- Email: [email protected]
Amplification of MGC2177, PLAG1, PSMC6P, and LYN in a malignant mixed tumor of salivary gland detected by cDNA microarray with tyramide signal amplification
Cancer Genetics and Cytogenetics 152 (2004) 124–128
Short communication
Amplification of MGC2177, PLAG1, PSMC6P, and LYN in a malignant mixed tumor of salivary gland detected by cDNA microarray with tyramide signal amplification Yvonne T.M. Tsang, Yi-Mieng Chang, Xinyan Lu, Pulivarthi H. Rao, Ching C. Lau, Kwong-Kwok Wong* Texas Children’s Cancer Center, Cancer Genomics Group, MC3-3320, Department of Pediatrics, Baylor College of Medicine, 6621 Fannin Street, Houston, TX 77030 Received 3 October 2003; received in revised form 1 December 2003; accepted 2 December 2003
Abstract
Gene amplifications have been observed in many different tumor cells, and many of these changes are related to tumor pathogenesis. Comparative genomic hybridization (CGH) using metaphase chromosomes can detect changes in chromosome copy number with a resolution of 10–20 Mb. Current advances in CGH analysis in a microarray format allow us to refine such changes down to the gene level. We applied microarray technology to detect novel gene amplification in a malignant mixed tumor of salivary gland. Besides detecting previously known gene amplifications (MDM2 and MYC), we identified four other highly amplified genes located at 8q11.2~q13: MGC2177, PLAG1, PSMC6P, and LYN. The amplification was further validated with real-time quantitative polymerase chain reaction. 쑖 2004 Elsevier Inc. All rights reserved.
1. Introduction
2. Materials and methods
The gain, loss, or amplification of chromosome regions is common among tumor cells. Genome-wide scanning of chromosome copy numbers with comparative genomic hybridization (CGH) on metaphase chromosomes is a powerful technique that has revealed many chromosomal aberrations in tumor cells, but with a limited resolution of 10–20 Mb [1]. To improve the resolution of conventional chromosome CGH, array CGH has been applied with use of cloned genomic DNA such as bacterial artificial chromosomes (BACs) [2–4], P1 clones [5,6], and cDNA clones [7,8]. Using chromosome CGH, we earlier identified a few chromosome regions with amplification in a malignant mixed tumor of salivary gland [9]. To further investigate the molecular structure of the amplicons in this salivary gland tumor, we applied cDNA microarrays for CGH analysis, a technique that has potentially much higher resolution than chromosome CGH.
2.1. Differential random primer labeling
* Corresponding author. Tel.: (832) 824-4373; fax: (832) 825-4038. E-mail address: [email protected] (K.-K. Wong). 0165-4608/04/$ – see front matter 쑖 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2003.12.001
Genomic DNA (50 ng) derived from a normal placenta and from malignant mixed tumor cells of salivary gland was digested with restriction enzyme EcoRI overnight in a volume of 20 µL of 1× universal restriction buffer (Stratagene, La Jolla, CA) at 37⬚C. After digestion, the restriction enzyme activity was inactivated by heating at 70⬚C for 20 minutes. Subsequently, 20 µL of 2.5× Random Primer solution from the BioPrime DNA labeling system (Invitrogen, Carlsbad, CA) was added to the 20 µL digested genomic DNA to obtain a final volume of 40 µL. The mixture was heated for 5 minutes in boiling water and then was placed on ice. Two sets of DNA, one from tumor cells and the other a reference genomic DNA, were differentially labeled with biotin and fluorescein using random primers. Next, 5 µL biotin11-dCTP (1 mmol/L; PerkinElmer Life Sciences, Boston, MA) and 3 µL unlabeled dNTPs (1.7 mmol/L dCTP, 3.3 mmol/L dGTP, 3.3 mmol/L dATP, and 3.3 mmol/L dTTP) was added to the 40 µL tumor DNA reaction mix; 5 µL of 1 mmol/L fluorescein-12-dCTP (PerkinElmer Life Sciences) was added to the reference DNA. Finally, 2 µL of Klenow fragment (Invitrogen) was added to both reaction mixes to
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128
125
initiate the labeling reaction, which was allowed to proceed for 2 hours and then was stopped with the addition of 5 µL of Stop buffer. 2.2. Hybridization, tyramide signal amplification of hybridization signal, and data analysis After the labeling reaction, the two differentially labeled genomic probes were precipitated from the 55 µL labeling reaction with 12.5 µL NH4OAc (7.5 mol/L), 100 µL 100% ethanol, and 2 µL linear acrylamide (1 mg/mL; Ambion, Austin, TX). The mixtures were left at ⫺20⬚C overnight. Precipitated probes were resuspended into 20 µL hybridization Q buffer from the Micromax tyramide signal amplification (TSA) labeling and detection kit (PerkinElmer Life Sciences). The two labeled DNAs, reference and tumor, were combined as a final 40 µL solution and were hybridized to an in-house cDNA microarray at 65⬚C inside a hybridization chamber for 16 hours. The in-house cDNA microarrays were fabricated with Easy-to-Spot Human UniGene 1 polymerase chain reaction (PCR) products (Incyte Genomics, Palo Alto, CA) consisting of 8,526 elements. All PCR products were resequenced to confirm identity before printing. The PCR products were printed, in duplicate, along with three Arabidopsis cDNA controls, using an OmniGrid Accent Arrayer (GeneMachines, San Carlos, CA), equipped with 24 SMP3 pins (TeleChem International, Sunnyvale, CA). Subsequently, the DNA–DNA hybridization signal on the microarray was sequentially amplified with tyramide–Cy3 and tyramide– Cy5 using reagents supplied in the TSA labeling and detection kit (PerkinElmer Life Sciences) as described previously [10]. All experiments were done in triplicate. Hybridization signals from each cDNA microarray were captured with a ScanArray4000XL laser scanner (PerkinElmer Life Sciences). Spot intensities from each of the elements were quantified and normalized using Lowess method with ScanArray Express 2.1 software (PerkinElmer Life Sciences). The data from triplicate experiments were collated, averaged, filtered, and analyzed with OmniViz software (OmniViz, Maynard, MA; http://www.omniviz.com). 2.3. Real-time quantitative PCR Gene copy number differences between the salivary gland tumor DNA and normal female DNA were determined with real-time quantitative PCR (qPCR), which was performed on an ABI 7000 thermocycler (Applied Biosystems, Foster City, CA). DNA content was normalized to that of Line-1, a repetitive element for which copy numbers per haploid genome are similar among all human cells (normal or neoplastic) as described previously [11]. Copy number changes per haploid genome were calculated as 2(Nt ⫺ Nline) ⫺ (St ⫺ Sline), where Nt is the threshold cycle number observed for an experimental primer in the normal female DNA, Nline is the
Fig. 1. Scatter plots of female versus female DNA hybridization signals (XX vs. XX) in salivary gland tumor. Hybridization signals were generated from a cDNA CGH experiment using (A) direct labeling or (B) indirect TSA labeling methods. Same-female DNA was labeled with Cy3 and Cy5 dyes separately, mixed, and hybridized to the same cDNA microarray. Hybridization signals were analyzed with ScanArray Express 2.1 software using adaptive circle and Lowess normalization methods.
threshold cycle number observed for a Line-1 primer in the normal female DNA, St is the average threshold cycle number observed for the experimental primer in salivary gland tumor DNA, and Sline is the average threshold cycle number observed for a Line-1 primer in salivary gland tumor DNA. Conditions for amplification were as follows: one cycle of 95⬚C for 10 minutes, followed by 40 cycles of 95⬚C for 15 seconds and 60⬚C for 60 seconds, using SYBR Green PCR Master Mix reagents (Applied Biosystems). Threshold cycle numbers were obtained using ABI Prism 7000 SDS v1.0 software (Applied Biosystems). Each analysis was performed in triplicate and threshold cycle numbers were averaged. The presence or absence of PCR products was evaluated with gel electrophoresis. PCR primers were designed using Primer Express v2.0 (Applied Biosystems) to span a 100- to 200-bp nonrepetitive region and were synthesized by Sigma Genosys (Woodlands, TX). Primer sequences for each region analyzed in this study are as follows: L1.2F: 5′ AAAGCCGCTCAACTACATGG L1.2R: 5′ TGCTTTGAATGCGTCCCAGAG PLAG1 F: 5′ GCCAATGCCCTCAGCTCTT PLAG1 R: 5′ TCCTCATCGTTTTTCACATCACA
126
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128
Fig. 3. BAC CGH profile for chromosome 8 of salivary gland tumor. Signal ratios (Cy5/Cy3) were plotted against each BAC clone, aligned along chromosome 8. Dye-swap experiments were performed. That is, tumor DNA was labeled with Cy5 dye and normal DNA with Cy3 dye in one experiment. In the second experiment, tumor DNA was labeled with Cy3 dye and normal DNA was labeled with Cy5 dye. Cy5/Cy3 ratios for both dyeswap experiments were plotted together. Ratios with reversed sign in a dye-swap experiment indicate a good result, without dye bias. The two BAC clones that detected amplification are noted, with the size and the gene carried by the BAC indicated in parenthesis.
Fig. 2. Genes with amplification on chromosome 8 and 12 of salivary gland tumor, identified using cDNA CGH with tyramide signal amplification: (A) chromosome 8; (B) chromosome 12. The cDNA microarray CGH profile (at left of the chromosome ideograms) is a plot of the ratios (average from triplicate experiments) of salivary gland tumor DNA versus normal reference DNA for the corresponding cDNA along the chromosome in log2 scale. The chromosome CGH profile (at right of ideograms) shows the mean green-to-red ratios obtained from 8–16 metaphase chromosomes.
MGC2217F4: 5′ GGAAAAGGGTCAGGGTTCATC MGC2217R4: 5′ AGTCTACCCCAGTCACCACATTG
3. Results and discussion We used a cDNA microarray approach to decipher the chromosome amplifications in a malignant mixed tumor of
salivary gland to the gene level. The use of TSA [10] in the detection of hybridization signal has reduced the amount of genomic DNA required to 50 ng, which is ~80 times less than that required by direct incorporation of fluorescent dyes in a cDNA microarray CGH analysis [8]. When using TSA, however, the background noise is higher than with a conventional direct-labeling method. In a TSA self-to-self hybridization experiment, our results showed that the mean ratio of the signals from Cy5 to Cy3 dyes of all the spots is 0.98, with a standard deviation of 1.7 (Fig. 1A), which is less sensitive than direct labeling, a method that has a mean ratio of 1.04 with a standard deviation of 1.4 (Fig. 1B) in detecting genes with small copy number change. Nevertheless, the use of TSA in cDNA CGH is sensitive enough to detect genes with higher levels of amplification. For detecting single-copy gain or loss of a chromosomal region an appropriate algorithm will be needed, as described previously [8], but the resolution will not be at a singlegene level. The copy number change for each gene was calculated as the ratio of the hybridization signal (normalized median signal intensity minus background signal intensity) of the
Table 1 Gene amplification detected with cDNA microarray Gene symbol and description [HUGO symbol, if different]
GenBank accession no.
Chromosome location
Fold amplification with cDNA CGH (or qPCR)
Hypothetical protein MGC2217 [CHCHD7] PLAG1, pleomorphic adenoma gene 1 LYN, v-yes-1 Yamaguchi sarcoma viral related oncogene homolog PVT1, Pvt1 oncogene homolog, MYC activator V-MYC, v-myc myelocytomatosis viral oncogene homolog [MYC] MDM2, Mdm2transformed 3T3 cell double minute 2, p53 binding protein CPM, carboxypeptidase M PTPRB, protein tyrosine phosphatase, receptor type, B PSMC6, proteasome (prosome, macropain) 26S subunit, ATPase, 6a
BE876967 NM_002655 BG108304 AI498125 BG256267 U33199 NM_001874 NM_002837 BG288544
8q11.23 8q12 8q13 8q24 8q24.12~q24.13 12q14.3~q15 12q15 12q15~q21 14q22.1
38 (24) 60 (28) 11 25 21 12 4 18 22
Fold amplification is the average of three replicate cDNA microarray experiments. For MGC2217 and PLAG1, the fold amplification was validated using real-time quantitative PCR (in parenthesis); qPCR was done three times with consistent results. a PSMC6 shares 97% DNA sequence identity with PSMC6P, which is located at 8q11.
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128
Fig. 4. Physical locations of amplified genes on chromosome 8 of salivary gland tumor. The linear positions of each of these genes are indicated in brackets. The location is retrieved from the UCSC Genome Brower (http:// genome.ucsc.edu/) using the July 2003 human sequence assembly. PSMC6P is a pseudogene of PSMC6 and shared 97% in DNA identity. The two adjacent cDNA clones in our cDNA microarray that did not show any amplification are MGC3925 and NCOA6IP, which suggests that the maximum size of the amplicon is 2.3 Mb.
127
Previous studies have indicated that a major group of salivary gland tumor has chromosome 8 abnormalities, mainly showing translocations involving region 8q12 [12]. Overexpression of pleomorphic adenoma gene 1 (PLAG1) is also detected in both benign and malignant salivary gland tumors [13] with and without 8q12 aberrations [14]. It is possible that overexpression of PLAG1 in some of these salivary gland tumors is a result of DNA copy amplification. PLAG1 is a member of a new subfamily of zinc finger proteins that includes the tumor suppressor candidate genes PLAGL1 (pleiomorphic adenoma gene-like 1; alias ZAC1 or LOT1) and PLAGL2. It has been suggested that the oncogenic capacity of PLAG1 involves the activation of the insulin-like growth factor-II mitogenic pathway [15]. LYN is an oncogene that encodes a novel tyrosine kinase and inhibits nuclear export of the p53 tumor suppressor [16]. It is possible that amplification of these genes may be related to the pathogenesis of mixed tumor of salivary gland. As far as we know, the four genes identified in this study have not before been shown to be amplified. The identification of these specific genes will be important in the understanding the cytogenetics and the genetics of malignant mixed tumor of salivary gland.
Acknowledgments tumor DNA to the normal female DNA on the cDNA microarray. The ratio is log2-transformed and plotted against the linear distant along the corresponding chromosome (Fig. 2). As shown in Fig. 2, amplified genes are located at the 8q11.2~q13, 8q24, and 12q14.3~q21 regions; identities of the genes are given in Table 1. The amplifications of MYC (8q24) and MDM2 (12q14) in this salivary gland tumor have been previously shown with Southern blot [9]; however, the previously known amplified gene, CDK4 [9], was not detected because our cDNA microarray does not contain the corresponding cDNA clone. Pleomorphic adenoma gene 1 (PLAG1) and the hypothetical gene MGC2177 are physically adjacent to each other on chromosome 8q11.2~q13 region. Amplification of PLAG1 and of MGC2177 was further confirmed with real-time quantitative PCR to be 28- and 24fold respectively (data not shown). Serendipitously, while evaluating an array printed with bacterial artificial chromosome (BAC) clones (Spectral Genomics, Houston, TX) with the same salivary tumor DNA, we found that proteasome (prosome, macropain) 26S subunit, ATPase 6 pseudogene (PSMC6P) and v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (LYN) genes are amplified, as revealed by the BAC clone R11-113H14, which contains only PSMC6P and LYN genes (Fig. 3). Thus, both the BAC array and the cDNA microarray show that PSMC6P and LYN genes are amplified. Based on the linear locations of the amplified genes on chromosome 8, we estimated that the maximum region of amplification is ~2.3 Mb (Fig. 4).
The work is partly supported by grants from John Dunn Foundation and Kleberg Foundation to the Cancer Genomics program. We are also indebted to Spectral Genomics, Inc. (Houston, TX), for the BAC array and to Rita Cheng for critical reading of the manuscript.
References [1] Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray JW, Waldman F, Pinkel D. Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science 1992;258:818–21. [2] Cai WW, Mao JH, Chow CW, Damani S, Balmain A, Bradley A. Genome-wide detection of chromosomal imbalances in tumors using BAC microarrays. Nat Biotechnol 2002;20:393–6. [3] Zhao J, Roth J, Bode-Lesniewska B, Pfaltz M, Heitz PU, Komminoth P. Combined comparative genomic hybridization and genomic microarray for detection of gene amplifications in pulmonary artery intimal sarcomas and adrenocortical tumors. Genes Chromosomes Cancer 2002;34:48–57. [4] Snijders AM, Nowak N, Segraves R, Blackwood S, Brown N, Conroy J, Hamilton G, Hindle AK, Huey B, Kimura K, Law S, Myambo K, Palmer J, Ylstra B, Yue JP, Gray JW, Jain AN, Pinkel D, Albertson DG. Assembly of microarrays for genome-wide measurement of DNA copy number. Nat Genet 2001;29:263–4. [5] Wilhelm M, Veltman JA, Olshen AB, Jain AN, Moore DH, Presti JC Jr, Kovacs G, Waldman FM. Array-based comparative genomic hybridization for the differential diagnosis of renal cell cancer. Cancer Res 2002;62:957–60. [6] Wessendorf S, Fritz B, Wrobel G, Nessling M, Lampel S, Goettel D, Kuepper M, Joos S, Hopman T, Kokocinski F, Dohner H, Bentz M, Schwaenen C, Lichter P. Automated screening for genomic imbalances
128
[7]
[8]
[9]
[10]
[11]
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128 using matrix-based comparative genomic hybridization. Lab Invest 2002;82:47–60. Heiskanen MA, Bittner ML, Chen Y, Khan J, Adler KE, Trent JM, Meltzer PS. Detection of gene amplification by genomic hybridization to cDNA microarrays. Cancer Res 2000;60:799–802. Pollack JR, Perou CM, Alizadeh AA, Eisen MB, Pergamenschikov A, Williams CF, Jeffrey SS, Botstein D, Brown PO. Genome-wide analysis of DNA copy-number changes using cDNA microarrays. Nat Genet 1999;23:41–6. Rao PH, Murty VV, Louie DC, Chaganti RS. Nonsyntenic amplification of MYC with CDK4 and MDM2 in a malignant mixed tumor of salivary gland. Cancer Genet Cytogenet 1998;105:160–3. Wong KK, Cheng RS, Mok SC. Identification of differentially expressed genes from ovarian cancer cells by MICROMAX cDNA microarray system. Biotechniques 2001;30:670–5. Wang TL, Maierhofer C, Speicher MR, Lengauer C, Vogelstein B, Kinzler KW, Velculescu VE. Digital karyotyping. Proc Natl Acad Sci U S A 2002;99:16156–61.
[12] Voz ML, Van de Ven WJ, Kas K. First insights into the molecular basis of pleomorphic adenomas of the salivary glands. Adv Dent Res 2000;14:81–3. [13] Queimado L, Lopes C, Du F, Martins C, Bowcock AM, Soares J, Lovett M. Pleomorphic adenoma gene 1 is expressed in cultured benign and malignant salivary gland tumor cells. Lab Invest 1999;79:583–9. [14] Astrom AK, Voz ML, Kas K, Roijer E, Wedell B, Mandahl N, Van de Ven W, Mark J, Stenman G. Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: identification of SII as a new fusion partner gene. Cancer Res 1999;59:918–23. [15] Hensen K, Van Valckenborgh IC, Kas K, Van de Ven WJ, Voz ML. The tumorigenic diversity of the three PLAG family members is associated with different DNA binding capacities. Cancer Res 2002;62:1510–7. [16] Ren X, Cao C, Zhu L, Yoshida K, Kharbanda S, Weichselbaum R, Kufe D. Lyn tyrosine kinase inhibits nuclear export of the p53 tumor suppressor. Cancer Biol Ther 2002;1:703–8.
Short communication
Amplification of MGC2177, PLAG1, PSMC6P, and LYN in a malignant mixed tumor of salivary gland detected by cDNA microarray with tyramide signal amplification Yvonne T.M. Tsang, Yi-Mieng Chang, Xinyan Lu, Pulivarthi H. Rao, Ching C. Lau, Kwong-Kwok Wong* Texas Children’s Cancer Center, Cancer Genomics Group, MC3-3320, Department of Pediatrics, Baylor College of Medicine, 6621 Fannin Street, Houston, TX 77030 Received 3 October 2003; received in revised form 1 December 2003; accepted 2 December 2003
Abstract
Gene amplifications have been observed in many different tumor cells, and many of these changes are related to tumor pathogenesis. Comparative genomic hybridization (CGH) using metaphase chromosomes can detect changes in chromosome copy number with a resolution of 10–20 Mb. Current advances in CGH analysis in a microarray format allow us to refine such changes down to the gene level. We applied microarray technology to detect novel gene amplification in a malignant mixed tumor of salivary gland. Besides detecting previously known gene amplifications (MDM2 and MYC), we identified four other highly amplified genes located at 8q11.2~q13: MGC2177, PLAG1, PSMC6P, and LYN. The amplification was further validated with real-time quantitative polymerase chain reaction. 쑖 2004 Elsevier Inc. All rights reserved.
1. Introduction
2. Materials and methods
The gain, loss, or amplification of chromosome regions is common among tumor cells. Genome-wide scanning of chromosome copy numbers with comparative genomic hybridization (CGH) on metaphase chromosomes is a powerful technique that has revealed many chromosomal aberrations in tumor cells, but with a limited resolution of 10–20 Mb [1]. To improve the resolution of conventional chromosome CGH, array CGH has been applied with use of cloned genomic DNA such as bacterial artificial chromosomes (BACs) [2–4], P1 clones [5,6], and cDNA clones [7,8]. Using chromosome CGH, we earlier identified a few chromosome regions with amplification in a malignant mixed tumor of salivary gland [9]. To further investigate the molecular structure of the amplicons in this salivary gland tumor, we applied cDNA microarrays for CGH analysis, a technique that has potentially much higher resolution than chromosome CGH.
2.1. Differential random primer labeling
* Corresponding author. Tel.: (832) 824-4373; fax: (832) 825-4038. E-mail address: [email protected] (K.-K. Wong). 0165-4608/04/$ – see front matter 쑖 2004 Elsevier Inc. All rights reserved. doi:10.1016/j.cancergencyto.2003.12.001
Genomic DNA (50 ng) derived from a normal placenta and from malignant mixed tumor cells of salivary gland was digested with restriction enzyme EcoRI overnight in a volume of 20 µL of 1× universal restriction buffer (Stratagene, La Jolla, CA) at 37⬚C. After digestion, the restriction enzyme activity was inactivated by heating at 70⬚C for 20 minutes. Subsequently, 20 µL of 2.5× Random Primer solution from the BioPrime DNA labeling system (Invitrogen, Carlsbad, CA) was added to the 20 µL digested genomic DNA to obtain a final volume of 40 µL. The mixture was heated for 5 minutes in boiling water and then was placed on ice. Two sets of DNA, one from tumor cells and the other a reference genomic DNA, were differentially labeled with biotin and fluorescein using random primers. Next, 5 µL biotin11-dCTP (1 mmol/L; PerkinElmer Life Sciences, Boston, MA) and 3 µL unlabeled dNTPs (1.7 mmol/L dCTP, 3.3 mmol/L dGTP, 3.3 mmol/L dATP, and 3.3 mmol/L dTTP) was added to the 40 µL tumor DNA reaction mix; 5 µL of 1 mmol/L fluorescein-12-dCTP (PerkinElmer Life Sciences) was added to the reference DNA. Finally, 2 µL of Klenow fragment (Invitrogen) was added to both reaction mixes to
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128
125
initiate the labeling reaction, which was allowed to proceed for 2 hours and then was stopped with the addition of 5 µL of Stop buffer. 2.2. Hybridization, tyramide signal amplification of hybridization signal, and data analysis After the labeling reaction, the two differentially labeled genomic probes were precipitated from the 55 µL labeling reaction with 12.5 µL NH4OAc (7.5 mol/L), 100 µL 100% ethanol, and 2 µL linear acrylamide (1 mg/mL; Ambion, Austin, TX). The mixtures were left at ⫺20⬚C overnight. Precipitated probes were resuspended into 20 µL hybridization Q buffer from the Micromax tyramide signal amplification (TSA) labeling and detection kit (PerkinElmer Life Sciences). The two labeled DNAs, reference and tumor, were combined as a final 40 µL solution and were hybridized to an in-house cDNA microarray at 65⬚C inside a hybridization chamber for 16 hours. The in-house cDNA microarrays were fabricated with Easy-to-Spot Human UniGene 1 polymerase chain reaction (PCR) products (Incyte Genomics, Palo Alto, CA) consisting of 8,526 elements. All PCR products were resequenced to confirm identity before printing. The PCR products were printed, in duplicate, along with three Arabidopsis cDNA controls, using an OmniGrid Accent Arrayer (GeneMachines, San Carlos, CA), equipped with 24 SMP3 pins (TeleChem International, Sunnyvale, CA). Subsequently, the DNA–DNA hybridization signal on the microarray was sequentially amplified with tyramide–Cy3 and tyramide– Cy5 using reagents supplied in the TSA labeling and detection kit (PerkinElmer Life Sciences) as described previously [10]. All experiments were done in triplicate. Hybridization signals from each cDNA microarray were captured with a ScanArray4000XL laser scanner (PerkinElmer Life Sciences). Spot intensities from each of the elements were quantified and normalized using Lowess method with ScanArray Express 2.1 software (PerkinElmer Life Sciences). The data from triplicate experiments were collated, averaged, filtered, and analyzed with OmniViz software (OmniViz, Maynard, MA; http://www.omniviz.com). 2.3. Real-time quantitative PCR Gene copy number differences between the salivary gland tumor DNA and normal female DNA were determined with real-time quantitative PCR (qPCR), which was performed on an ABI 7000 thermocycler (Applied Biosystems, Foster City, CA). DNA content was normalized to that of Line-1, a repetitive element for which copy numbers per haploid genome are similar among all human cells (normal or neoplastic) as described previously [11]. Copy number changes per haploid genome were calculated as 2(Nt ⫺ Nline) ⫺ (St ⫺ Sline), where Nt is the threshold cycle number observed for an experimental primer in the normal female DNA, Nline is the
Fig. 1. Scatter plots of female versus female DNA hybridization signals (XX vs. XX) in salivary gland tumor. Hybridization signals were generated from a cDNA CGH experiment using (A) direct labeling or (B) indirect TSA labeling methods. Same-female DNA was labeled with Cy3 and Cy5 dyes separately, mixed, and hybridized to the same cDNA microarray. Hybridization signals were analyzed with ScanArray Express 2.1 software using adaptive circle and Lowess normalization methods.
threshold cycle number observed for a Line-1 primer in the normal female DNA, St is the average threshold cycle number observed for the experimental primer in salivary gland tumor DNA, and Sline is the average threshold cycle number observed for a Line-1 primer in salivary gland tumor DNA. Conditions for amplification were as follows: one cycle of 95⬚C for 10 minutes, followed by 40 cycles of 95⬚C for 15 seconds and 60⬚C for 60 seconds, using SYBR Green PCR Master Mix reagents (Applied Biosystems). Threshold cycle numbers were obtained using ABI Prism 7000 SDS v1.0 software (Applied Biosystems). Each analysis was performed in triplicate and threshold cycle numbers were averaged. The presence or absence of PCR products was evaluated with gel electrophoresis. PCR primers were designed using Primer Express v2.0 (Applied Biosystems) to span a 100- to 200-bp nonrepetitive region and were synthesized by Sigma Genosys (Woodlands, TX). Primer sequences for each region analyzed in this study are as follows: L1.2F: 5′ AAAGCCGCTCAACTACATGG L1.2R: 5′ TGCTTTGAATGCGTCCCAGAG PLAG1 F: 5′ GCCAATGCCCTCAGCTCTT PLAG1 R: 5′ TCCTCATCGTTTTTCACATCACA
126
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128
Fig. 3. BAC CGH profile for chromosome 8 of salivary gland tumor. Signal ratios (Cy5/Cy3) were plotted against each BAC clone, aligned along chromosome 8. Dye-swap experiments were performed. That is, tumor DNA was labeled with Cy5 dye and normal DNA with Cy3 dye in one experiment. In the second experiment, tumor DNA was labeled with Cy3 dye and normal DNA was labeled with Cy5 dye. Cy5/Cy3 ratios for both dyeswap experiments were plotted together. Ratios with reversed sign in a dye-swap experiment indicate a good result, without dye bias. The two BAC clones that detected amplification are noted, with the size and the gene carried by the BAC indicated in parenthesis.
Fig. 2. Genes with amplification on chromosome 8 and 12 of salivary gland tumor, identified using cDNA CGH with tyramide signal amplification: (A) chromosome 8; (B) chromosome 12. The cDNA microarray CGH profile (at left of the chromosome ideograms) is a plot of the ratios (average from triplicate experiments) of salivary gland tumor DNA versus normal reference DNA for the corresponding cDNA along the chromosome in log2 scale. The chromosome CGH profile (at right of ideograms) shows the mean green-to-red ratios obtained from 8–16 metaphase chromosomes.
MGC2217F4: 5′ GGAAAAGGGTCAGGGTTCATC MGC2217R4: 5′ AGTCTACCCCAGTCACCACATTG
3. Results and discussion We used a cDNA microarray approach to decipher the chromosome amplifications in a malignant mixed tumor of
salivary gland to the gene level. The use of TSA [10] in the detection of hybridization signal has reduced the amount of genomic DNA required to 50 ng, which is ~80 times less than that required by direct incorporation of fluorescent dyes in a cDNA microarray CGH analysis [8]. When using TSA, however, the background noise is higher than with a conventional direct-labeling method. In a TSA self-to-self hybridization experiment, our results showed that the mean ratio of the signals from Cy5 to Cy3 dyes of all the spots is 0.98, with a standard deviation of 1.7 (Fig. 1A), which is less sensitive than direct labeling, a method that has a mean ratio of 1.04 with a standard deviation of 1.4 (Fig. 1B) in detecting genes with small copy number change. Nevertheless, the use of TSA in cDNA CGH is sensitive enough to detect genes with higher levels of amplification. For detecting single-copy gain or loss of a chromosomal region an appropriate algorithm will be needed, as described previously [8], but the resolution will not be at a singlegene level. The copy number change for each gene was calculated as the ratio of the hybridization signal (normalized median signal intensity minus background signal intensity) of the
Table 1 Gene amplification detected with cDNA microarray Gene symbol and description [HUGO symbol, if different]
GenBank accession no.
Chromosome location
Fold amplification with cDNA CGH (or qPCR)
Hypothetical protein MGC2217 [CHCHD7] PLAG1, pleomorphic adenoma gene 1 LYN, v-yes-1 Yamaguchi sarcoma viral related oncogene homolog PVT1, Pvt1 oncogene homolog, MYC activator V-MYC, v-myc myelocytomatosis viral oncogene homolog [MYC] MDM2, Mdm2transformed 3T3 cell double minute 2, p53 binding protein CPM, carboxypeptidase M PTPRB, protein tyrosine phosphatase, receptor type, B PSMC6, proteasome (prosome, macropain) 26S subunit, ATPase, 6a
BE876967 NM_002655 BG108304 AI498125 BG256267 U33199 NM_001874 NM_002837 BG288544
8q11.23 8q12 8q13 8q24 8q24.12~q24.13 12q14.3~q15 12q15 12q15~q21 14q22.1
38 (24) 60 (28) 11 25 21 12 4 18 22
Fold amplification is the average of three replicate cDNA microarray experiments. For MGC2217 and PLAG1, the fold amplification was validated using real-time quantitative PCR (in parenthesis); qPCR was done three times with consistent results. a PSMC6 shares 97% DNA sequence identity with PSMC6P, which is located at 8q11.
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128
Fig. 4. Physical locations of amplified genes on chromosome 8 of salivary gland tumor. The linear positions of each of these genes are indicated in brackets. The location is retrieved from the UCSC Genome Brower (http:// genome.ucsc.edu/) using the July 2003 human sequence assembly. PSMC6P is a pseudogene of PSMC6 and shared 97% in DNA identity. The two adjacent cDNA clones in our cDNA microarray that did not show any amplification are MGC3925 and NCOA6IP, which suggests that the maximum size of the amplicon is 2.3 Mb.
127
Previous studies have indicated that a major group of salivary gland tumor has chromosome 8 abnormalities, mainly showing translocations involving region 8q12 [12]. Overexpression of pleomorphic adenoma gene 1 (PLAG1) is also detected in both benign and malignant salivary gland tumors [13] with and without 8q12 aberrations [14]. It is possible that overexpression of PLAG1 in some of these salivary gland tumors is a result of DNA copy amplification. PLAG1 is a member of a new subfamily of zinc finger proteins that includes the tumor suppressor candidate genes PLAGL1 (pleiomorphic adenoma gene-like 1; alias ZAC1 or LOT1) and PLAGL2. It has been suggested that the oncogenic capacity of PLAG1 involves the activation of the insulin-like growth factor-II mitogenic pathway [15]. LYN is an oncogene that encodes a novel tyrosine kinase and inhibits nuclear export of the p53 tumor suppressor [16]. It is possible that amplification of these genes may be related to the pathogenesis of mixed tumor of salivary gland. As far as we know, the four genes identified in this study have not before been shown to be amplified. The identification of these specific genes will be important in the understanding the cytogenetics and the genetics of malignant mixed tumor of salivary gland.
Acknowledgments tumor DNA to the normal female DNA on the cDNA microarray. The ratio is log2-transformed and plotted against the linear distant along the corresponding chromosome (Fig. 2). As shown in Fig. 2, amplified genes are located at the 8q11.2~q13, 8q24, and 12q14.3~q21 regions; identities of the genes are given in Table 1. The amplifications of MYC (8q24) and MDM2 (12q14) in this salivary gland tumor have been previously shown with Southern blot [9]; however, the previously known amplified gene, CDK4 [9], was not detected because our cDNA microarray does not contain the corresponding cDNA clone. Pleomorphic adenoma gene 1 (PLAG1) and the hypothetical gene MGC2177 are physically adjacent to each other on chromosome 8q11.2~q13 region. Amplification of PLAG1 and of MGC2177 was further confirmed with real-time quantitative PCR to be 28- and 24fold respectively (data not shown). Serendipitously, while evaluating an array printed with bacterial artificial chromosome (BAC) clones (Spectral Genomics, Houston, TX) with the same salivary tumor DNA, we found that proteasome (prosome, macropain) 26S subunit, ATPase 6 pseudogene (PSMC6P) and v-yes-1 Yamaguchi sarcoma viral related oncogene homolog (LYN) genes are amplified, as revealed by the BAC clone R11-113H14, which contains only PSMC6P and LYN genes (Fig. 3). Thus, both the BAC array and the cDNA microarray show that PSMC6P and LYN genes are amplified. Based on the linear locations of the amplified genes on chromosome 8, we estimated that the maximum region of amplification is ~2.3 Mb (Fig. 4).
The work is partly supported by grants from John Dunn Foundation and Kleberg Foundation to the Cancer Genomics program. We are also indebted to Spectral Genomics, Inc. (Houston, TX), for the BAC array and to Rita Cheng for critical reading of the manuscript.
References [1] Kallioniemi A, Kallioniemi OP, Sudar D, Rutovitz D, Gray JW, Waldman F, Pinkel D. Comparative genomic hybridization for molecular cytogenetic analysis of solid tumors. Science 1992;258:818–21. [2] Cai WW, Mao JH, Chow CW, Damani S, Balmain A, Bradley A. Genome-wide detection of chromosomal imbalances in tumors using BAC microarrays. Nat Biotechnol 2002;20:393–6. [3] Zhao J, Roth J, Bode-Lesniewska B, Pfaltz M, Heitz PU, Komminoth P. Combined comparative genomic hybridization and genomic microarray for detection of gene amplifications in pulmonary artery intimal sarcomas and adrenocortical tumors. Genes Chromosomes Cancer 2002;34:48–57. [4] Snijders AM, Nowak N, Segraves R, Blackwood S, Brown N, Conroy J, Hamilton G, Hindle AK, Huey B, Kimura K, Law S, Myambo K, Palmer J, Ylstra B, Yue JP, Gray JW, Jain AN, Pinkel D, Albertson DG. Assembly of microarrays for genome-wide measurement of DNA copy number. Nat Genet 2001;29:263–4. [5] Wilhelm M, Veltman JA, Olshen AB, Jain AN, Moore DH, Presti JC Jr, Kovacs G, Waldman FM. Array-based comparative genomic hybridization for the differential diagnosis of renal cell cancer. Cancer Res 2002;62:957–60. [6] Wessendorf S, Fritz B, Wrobel G, Nessling M, Lampel S, Goettel D, Kuepper M, Joos S, Hopman T, Kokocinski F, Dohner H, Bentz M, Schwaenen C, Lichter P. Automated screening for genomic imbalances
128
[7]
[8]
[9]
[10]
[11]
Y.T.M. Tsang et al. / Cancer Genetics and Cytogenetics 152 (2004) 124–128 using matrix-based comparative genomic hybridization. Lab Invest 2002;82:47–60. Heiskanen MA, Bittner ML, Chen Y, Khan J, Adler KE, Trent JM, Meltzer PS. Detection of gene amplification by genomic hybridization to cDNA microarrays. Cancer Res 2000;60:799–802. Pollack JR, Perou CM, Alizadeh AA, Eisen MB, Pergamenschikov A, Williams CF, Jeffrey SS, Botstein D, Brown PO. Genome-wide analysis of DNA copy-number changes using cDNA microarrays. Nat Genet 1999;23:41–6. Rao PH, Murty VV, Louie DC, Chaganti RS. Nonsyntenic amplification of MYC with CDK4 and MDM2 in a malignant mixed tumor of salivary gland. Cancer Genet Cytogenet 1998;105:160–3. Wong KK, Cheng RS, Mok SC. Identification of differentially expressed genes from ovarian cancer cells by MICROMAX cDNA microarray system. Biotechniques 2001;30:670–5. Wang TL, Maierhofer C, Speicher MR, Lengauer C, Vogelstein B, Kinzler KW, Velculescu VE. Digital karyotyping. Proc Natl Acad Sci U S A 2002;99:16156–61.
[12] Voz ML, Van de Ven WJ, Kas K. First insights into the molecular basis of pleomorphic adenomas of the salivary glands. Adv Dent Res 2000;14:81–3. [13] Queimado L, Lopes C, Du F, Martins C, Bowcock AM, Soares J, Lovett M. Pleomorphic adenoma gene 1 is expressed in cultured benign and malignant salivary gland tumor cells. Lab Invest 1999;79:583–9. [14] Astrom AK, Voz ML, Kas K, Roijer E, Wedell B, Mandahl N, Van de Ven W, Mark J, Stenman G. Conserved mechanism of PLAG1 activation in salivary gland tumors with and without chromosome 8q12 abnormalities: identification of SII as a new fusion partner gene. Cancer Res 1999;59:918–23. [15] Hensen K, Van Valckenborgh IC, Kas K, Van de Ven WJ, Voz ML. The tumorigenic diversity of the three PLAG family members is associated with different DNA binding capacities. Cancer Res 2002;62:1510–7. [16] Ren X, Cao C, Zhu L, Yoshida K, Kharbanda S, Weichselbaum R, Kufe D. Lyn tyrosine kinase inhibits nuclear export of the p53 tumor suppressor. Cancer Biol Ther 2002;1:703–8.