Amplification and cloning of the Mycobacterium tuberculosis dnaA gene

Gene, 163 (1995) 75-79 © 1995 Elsevier Science B.V. All rights reserved. 0378-1119/95/$09.50

75

GENE 09121

Amplification and cloning of the Mycobacterium tuberculosis dnaA gene (DNA replication initiation; cloning; DNA sequencing; mycobacterial pathogens; PCR)

Malini Rajagopalan, Ming-hui Qin, Vincent A. Steingrube, Donald R. Nash, Richard J. Wallace Jr. and Murty V.V.S. Madiraju Department of Microbiology, University of Texas Health Center at Tyler, Tyler, TX 75710, USA Received by J. Wild: 19 January 1995; Revised/Accepted 28 April/23 May 1995; Received at publishers 12 June 1995

SUMMARY

To identify and subsequently clone the gene encoding the DnaA protein, degenerate oligodeoxyribonucleotide (oligo) primers targeted against two highly conserved domains of the eubacterial DnaA were used to amplify a 780-bp DNA region spanning the two primers from genomic DNA preparations of Mycobacterium tuberculosis (Mr), M. boris (Mb) and M. avium (Ma). Nucleotide (nt) sequences and deduced amino acid (aa) sequences of these fragments revealed homologies with each other and with the corresponding regions from other bacteria. Using an oligo specific to Mt dnaA as a probe, the Mt genomic DNA cosmid libraries propagated in Escherichia coli were screened and a cosmid DNA clone hybridizing with the oligo was identified. Furthermore, a 5-kb DNA fragment containing the Mt dnaA was subcloned into a pUC18 vector.

INTRODUCTION

In recent years, there has been an increase in the number of Mycobacterium tuberculosis (Mr) strains that are resistant to traditionally used anti-tuberculosis drugs in both immune compromised and immune competent people (Snider et al., 1994). Hence, development of new generation antibiotics targeted against key metabolic pathways such as the initiation of DNA replication, would provide new avenues for treatment of mycobacterial infections (Bates, 1995). DnaA protein is the key Correspondence to: Dr. M.V.V,S. Madiraju, Department of Microbiology, University of Texas Health Center at Tyler, Tyler, TX-75710, USA. Tel. (1-903) 877-2877; Fax (1-903) 877-7652; e-mail: [email protected] Abbreviations: A, absorbance (1 cm); aa, amino acid(s); bp, base pair(s); dnaA, gene encoding DnaA protein; Ec, Escherichia coli; HIV, human immunodeficiency virus; kb, kilobase(s) or 1000 bp; Ml, Micrococcus luteus; M., Mycobacterium; Ma, M. avium; Mb, M. boris; Mr; M. tuberculosis; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ori, origin(s) of DNA replication; PCR, polymerase chain reaction; Sc, Streptomyces coelicolor; SDS, sodium dodecyl sulfate; X, any aa.

SSD1 0378-1119(95)00403-3

mediator responsible for the initiation of DNA replication in eubacteria. It specifically interacts with the origin of DNA replication (ori), binds to 9 nt long sequences called the DnaA boxes and triggers a cascade of events resulting in replication initiation (Kornberg and Baker, 1991; Skarstadt and Boye, 1994). Thus, the interactions of DnaA protein with the ori are the key first steps involved in replication initiation in bacteria. As a first step in understanding replication initiation in mycobacteria, we have focused on identifying the dnaA gene. Many genes involved in DNA metabolism, e.g. recA, gyr and rne, are rather highly conserved (Dubnau, 1993; Kowalczykowski et al., 1994; Wang and Cohen, 1994; Yasbin et al., 1993). Cloning of these genes has been achieved by functional complementation. However, cloning of mycobacterial genes by functional complementation of well characterized Escherichia coli (Ec) mutant strains has met with limited success, presumably due to poor mycobacterial gene expression in Ec (Clark-Curtiss et al., 1985). The aim of this study was to clone dnaA gene segments from three mycobacterial species namely, Mt, M. boris (Mb) and M. avium (Ma ), using degenerate

76 oligo primers targeted against two highly conserved domains of DnaA protein. We also report on isolation of a Mt cosmid containing the putative dnaA gene and subsequent subcloning of a D N A fragment containing the Mt dnaA gene.

EXPERIMENTALAND DISCUSSION

M

1

2

3

4

kb 4.0--. 3.0 2.0--1.5---

(a) Amplification of the dnaA gene fragment Previous studies had identified dnaA mutant strains of Ec which are temperature sensitive (Kimura et al., 1979; Kornberg and Baker, 1991; Schaus et al., 1981). Our attempts to restore the temperature-resistant phenotype to Ec dnaA mutant strains by transforming with mycobacterial plasmid expression libraries were not successful (data not shown). This was not unexpected since functional complementation of Ec dnaA mutants is limited to only closely related G r a m - species such as Salmonella typhimurium and Serratia marcescens (Kornberg and Baker, 1991; Skovgaard and Hansen, 1987). However, comparative analyses of DnaA protein aa sequences from Gram + and G r a m - bacteria has revealed a high degree of structural conservation (for recent reviews see Skarstadt and Boye, 1994; Yoshikawa and Ogasawara, 1991). Of particular interest is the ATP-binding domain with a sequence motif G X X G X G K T H L and another domain of G G R D H T T sequence separated by 780 bp. We reasoned that degenerate oligo primers made against these regions should amplify the mycobacterial D N A region between the primers and facilitate cloning of the dnaA gene. Accordingly, degenerate oligo primers (see Fig. 1) were synthesized in a Pharmacia D N A synthesizer (Pharmacia Biotech, Piscataway, N J, USA) and used to amplify the D N A region spanning the two primers from genomic D N A preparations of Mt, M b and Ma. Examination of the PCR products following electrophoresis on agarose gels revealed the expected 780-bp fragment (Fig. 1). In addition to the expected 780-bp PCR product, fragments of 450 bp or less were obtained from Mb, Mt H37Ra and Mt H37Rv (Fig. 1, lanes 2-4). Presumably, these fragments could represent nonspecific amplification products. The oligo primers were also used to successfully amplify the 780-bp fragment from some other members of mycobacteria such as M. smegmatis, M. intracellulare, M. peregrinum and M. scrofulaceum (data not shown).

(b) Determination of nt sequence of PCR amplified dnaA fragments To confirm that the P C R product is the expected dnaA gene fragment and not a nonspecific amplification product, the 780-bp P C R fragments obtained from Mr, M b and Ma were. gel purified and separately cloned into

1.0---

0.5---

Fig. 1. Agarose-gelelectrophoresis of PCR products. Lanes: 1, Ma; 2, Mb; 3, Mt H37Ra; 4, Mt H37Rv. M refers to 1-kb ladder. Arrow head points to the expected 780-bp PCR product. Methods: Mycobacterial strains were grown with shaking at 37°Cto A 6 o o n m = 0.6 in Middlebrook 7H9 broth (Difco Laboratories, Detroit, MI)/0.05% Tween-80/0.05% bovine serum albumin/0.1% glucose. Cells were harvested, lysed following lysozyrne-SDSlysis protocol and genomic DNA was isolated as described (Husson et al., 1990). Two oligo primers, MVM8 (GGAGGCCTGGGBAARACNCACY) and MVM9 (TCCCCGCGGTSGTRTGRTCRCGDCC] were synthesized. (B=C or G or T; D=A or G or T; N=A or C or G or T; R=A or G; S=C or G; Y = C or T). MVM8 primer was made against the GKTHL region of the ATP-bindingdomain GXXGXGKTHL,whereas MVM9 primer was made against GRDHTT. The underlined region in the PCR primer sequence represents dnaA unrelated sequence incorporated for cloning purposes. Primers used for amplifications were synthesized in a Pharmacia DNA synthesizer and purified on Pharmacia NAP-10 sizing columns. DNA amplification reactions were carried out in a Coy thermocycler (Coy Corporation, Grass Lake, MI, USA) and contained the followingin a final reaction volume of 25 lal: 1 gM each of primers MVM8 and MVM9, 200 gM deoxyribonucleosidetriphosphates, buffer D from the PCR optimization kit (Invitrogen, San Diego, CA, USA); 1 unit of Taq polymerase (Roche Molecular Systems, Inc., Branchburg, NJ, USA) and approximately 150 ng of mycobacterial genomic DNA preparations. Amplificationconditions were as follows:initial denaturation at 95°C for 5 min followed by six cycles of amplification for 1 min each of denaturation at 94°C, annealing at 55°C and elongation at 72°C. This was followedby another 30 cyclesof 1 min each of denaturation at 94°C, annealing at 60°C and elongation at 72°C and a final extension for 4 min at 72°C to complete the synthesis of all DNA strands. The PCR products thus obtained were run in 1% agarose gels, stained with ethidium bromide, and photographed. pUC18 vectors carrying Ap R gene using Pharmacia's Sureclone ligation kit and transformed into an Ec DH5~ strain. Recombinant plasmid D N A containing appropriate size inserts were identified, amplified and purified using the Prep-A gene miniprep kit (Bio-Rad Laboratories, Richmond, CA, USA). The nt sequence of

77

"

m

Ec

120 120 12e 120

160

loo

Ee l i ~ i ~ V N E N g i R

LfIGN A FF~ I N L RSlIVlmE~lfi~l J~J~NFTGIIA~I 180

--

24o 241~ 240

Sc G I ~ I m l m ~ B P G G E D ~ I A P g ~ I ~ I " S T A ~ D I m G L ~ I I C I I T ~ ~ 141E g ~ - - T i J E T A H E ~ [ T P E L ~ j ~ L ~ L ~ j . ~ 3 " S K S J ~ I ' ~ ! ' ~ Ec D F ' V R E A ~ L Q E K L ~ ~ K I F A O E L S K R I I ~ S ~ S V a R P I ~ U Mo

wo~ Wc

Sc

-

"i .................................

............................ -

i: .... ::

.....................................

-. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Z40 240

30o3°°

ments to probe the BamHI-digested genomic DNA preparations of Mr, Mb and Ma (Fig. 3). These experiments revealed specific hybridization signals corresponding to 5 kb with Mb and Mt and 7 kb with Ma, suggesting that these DNA fragments, if isolated, would contain the respective dnaA genes and presumably their flanking sequences. The nt sequence of Mt dnaA was compared with that of Ec and a 30-mer oligo (MVM60) that showed 9/30 similarities with Ec dnaA gene was designed (see Fig. 4). This oligo was synthesized in a Pharmacia DNA synthesizer, endlabeled with [7-32P] ATP and used to screen Mt genomic DNA cosmid library propagated in Ec in a colony hybridization experiment (Sambrook et al, 1989). The recombinant cosmids hybridizing with the Mt dnaA specific oligo were isolated. The presence of dnaA sequences in these cosmids was confirmed by PCR ampli-

3~ 3OO 3OO

iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii 3oo Fig. 2. Alignment of mycobacterial DnaA protein sequences with other bacterial DnaA sequences. The nt sequence of the 780-bp PCR products from Mr, Mb and Ma were determined in Pharmacia ALF DNA sequencer. The aa sequences were deduced and compared with those of Ml (M34006), Sc (M82836) and Ec 001602) using MacDnasis 3.0 program. Identical aa are shown in shaded boxes. - indicates a gap created for alignment. The aa are grouped in blocks of 10. The nt sequences have been assigned the following GenBank accession Nos.: Ma, U19185; Mb, U19186; Mt, U19184.

the cloned fragment was determined in Pharmacia Automated Laser Fluorescence (ALF) DNA sequencer using autocycle and autoread kits as recommended by the manufacturers. Comparative analyses of the deduced aa sequence of the mycobacterial DnaA protein segments with the corresponding DnaA segments of two Gram + members, Sc and Ml (Calcutt and Schmidt, 1992; Fujita et al., 1990), and a Gram- member, Ec (Hansen et al., 1982), were carried out using MacDnasis 3.0program (see Fig. 2). These data revealed that the DnaA protein region is highly conserved in all these bacteria. Further, the Mt DnaA region is 93% similar to Mb and 89% similar to Ma (data not shown). Additionally, mycobacterial DnaA protein sequences are 57% similar to Sc and Ml and 31% similar to Ec (data not shown). These analyses strongly suggest that the PCR products are indeed derived from the dnaA gene.

(c) Identification and cloning of M t

dnaA gene To further confirm that the PCR products of Ma, Mb and Mt were derived from the respective genomic DNA, Southern hybridization analyses were carried out. The 780-bp PCR product obtained from the Mt genomic DNA was radiolabeled with [~-32p]dCTP (Sambrook et al., 1989) and used in Southern hybridization experi-

Mt

Mb

Ma

kb

8.0 6.0~5.0"4.0 ~ 3.0---

2.0--

i(i

Fig. 3. Southern hybridization analysis ofmycobacterial genomic DNA preparations. Genomic DNA preparations of 2 ~g each of Mt, Mb and Ma were digested with BamHI enzyme and electrophoresed in 0.8% agarose gels. Following electrophoresis, DNA was transferred to Zetaprobe nylon membranes (Bio-Rad) by capillary transfer protocol (Sambrook et al., 1989). The 780-bp PCR product obtained from Mt was nicktranslated using [ct-32p]dCTP, nonradioactive dATP, dGTP and dTTP (Sambrook et al., 1989) and used to probe the nylon membranes. Hybridization reactions were carried out at 6Y~C and all washings were performed under high stringency conditions (Sambrook et al., 1989). Membranes were air dried and exposed to X-Ray film. The weak hybridization signal seen with Ma is due to the fact that the amount of genomic DNA of Ma loaded was less than Mb and Mt. The concentration of Ma genomic DNA was presumably overestimated because of the interfering UV absorbing material other than DNA and RNA present in the DNA preparation.

78

lkb

I B I I

I A I

SLE ~il

S I ;VA

~"J/I///~*.

•

A I

K KB i II i

I

oligo specific to Mt dnaA was identified and was used to screen Mt genomic DNA cosmid libraries propagated in Ec for identifying cosmid DNA molecules containing the dnaA gene. A 5-kb BamHI fragment containing the Mt dnaA gene and its flanking regions was identified and subsequently subcloned into a pUC18 vector.

dnaA PCR fragment

Fig. 4. Physical map of a 5-kb DNA fragment containing Mt dnaA gene. The locations of some selected restriction enzymes on the 5-kb dnaA-containing fragment are indicated: A, ApaI; B, BamHI; E, EcoRI; K, KpnI and S, Sinai. Dark box represents the 780-bp PCR product inside the putative dnaA gene shown as a hatched box. An arrow near dnaA indicates the direction of transcription. Methods: By comparing the nt sequence of Mt dnaA gene fragment with the corresponding sequence of Ec, a 30-mer oligo, MVM60 with a sequence of 5' TATGCCCAACGGTTGTTCCCGGGAATGCGG was designed and subsequently synthesized in a Pharmacia DNA synthesizer. Bold letters in the sequence indicate the similarities with Ec dnaA sequence. The oligo was endlabeled with 1-732-p]ATP and used to identify dnaA containing cosmid molecules by screening Mt genomic DNA cosmid libraries propagated in Ec in a colony hybridization experiment (Sambrook et al., 1989). Identity of dnaA gene was established by PCR amplification of 780-bp from dnaA positive cosmids as described in Fig. 1. In addition, a nick-translated 780-bp PCR product and endlabeled MVM60 oligo were used to probe cosmid DNA digested with various enzymes in Southern hybridization experiments as described in Fig. 3 (Sambrook et al., 1989). These studies led to the identification of a 5-kb DNA fragment containing Mt dnaA gene which was gel-purified and cloned into pUC18 in the BamHI site. Recombinant plasmids containing the 5-kb insert present in both orientations were identified, digested with ApaI, BamHI, EcoRI, EcoRV, KpnI, PstI, SphI and SmaI enzymes, electrophoresed in 0.8% agarose gels, stained with ethidium bromide and photographed. The sizes of the bands produced were deduced by comparing the mobility of the DNA fragments with those of the known molecular weight markers. The 5-kb DNA fragment had no sites for PstI, EcoRV and SphI enzymes. Based on these data, a physical map of the 5-kb fragment was prepared. Although restriction digestion patterns indicated the probable presence of two closely spaced KpnI sites, the presence of the second KpnI site furthest to the left of the BamHI site, will need to be verified by DNA sequencing.

fication of the 780-bp product. From one such cosmid (pMQ16), a 5-kb BamHI fragment believed to contain the dnaA gene was identified and subcloned into pUC18 vector. A physical map of the 5-kb BamHI fragment indicating the restriction sites for some selected enzymes is shown in Fig. 4. Based on these data and the fact that dnaA in other bacteria is approximately 1500 bp, we presume that the 5-kb BamHI fragment contains the entire dnaA gene and its immediate flanking regions. Thus, the availability of cloned dnaA gene should facilitate studies on DNA replication initiation in Mr.

(d) Conclusions Degenerate oligo primers were used to amplify a dnaA gene segment from several species of mycobacteria by PCR. Based on the nt sequence of these fragments, an

ACKNOWLEDGMENTS

We are grateful to Drs. A. John Clark, University of California at Berkeley, Cathy Wu, Vijaykumar Boggaram and Shaun Black of University of Texas Health Center at Tyler for their help with DNA and protein sequence analysis. We express our sincere gratitude to Dr. William R. Jacobs, Jr. for providing cosmid libraries. M. avium genomic DNA preparations used in the preliminary experiments were kindly provided by Dr. J. Falkinham, III of Virginia Polytechnic Institute and State University, Blacksburg, Virginia. This research was supported by Institutional funds from the University of Texas Health Center, Tyler, Texas.

REFERENCES Bates, J.H.: Tuberculosis chemotherapy: the need for new antituberculosis drugs is urgent. Am. J. Respir. Crit. Care Med. 151 (1995) 942-943. Calcutt, M.J. and Schmidt, F.J.: Conserved gene arrangement in the origin region of the Streptomyces coelicolor chromosome. J. Bacteriol. 174 (1992) 3220-3226. Clark-Curtiss, J.E., Jacobs, W.R., Docherty, M.A., Ritchie, L.R. and Curtiss III, R.: Molecular analysis of DNA and construction of genomic libraries of Mycobacterium leprae. J. Bacteriol. 161 (1985) 1093-1102. Dubnau, D.: Genetic exchange and homologous recombination. In: Sonenshein, A.L., Hoch, J.A. and Losick, R. (Eds.), Bacillus subtilis and Other Gram Positive Bacteria: Biochemistry, Physiology and Molecular Genetics. American Society for Microbiology, Washington, DC, 1993, pp. 555-585. Fujita, M.Q., Yoshikawa, H. and Ogasawara, N.: Structure of the dnaA region of Micrococcus luteus: conservation and variations among eubacteria. Gene 93 (1990) 73-78. Hansen, E.B., Hansen, F.G. and von Meyenburg, K.: The nucleotide sequence of the dnaA gene and the first part of the dnaN gene of Escherichia coli. Nucleic Acids Res. 10 (1982) 7373-7385. Husson, R.N., James, B.E. and Young, R.A.: Gene replacement and expression of foreign DNA in mycobacteria. J. Bacteriol. 172 (1990) 519 524. Kimura, M., Miki, T., Hiraga, S., Nagata, T. and Yura, T.: Conditionally lethal amber mutations in the dnaA region of the Escherichia coli chromosome that affect chromosome replication. J. Bacteriol. 140 (1979) 825-834. Kornberg, A. and Baker, T.: DNA Replication, 2nd ed. W.H. Freeman and Company, New York, 1991. Kowalczykowski, S.C., Dixon, D.A., Eggleston, A.K., Lauder, S.D. and Rehrauer, W.M.: Biochemistry of homologous recombination in Escherichia coli. Microbiol. Rev. 58 (1994) 401-465.

79 Sambrook, J, Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. Schaus, N., O'Day, K., Peters, W. and Wright, A.: Isolation and characterization of amber mutations in dnaA gene of Escherichia coli K-12. J. Bacteriol. 145 (1981) 904-913. Skarstadt, K. and Boye, E.: The initiator protein DnaA: evolution, properties and function. Biochem. Biophys. Acta 1217 (1994) 111 130. Skovgaard, O. and Hansen, F.G.: Comparison of dnaA nucleotide sequences of Escherichia coli, Salmonella typhimurium, and Serratia marcescens. J. Bacteriol. 169 (1987) 3976-3981. Snider Jr., D. E., Raviglione, M. and Kochi, A.: Global burden of tuberculosis. In: Bloom, B.R. (Ed.), Tuberculosis: Pathogenesis,

Protection and Control. American Society for Microbiology, Washington, DC, 1994, pp. 3-11. Wang, M. and Cohen, S.N.: ard-l: a human gene that reverses the effects of temperature sensitive and deletion mutations in the Escherichia coli rne gene and encodes an activity producing RNase E like cleavages. Proc. Natl. Acad. Sci. USA 91 (1994) 10591-10595. Yasbin, R.E., Cheo, D. and Bol, D.: DNA repair systems. In: Sonenshein, A.L., Hoch, J.A. and Losick, R. (Eds.), Bacillus subtilis and Other Gram Positive Bacteria: Biochemistry, Physiology and Molecular Genetics. American Society for Microbiology, Washington, DC, 1993, pp. 529-539. Yoshikawa, H. and Ogasawara, N.: Structure and function of DnaA and the DnaA-box in eubacteria: evolutionary relationships of bacterial replication origins. Mol. Microbiol. 5 (1991) 2589-2597.