-length coding region of IBDV genome was amplified by LA-PCR using primers A and C for segment A and primers UVP1 and LVP1 for segment B (Table 1). The primers were derived from the 5’ and 3’ ends of conserved sequences of
Table 1 Oligonucleotides used for the long and accurate polymerase chain reaction (LA-PCR) amplification of full-length coding region cDNA of IBDV genomic segment A or Ba Primer
A C AUIP UVP1 LVP1 BUIP T7N Sp6N
Nucleotide sequence
gaattcCAGGATGGAACTCC atgcatGTTGTAAGGCCGAATTGG AGATAGTGACCTCCAAATGTG GMAWTAACGTGGCTAGGGGYGAT AGGSCGGGGATAMGGGGTCT GGGGTACCGGGATCCAGCAGGCATACAAG AgggatccTAATACGACTCACTATAGGG GagaattcATTTAGGTGACACTATAGAATAC
Used in
Location
RT
PCR
+ +
+ + + + + +
+ +
SQ
+
+ + +
A 58-74 (s) A 3232-3213 (as) A 1062-1082 (s) B 33-58 (s) B 2809-2790 (as) B 1947-1968 (s) T7 Promoter Sp6 Promoter
a Restriction enzyme sites are in small caps. The locations of the sequences are where the primers anneal in the published sequence of P2 strain of IBDV (Genbank accession nos X84034 and X84035). The restriction enzyme sites are not included in numbering. (s): sense orientation, (as): antisense orientation, RT: reverse transcription, PCR: polymerase chain reaction, SQ, sequencing; +, used in the described reaction.
58
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
segments A and B of different IBDV strains (P2, Cu-1, 23/82, STC, OH, QC-2) that have published nucleotide sequences to date (Genbank, Bethesda, MD, USA). To amplify the full-length coding region of variant strain E genome, several conditions were tested: amount of cDNA in the amplification reaction, removal of RNA:cDNA hybrids, magnesium concentration, duration of denaturation during PCR amplification, and different polymerase mixtures. The following conditions were used to amplify the IBDV genomic segments. The PCR was carried out with either Taq DNA polymerase (Life Technologies) and Vent DNA polymerase (New England Biolabs, Beverly, MA) together in a 64:1 (v:v) ratio mixture or Taq DNA polymerase and Pfu polymerase (Stratagene, La Jolla, CA) together in a 64:1 (v:v) ratio mixture. Reactions of 100 ml were set up in 200 ml thin wall PCR tubes. The buffer that was used for PCR contained 10 mM Tris – hydrochloride (pH 9.0), 50 mM potassium chloride, 2 mM magnesium chloride, 0.2 mM dNTP mixture, 0.1% triton X-100,0.25 pmol of each primer, and 1 ml ( 3 U/ml) of the polymerase mixture. Then 3 ml of the cDNA was used as template in the LA-PCR. The PCR mixture without the polymerase was incubated at 94°C for 1 min and the temperature was lowered to 80°C where the polymerase mixture was added. The mixture was incubated for 5 min. The cyclic conditions of the LA-PCR was 94°C, 10 s for denaturation; 58°C, 30 s for annealing; and 72°C, 3 min and 30 s for extension. These conditions were applied for 35 cycles and the amplified products were extended to full-length by incubation at 72°C for 15 min. Following the LA-PCR, the reaction products were either analyzed by agarose gel (0.8%) electrophoresis or used for cloning immediately.
2.5. Cloning of cDNA amplicons of small and large IBDV genome segments Of the LA-PCR product, 50 ml were extracted with phenol:chlorophorm:isoamylalcohol (25:24:1, v:v) and 10 ml of the extracted material was used in another set of PCR. In this PCR, primers and dNTPs, except for dATP, was omitted and instead of polymerase mixture, Taq polymerase
alone was used to add an adenine residue to the 3% end of the PCR products. The reaction was heated to 72°C and incubated for 15 min and cooled slowly. Of the reaction, 2 ml mixture was used directly to clone into the EcoRI site of either pCR-II (segment A) or pCR3.1-uni (segment B) plasmid vector (Invitrogen, San Diego, CA) as described by the manufacturer. Full-length clones were screened by amplification with either T7N and Sp6N primers, or segment-specific primers (Table 1). The orientation and the identity of the full-length products were confirmed by inclusion of an internal primer specific for either segment A (primer AUIP) or segment B (primer BUIP) in the above reaction and the results were analyzed by agarose gel electrophoresis and ethidium bromide staining.
2.6. Nucleotide sequencing The nucleotide sequences of coding regions of both segments A and B were determined by an automated DNA sequencer using Li-Cor longread sequencing reaction kit (MacConnell Research Corp., San Diego, CA).
3. Results and discussion
3.1. Extraction of 6iral dsRNA and synthesis of cDNA The variant E strain of IBDV was used to develop a LA-PCR method that surpassed the limitations of cloning and subcloning procedures for the production of full-length coding region cDNA clones of IBDV. The IBDV viral dsRNA was extracted and purified from the bursae of Fabricius of chickens. The RNA purification procedure described above produced 1.98 mg of purified IBDV dsRNA of very good quality (l260/ 280o 1.8). For the synthesis of cDNA, both AMV and a mutated form of MMLV reverse transcriptases (Superscript II RTase) were used in the presence of virus-specific primers or random hexamers. Only Superscript II RTase reaction produced long cDNA products of IBDV in both specifically and non-specifically primed cDNA
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
preparations as judged by LA-PCR. The amount and quality of the full-length IBDV cDNA synthesized was greater and higher when random hexamers were used to prime the reverse transcription than when virus-specific primers were used (data not shown). This result is attributable to the lack of RNase-H activity in the Superscript II RTase that enables the production of long cDNA transcripts. Following the synthesis of cDNA, RNA portion of the RNA:cDNA hybrids from the viral genes were digested with RNase-H to improve the LA-PCR amplification since the viral RNA can also serve as template and reduce the efficiency of the PCR. For the production of long cDNA products of IBDV, incubation of the viral dsRNA at 95°C for only 1 min was sufficient to denature the viral RNA. Infectious bursal disease virus dsRNA did not need to be treated with either dimethyl-sulphoxide or methylmercury hydroxide as was done by others (Qian and Kibenge, 1994).
3.2. LA-PCR amplification The LA-PCR procedure produced two amplification products of 3182 and 2777 bp corresponding to segment A and B of IBDV, respectively (Fig. 1). During the amplification from cDNA templates by LA-PCR procedure, it was necessary to use a hot-start method, in which DNA polymerase was added when reaction temperature was at 75–80°C after the initial denaturation step, and a combination of Taq and Pfu polymerases (64:1, v:v). Another combination of polymerase mix, Taq and Vent DNA polymerases (30:1, 64:1, v:v) was also tested but was found to be unsuitable for the procedure since there was no specific amplification product (data not shown). Presence of Pfu DNA polymerase with proof reading activity in the amplification reactions decreases the amplification errors associated with Taq DNA polymerase. Following the amplification of both segments of IBDV, the amplicons from segment A were successfully cloned into EcoRI site of pCRII vector producing pCR-A clone and from segment B into EcoRI site of pCR3.1-uni vector producing pCR-B clone (Fig. 2). In both cases, the orientation of the insert was such that it
59
Fig. 1. Agarose gel electrophoresis of amplified small and large segments of infectious bursal disease virus cDNA by a long and accurate polymerase chain reaction (LA-PCR) procedure. The dsRNA of variant E strain IBDV was obtained and used for reverse transcription by Superscript II RTase in the presence of random primers. The resulting cDNA was amplified by LA-PCR with the primers A and C (Table 1) to produce 3182 base-pairs (bp) of large segment A (lane 2) and primers UVP1 AND LVP1 to produce 2777 bp of small segment B (lane 3) of IBDV cDNA. Lane 1 is the 1 Kbp molecular weight marker (Life Sciences, Gaithersburg, MD).
would produce a sense strand of the viral segments when transcribed by the bacteriophage T7 RNA polymerase. The recombinant vectors were transformed into E. coli and potential clones were screened by PCR amplification by the segment specific primers (primers A and C for segment A; primers UVP1 and LVP1 for segment B, Table 1). Single clones for both segments were identified and used for sequencing. Following the sequencing reactions, 3182 bp of segment A sequence and 2777 bp of segment B sequence from variant E strain of IBDV were obtained. The sequences were deposited in the Genbank database with the accession numbers AF133904 for segment A and AF133905 for segment B. The sequences analyzed against the known sequences of IBDV that had been deposited at Genbank were confirmed to have the identity of IBDV (data not shown).
60
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
Fig. 2. A schematic representation of cloning large (A) and small (B) segment genes of infectious bursal disease virus. The clones pCR-A is derived from pCR-II (Invitrogen, San Diego, CA) for segment A and pCR-B is derived from pCR-3.1-uni (Invitrogen) for segment B. In both cases, the EcoRI site was used for the cloning of the PCR amplified segment A and segment B genes.
The cDNA preparation and LA-PCR method described here is very simple, efficient, and applicable to amplify and clone the full-length cDNA segments of RNA genomes of other IBDV strains or isolates. The procedure is capable of amplifying cDNA copies of viral RNA genomes at least up to 3182 bp in a single amplification reaction. The complete size of the segment A is 3261 bp and that of segment B is 2827 bp in P2 strain of IBDV (Mundt and Muller, 1995). Although the complete coding and partial non-coding sequences from IBDV strain E genome were successfully amplified, cloned and sequenced, 79 bp of noncoding region in segment A and 51 bp of noncoding region in segment B sequence remain to be determined. Currently, LA-PCR amplification of complete full-length cDNA of genomic segment A or B of IBDV variant strain E, including non-coding and coding regions is underway. Acknowledgements The authors thank the financial support provided by the School of Veterinary Medicine, Purdue University and the U.S. Department of Agriculture.
References Akin, A., Wu, C.C., Lin, T.L., 1998. A comparison of two RNA isolation methods for double-stranded RNA of infectious bursal disease virus. J. Virol. Methods 74, 179 – 184. Allan, W.H., Faragher, J.T., Cullen, G.A., 1972. Immuno-suppression by infectious bursal agent in chickens immunized against Newcastle disease. Vet. Rec. 90, 511 – 512. Barnes, W.M., 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216 – 2220. Baylis, C.D., Spies, U., Shaw, K., Peters, R.W., Papageorgiou, A., Muller, H., Boursnell, M.E.G., 1990. A comparison of the sequences of segment A of four infectious bursal disease virus strains and identification of a variable region in VP2. J. Gen. Virol. 71, 1303 – 1312. Cheng, S., Higuchi, R., Stoneking, M., 1994. Complete mitochondrial genome amplification. Nat. Genet. 7, 350 – 351. Davis, V.S., Boyle, J.A., 1990a. Adapting the polymerase chain reaction to a double-stranded RNA genome. Anal. Biochem. 189, 30 – 34. Davis, V.S., Boyle, J.A., 1990b. Random cDNA probes to infectious bursal disease virus. Avian Dis. 34, 329 – 335. Diaz-Ruiz, J.R., Kaper, J.M., 1978. Isolation of viral doublestranded RNAs using a LiCl fractionation procedure. Prep. Biochem. 8, 1 – 17. Giambrone, J.J., Eidson, C.S., Kleven, S.H., 1977. Effect of infectious bursal disease on the response of chickens to Mycoplasma syno6iae, Newcastle disease virus, and infectious bronchitis virus. Am. J. Vet. Res. 38, 251 – 253.
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61 Hudson, P.J., McKern, N.M., Power, B.E., Azad, A.A., 1986. Genomic structure of the large RNA segment of infectious bursal disease virus. Nucleic Acids Res. 14, 5001–5012. Jen, L.W., Cho, B.R., 1980. Effects of infectious bursal disease on Marek’s disease vaccination: suppression of antiviral immune response. Avian Dis. 24, 896–907. Kibenge, F.S.B., Jackwood, D.J., Mercado, C.C., 1990. Nucleotide sequence analysis of genome segment A of infectious bursal disease virus. J. Gen. Virol. 71, 569–577. Lana, D.P., Beisel, C.E., Silva, R.F., 1992. Genetic mechanisms of antigenic variation in infectious bursal disease virus: analysis of a naturally occuring variant virus. Virus Genes 6, 247 – 259. Muller, H., Scholtissek, C., Becht, H., 1979. The genome of infectious bursal disease virus consists of two segments of double-stranded RNA. J. Virol. 31, 584–589. Mundt, E., Muller, H., 1995. Complete nucleotide sequences of 5%- and 3%-noncoding regions of both genome segments
.
61
of different strains of infectious bursal disease virus. Virology 209, 10 – 18. Mundt, E., Vakharia, V.N., 1996. Synthetic transcripts of double-stranded birnavirus genome are infectious. Proc. Natl. Acad. Sci. USA 93, 11131 – 11136. Qian, B., Kibenge, F.S.B., 1994. Observations on polymerase chain reaction amplification of infectious bursal disease virus dsRNA. J. Virol. Methods 47, 1 – 2. Spies, U., Muller, H., Becht, H., 1987. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Res. 8, 127 – 140. Vakharia, V.N., Ahamed, B., He, J., 1992. Use of polymerase chain reaction for efficient cloning of dsRNA segments of infectious bursal disease virus. Avian Dis. 36, 736 – 742. Wu, C.C., Lin, T.L., Zhang, H.G., Davis, V.S., Boyle, J.A., 1992. Molecular detection of infectious bursal disease virus. Avian Dis. 36, 221 – 226.
Amplification and cloning of infectious bursal disease virus genomic RNA segments by long and accurate PCR Aydemir Akin, Ching Ching Wu *, Tsang Long Lin Department of Veterinary Pathobiology, School of Veterinary Medicine, Purdue Uni6ersity, West Lafayette, IN 47907 -1175, USA Received in revised form 17 May 1999; accepted 18 May 1999
Abstract Improved methods of reverse transcription, polymerase chain reaction (PCR) amplification, and cloning of full-length coding region of both strands of infectious bursal disease virus (IBDV) variant strain E genome were developed. Denaturation of IBDV RNA by heat in the presence of primers and use of a reverse transcriptase lacking RNase-H activity produced full-length coding region and partial non-coding region cDNA copies of the viral genomic segments. Digestion of the RNA component of RNA-cDNA hybrids by RNase-H followed by long and accurate PCR (LA-PCR) amplification of IBDV cDNA in a single step resulted in the synthesis of 3182 base-pairs (bp) of segment A and 2777 bp of segment B cDNA copies of IBDV genome. The resulting amplicons were successfully cloned and sequenced revealing their identity of IBDV. The LA-PCR method can be utilized for the amplification and cloning of the other IBDV strains or isolates and will greatly enhance the availability of sequence information or infectious cDNA copies of IBDV. © 1999 Elsevier Science B.V. All rights reserved. Keywords: Long PCR; Long and accurate PCR; LA-PCR; Infectious bursal disease virus; IBDV; Amplification; Double-stranded RNA; dsRNA
1. Introduction Infectious bursal disease virus (IBDV) is a member of the Birnaviridae family, which is divided into three main genera: Aquabirnavirus (e.g. infectious pancreatic necrosis virus), Entomobirnavirus (e.g. drosophila-X virus), and Avibirnavirus (e.g., IBDV). Classification into genera is based on the host range of the bir-
* Corresponding author. Fax: +1-765-4949181. E-mail address: [email protected] (C. Ching Wu)
navirus for efficient replication and pathogenicity. Infectious bursal disease virus is an economically important pathogen in the poultry industry. Immunosuppression caused by the IBDV makes chickens susceptible to other diseases, and interferes with effective vaccination against infectious bronchitis, Marek’s disease, and Newcastle disease (Allan et al., 1972; Giambrone et al., 1977; Jen and Cho, 1980). Two serotypes of IBDV exist; serotype 1 contains viruses that cause an acute disease in young chickens and serotype 2 contains viruses that are not known to induce disease in chickens.
0166-0934/99/$ - see front matter © 1999 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 6 - 0 9 3 4 ( 9 9 ) 0 0 0 8 3 - X
56
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
The virus has a nonenveloped and icosohedral shaped virion. The genome of IBDV consists of two segments (large and small segments) of high molecular weight double-stranded (ds) RNA (Muller et al., 1979). A 90 kDa-polypeptide links the two segments (Spies et al., 1987). The lengths of the segments vary slightly among different strains. Large RNA and small RNA segments of Cu-1 strain of IBDV were found to be 3261 and 2827 base-pairs (bp), respectively (Mundt and Muller, 1995). Complete nucleotide sequences have been published for only a small number of IBDV strains. The main setback for the availability of complete sequence information for most IBDV strains are the lengthy processing time using traditional cloning methods and the difficulty in obtaining sequence information at the ends of the viral segments. To obtain a full-length cDNA clone of the virus, partial overlapping fragments were cloned into plasmid vectors, recombinants were screened and sequenced, and some selected plasmids were reassembled to form the complete sequence by means of restriction enzyme digestion and subcloning into plasmid vectors (Hudson et al., 1986; Baylis et al., 1990; Kibenge et al., 1990; Vakharia et al., 1992). This process is extremely time consuming and technically challenging, and failure to obtain a satisfactory sequence information is not uncommon. Recently, by using the traditional method mentioned above, infective full-length cDNA clones of IBDV were produced (Mundt and Vakharia, 1996). RNA produced from the clones was successfully transfected into cells to produce the first recombinant infectious IBDV (Lana et al., 1992; Mundt and Vakharia, 1996). Availability of full-length infectious cDNA clones would definitely expand the current knowledge of the viral genome, virus replication and its antigenic properties at the molecular level. Moreover, by modification of the viral genome, more potent IBDV vaccines could be developed. In this respect, improvement of a method that surpasses the current limitations of the cloning procedures is vital for the determination of complete nucleotide sequences of different strains of IBDV. To overcome these obstacles, polymerase chain reaction (PCR) and TA-cloning approach, where the addition of a deoxyadenosine residue at the each
3% ends of a dsDNA molecule by virtue of nonspecific terminal transferase activity of Thermus aquaticus (Taq) polymerase, were utilized to clone the PCR amplicons into a plasmid vector with 3% overhanging deoxythymidine residues. However, the benefit of such approach has been limited due to inadequacy of Taq polymerase to amplify efficiently longer than 2 kb of cDNA fragments. Recently, several modifications to PCR have been reported to enable amplification of long regions, i.e. 42 Kb pairs of DNA (Barnes, 1994; Cheng et al., 1994). These modifications included: the additions of an additional thermophylic polymerase with proof reading activity (3% –5% exonuclease) into PCR mixture to remove the mismatched bases that cause a pause in polymerization mediated by Taq, reduction of denaturation time to as low as 2 s for up to 18 kb of template, and use of a variant of Taq polymerase (KlenTaq). Some modifications in the buffer composition were also suggested to protect DNA from being nicked at elevated temperatures due to acidic conditions (alkaline tricine buffer). Digestion of the RNA portion of the RNA-cDNA hybrids that were produced by reverse transcription by treatment with RNase-H was also reported to improve amplification of long regions of cDNA from RNA templates. In the present study, reverse transcription using a reverse transcriptase lacking RNase-H activity followed by a single step of long and accurate PCR (LA-PCR) was utilized for the first time to completely amplify the full-length coding region of cDNA copies of IBDV dsRNA genome segments.
2. Materials and methods
2.1. Virus Chickens (3-week-old) were orally infected with variant E strain of IBDV. Bursae were aseptically removed from the chickens and 0.5 g of bursae were homogenized in PBS (pH 7) and used to extract and purify dsRNA of IBDV.
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
2.2. Extraction of 6iral RNA An improved RNA extraction process was used to obtain purified dsRNA of the virus from the bursal homogenates (Davis and Boyle, 1990a,b; Wu et al., 1992; Akin et al., 1998). Briefly, the bursal homogenates were freeze-thawed three times and treated with proteinase K (100 mg/ml) and 1% of sodium dodecyl sulfate SDS for 2 h at 60°C. Then 0.2% diethylpyrocarbonate (DEPC) was added and incubation was continued for additional 30 min. Afterwards, potassium acetate was added (1 M final) and total nucleic acids were precipitated with 2.5 volumes of absolute ethanol followed by centrifugation at 14 000× g for 30 min. The dsRNA of the virus was purified from the total nucleic acids by a two-step differential lithium chloride (2 and 4 M, respectively) precipitation (Diaz-Ruiz and Kaper, 1978). The viral RNA was finally dissolved in RNase-free sterile deionized water (sdH2O) and stored at −80°C. A portion of the RNA was quantified by spectrophotometry with wavelength set at 260 nm.
2.3. Oligodeoxynuclotide primers The nucleotide sequences of the oligonucleotides used in RT, LA-PCR, and sequencing are listed in Table 1. The primers AUIP, BUIP, T7N
57
and Sp6N were used for confirmation of orientation of the clones.
2.4. Re6erse transcription and LA-PCR The purified dsRNA of variant E strain of IBDV (1 mg) was heat denatured at 100°C for 3 min and slowly cooled to 22°C in 15 min in RT buffer (Superscript II system, Life Technologies, Gaithersburg, MD) which contained either primers A and C mixture, 2 ng/ml of each primer, or random hexamers, 40 ng/ml. The reverse transcription was performed at 45°C for 60 min using a mutant form of MMLV reverse transcriptase (RTase) lacking RNase-H activity (Superscript II, Life Technologies) in a 20°C reaction. At the 30th min, 1 more microliter of RTase was added. At the end, 1 ml of RNase-H was added to the cDNA preparation to degrade the RNA portion of RNA:cDNA hybrids of IBDV genome and incubated at 37°C for 15 min. The reverse transcriptase and the RNase-H was inactivated by heating the reaction for 10 min at 85°C. Then, 40 ml of sdH2O was added to the reaction. Full-length coding region of IBDV genome was amplified by LA-PCR using primers A and C for segment A and primers UVP1 and LVP1 for segment B (Table 1). The primers were derived from the 5’ and 3’ ends of conserved sequences of
Table 1 Oligonucleotides used for the long and accurate polymerase chain reaction (LA-PCR) amplification of full-length coding region cDNA of IBDV genomic segment A or Ba Primer
A C AUIP UVP1 LVP1 BUIP T7N Sp6N
Nucleotide sequence
gaattcCAGGATGGAACTCC atgcatGTTGTAAGGCCGAATTGG AGATAGTGACCTCCAAATGTG GMAWTAACGTGGCTAGGGGYGAT AGGSCGGGGATAMGGGGTCT GGGGTACCGGGATCCAGCAGGCATACAAG AgggatccTAATACGACTCACTATAGGG GagaattcATTTAGGTGACACTATAGAATAC
Used in
Location
RT
PCR
+ +
+ + + + + +
+ +
SQ
+
+ + +
A 58-74 (s) A 3232-3213 (as) A 1062-1082 (s) B 33-58 (s) B 2809-2790 (as) B 1947-1968 (s) T7 Promoter Sp6 Promoter
a Restriction enzyme sites are in small caps. The locations of the sequences are where the primers anneal in the published sequence of P2 strain of IBDV (Genbank accession nos X84034 and X84035). The restriction enzyme sites are not included in numbering. (s): sense orientation, (as): antisense orientation, RT: reverse transcription, PCR: polymerase chain reaction, SQ, sequencing; +, used in the described reaction.
58
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
segments A and B of different IBDV strains (P2, Cu-1, 23/82, STC, OH, QC-2) that have published nucleotide sequences to date (Genbank, Bethesda, MD, USA). To amplify the full-length coding region of variant strain E genome, several conditions were tested: amount of cDNA in the amplification reaction, removal of RNA:cDNA hybrids, magnesium concentration, duration of denaturation during PCR amplification, and different polymerase mixtures. The following conditions were used to amplify the IBDV genomic segments. The PCR was carried out with either Taq DNA polymerase (Life Technologies) and Vent DNA polymerase (New England Biolabs, Beverly, MA) together in a 64:1 (v:v) ratio mixture or Taq DNA polymerase and Pfu polymerase (Stratagene, La Jolla, CA) together in a 64:1 (v:v) ratio mixture. Reactions of 100 ml were set up in 200 ml thin wall PCR tubes. The buffer that was used for PCR contained 10 mM Tris – hydrochloride (pH 9.0), 50 mM potassium chloride, 2 mM magnesium chloride, 0.2 mM dNTP mixture, 0.1% triton X-100,0.25 pmol of each primer, and 1 ml ( 3 U/ml) of the polymerase mixture. Then 3 ml of the cDNA was used as template in the LA-PCR. The PCR mixture without the polymerase was incubated at 94°C for 1 min and the temperature was lowered to 80°C where the polymerase mixture was added. The mixture was incubated for 5 min. The cyclic conditions of the LA-PCR was 94°C, 10 s for denaturation; 58°C, 30 s for annealing; and 72°C, 3 min and 30 s for extension. These conditions were applied for 35 cycles and the amplified products were extended to full-length by incubation at 72°C for 15 min. Following the LA-PCR, the reaction products were either analyzed by agarose gel (0.8%) electrophoresis or used for cloning immediately.
2.5. Cloning of cDNA amplicons of small and large IBDV genome segments Of the LA-PCR product, 50 ml were extracted with phenol:chlorophorm:isoamylalcohol (25:24:1, v:v) and 10 ml of the extracted material was used in another set of PCR. In this PCR, primers and dNTPs, except for dATP, was omitted and instead of polymerase mixture, Taq polymerase
alone was used to add an adenine residue to the 3% end of the PCR products. The reaction was heated to 72°C and incubated for 15 min and cooled slowly. Of the reaction, 2 ml mixture was used directly to clone into the EcoRI site of either pCR-II (segment A) or pCR3.1-uni (segment B) plasmid vector (Invitrogen, San Diego, CA) as described by the manufacturer. Full-length clones were screened by amplification with either T7N and Sp6N primers, or segment-specific primers (Table 1). The orientation and the identity of the full-length products were confirmed by inclusion of an internal primer specific for either segment A (primer AUIP) or segment B (primer BUIP) in the above reaction and the results were analyzed by agarose gel electrophoresis and ethidium bromide staining.
2.6. Nucleotide sequencing The nucleotide sequences of coding regions of both segments A and B were determined by an automated DNA sequencer using Li-Cor longread sequencing reaction kit (MacConnell Research Corp., San Diego, CA).
3. Results and discussion
3.1. Extraction of 6iral dsRNA and synthesis of cDNA The variant E strain of IBDV was used to develop a LA-PCR method that surpassed the limitations of cloning and subcloning procedures for the production of full-length coding region cDNA clones of IBDV. The IBDV viral dsRNA was extracted and purified from the bursae of Fabricius of chickens. The RNA purification procedure described above produced 1.98 mg of purified IBDV dsRNA of very good quality (l260/ 280o 1.8). For the synthesis of cDNA, both AMV and a mutated form of MMLV reverse transcriptases (Superscript II RTase) were used in the presence of virus-specific primers or random hexamers. Only Superscript II RTase reaction produced long cDNA products of IBDV in both specifically and non-specifically primed cDNA
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
preparations as judged by LA-PCR. The amount and quality of the full-length IBDV cDNA synthesized was greater and higher when random hexamers were used to prime the reverse transcription than when virus-specific primers were used (data not shown). This result is attributable to the lack of RNase-H activity in the Superscript II RTase that enables the production of long cDNA transcripts. Following the synthesis of cDNA, RNA portion of the RNA:cDNA hybrids from the viral genes were digested with RNase-H to improve the LA-PCR amplification since the viral RNA can also serve as template and reduce the efficiency of the PCR. For the production of long cDNA products of IBDV, incubation of the viral dsRNA at 95°C for only 1 min was sufficient to denature the viral RNA. Infectious bursal disease virus dsRNA did not need to be treated with either dimethyl-sulphoxide or methylmercury hydroxide as was done by others (Qian and Kibenge, 1994).
3.2. LA-PCR amplification The LA-PCR procedure produced two amplification products of 3182 and 2777 bp corresponding to segment A and B of IBDV, respectively (Fig. 1). During the amplification from cDNA templates by LA-PCR procedure, it was necessary to use a hot-start method, in which DNA polymerase was added when reaction temperature was at 75–80°C after the initial denaturation step, and a combination of Taq and Pfu polymerases (64:1, v:v). Another combination of polymerase mix, Taq and Vent DNA polymerases (30:1, 64:1, v:v) was also tested but was found to be unsuitable for the procedure since there was no specific amplification product (data not shown). Presence of Pfu DNA polymerase with proof reading activity in the amplification reactions decreases the amplification errors associated with Taq DNA polymerase. Following the amplification of both segments of IBDV, the amplicons from segment A were successfully cloned into EcoRI site of pCRII vector producing pCR-A clone and from segment B into EcoRI site of pCR3.1-uni vector producing pCR-B clone (Fig. 2). In both cases, the orientation of the insert was such that it
59
Fig. 1. Agarose gel electrophoresis of amplified small and large segments of infectious bursal disease virus cDNA by a long and accurate polymerase chain reaction (LA-PCR) procedure. The dsRNA of variant E strain IBDV was obtained and used for reverse transcription by Superscript II RTase in the presence of random primers. The resulting cDNA was amplified by LA-PCR with the primers A and C (Table 1) to produce 3182 base-pairs (bp) of large segment A (lane 2) and primers UVP1 AND LVP1 to produce 2777 bp of small segment B (lane 3) of IBDV cDNA. Lane 1 is the 1 Kbp molecular weight marker (Life Sciences, Gaithersburg, MD).
would produce a sense strand of the viral segments when transcribed by the bacteriophage T7 RNA polymerase. The recombinant vectors were transformed into E. coli and potential clones were screened by PCR amplification by the segment specific primers (primers A and C for segment A; primers UVP1 and LVP1 for segment B, Table 1). Single clones for both segments were identified and used for sequencing. Following the sequencing reactions, 3182 bp of segment A sequence and 2777 bp of segment B sequence from variant E strain of IBDV were obtained. The sequences were deposited in the Genbank database with the accession numbers AF133904 for segment A and AF133905 for segment B. The sequences analyzed against the known sequences of IBDV that had been deposited at Genbank were confirmed to have the identity of IBDV (data not shown).
60
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61
Fig. 2. A schematic representation of cloning large (A) and small (B) segment genes of infectious bursal disease virus. The clones pCR-A is derived from pCR-II (Invitrogen, San Diego, CA) for segment A and pCR-B is derived from pCR-3.1-uni (Invitrogen) for segment B. In both cases, the EcoRI site was used for the cloning of the PCR amplified segment A and segment B genes.
The cDNA preparation and LA-PCR method described here is very simple, efficient, and applicable to amplify and clone the full-length cDNA segments of RNA genomes of other IBDV strains or isolates. The procedure is capable of amplifying cDNA copies of viral RNA genomes at least up to 3182 bp in a single amplification reaction. The complete size of the segment A is 3261 bp and that of segment B is 2827 bp in P2 strain of IBDV (Mundt and Muller, 1995). Although the complete coding and partial non-coding sequences from IBDV strain E genome were successfully amplified, cloned and sequenced, 79 bp of noncoding region in segment A and 51 bp of noncoding region in segment B sequence remain to be determined. Currently, LA-PCR amplification of complete full-length cDNA of genomic segment A or B of IBDV variant strain E, including non-coding and coding regions is underway. Acknowledgements The authors thank the financial support provided by the School of Veterinary Medicine, Purdue University and the U.S. Department of Agriculture.
References Akin, A., Wu, C.C., Lin, T.L., 1998. A comparison of two RNA isolation methods for double-stranded RNA of infectious bursal disease virus. J. Virol. Methods 74, 179 – 184. Allan, W.H., Faragher, J.T., Cullen, G.A., 1972. Immuno-suppression by infectious bursal agent in chickens immunized against Newcastle disease. Vet. Rec. 90, 511 – 512. Barnes, W.M., 1994. PCR amplification of up to 35-kb DNA with high fidelity and high yield from bacteriophage templates. Proc. Natl. Acad. Sci. USA 91, 2216 – 2220. Baylis, C.D., Spies, U., Shaw, K., Peters, R.W., Papageorgiou, A., Muller, H., Boursnell, M.E.G., 1990. A comparison of the sequences of segment A of four infectious bursal disease virus strains and identification of a variable region in VP2. J. Gen. Virol. 71, 1303 – 1312. Cheng, S., Higuchi, R., Stoneking, M., 1994. Complete mitochondrial genome amplification. Nat. Genet. 7, 350 – 351. Davis, V.S., Boyle, J.A., 1990a. Adapting the polymerase chain reaction to a double-stranded RNA genome. Anal. Biochem. 189, 30 – 34. Davis, V.S., Boyle, J.A., 1990b. Random cDNA probes to infectious bursal disease virus. Avian Dis. 34, 329 – 335. Diaz-Ruiz, J.R., Kaper, J.M., 1978. Isolation of viral doublestranded RNAs using a LiCl fractionation procedure. Prep. Biochem. 8, 1 – 17. Giambrone, J.J., Eidson, C.S., Kleven, S.H., 1977. Effect of infectious bursal disease on the response of chickens to Mycoplasma syno6iae, Newcastle disease virus, and infectious bronchitis virus. Am. J. Vet. Res. 38, 251 – 253.
A. Akin et al. / Journal of Virological Methods 82 (1999) 55–61 Hudson, P.J., McKern, N.M., Power, B.E., Azad, A.A., 1986. Genomic structure of the large RNA segment of infectious bursal disease virus. Nucleic Acids Res. 14, 5001–5012. Jen, L.W., Cho, B.R., 1980. Effects of infectious bursal disease on Marek’s disease vaccination: suppression of antiviral immune response. Avian Dis. 24, 896–907. Kibenge, F.S.B., Jackwood, D.J., Mercado, C.C., 1990. Nucleotide sequence analysis of genome segment A of infectious bursal disease virus. J. Gen. Virol. 71, 569–577. Lana, D.P., Beisel, C.E., Silva, R.F., 1992. Genetic mechanisms of antigenic variation in infectious bursal disease virus: analysis of a naturally occuring variant virus. Virus Genes 6, 247 – 259. Muller, H., Scholtissek, C., Becht, H., 1979. The genome of infectious bursal disease virus consists of two segments of double-stranded RNA. J. Virol. 31, 584–589. Mundt, E., Muller, H., 1995. Complete nucleotide sequences of 5%- and 3%-noncoding regions of both genome segments
.
61
of different strains of infectious bursal disease virus. Virology 209, 10 – 18. Mundt, E., Vakharia, V.N., 1996. Synthetic transcripts of double-stranded birnavirus genome are infectious. Proc. Natl. Acad. Sci. USA 93, 11131 – 11136. Qian, B., Kibenge, F.S.B., 1994. Observations on polymerase chain reaction amplification of infectious bursal disease virus dsRNA. J. Virol. Methods 47, 1 – 2. Spies, U., Muller, H., Becht, H., 1987. Properties of RNA polymerase activity associated with infectious bursal disease virus and characterization of its reaction products. Virus Res. 8, 127 – 140. Vakharia, V.N., Ahamed, B., He, J., 1992. Use of polymerase chain reaction for efficient cloning of dsRNA segments of infectious bursal disease virus. Avian Dis. 36, 736 – 742. Wu, C.C., Lin, T.L., Zhang, H.G., Davis, V.S., Boyle, J.A., 1992. Molecular detection of infectious bursal disease virus. Avian Dis. 36, 221 – 226.