- Email: [email protected]
amu argon ions
Advances in Space Research 36 (2005) 1680–1688 www.elsevier.com/locate/asr
Gene expression in mammalian cells after exposure to 95 MeV/amu argon ions Andrea Arenz *, Christine E. Hellweg, Matthias M. Meier, Christa Baumstark-Khan DLR German Aerospace Center, Institut fu¨r Luft- und Raumfahrtmedizin, Strahlenbiologie, Linder Hoehe, 51147 Ko¨ln, Germany Received 18 November 2004; received in revised form 16 February 2005; accepted 22 February 2005
Abstract High LET radiations, such as heavy ions or neutrons, have an increased biological effectiveness compared to X-rays for gene mutation, genomic instability and carcinogenesis. Estimating the biological risks from space radiation encountered by cosmonauts will continue to influence long term duration in space, such as the planned mission to Mars. The human radiation responsive genes CDKN1A (p21/WAF), GADD45a (GADD45), GADD45b (MyD118), RRM2b (p53R2) and BRCA2 (FancD1), involved in cell cycle control or damage repair, were screened for gene expression changes in MCF-7 cells by quantitative real-time reverse transcription PCR (qRT-PCR) assay, using cDNA obtained from total RNA isolated at various time points after irradiation with accelerated doses of 36-argon ions and X-rays. Examination of the expression profiles 2 and 12 h after exposure reveals a pattern consistent with a population of cells in the early response to DNA damage and invoking cell stress responses. Interesting new data showing different expression patterns according to the gene and the type of ionizing radiation used could be obtained. Results show, that the signaling and repair activities induced after heavy ion or X-ray exposure are not the same and gene expression patterns may become useful indicators for distinguishing different types of radiation in relation to their biological effects. 2005 COSPAR. Published by Elsevier Ltd. All rights reserved. Keywords: Space; Human radiation-responsive genes; Gene activation; Quantitative RT-PCR
1. Introduction Human space discovery programs, such as the utilization of the international space station (ISS) and the planned mission to Mars, require extended attendance of crews in the outer space. It is well recognized that space radiation represents a major hazard to astronauts involved in interplanetary missions, and that an increase in the duration of space flights may result in an increase in the associated cancer risk. The space radiation environment is a complex mixture of different radiation
*
Corresponding author. Tel.: +49 2203 6012435; fax: +49 2203 61970. E-mail address: [email protected] (A. Arenz).
types. Highly energetic, heavy charged particles from galactic cosmic radiation cannot be sufficiently shielded in space vehicles and space suits for work in outer space (Horneck et al., 2003a,b; Jakel, 2004). Radiation effects to humans of these particles are largely unknown. Therefore direct biological measurements are necessary. Identifying genes that are differently expressed in response to DNA damage caused by different qualities of radiation may help to elucidate markers for genetic damage. Radiation-induced DNA damage initiates a complex series of overlapping gene responses responsible for the maintenance of genome integrity (Jackson, 2002; Iliakis et al., 2003). In addition, differences in radiation quality, such as the exposure to high-linear energy transfer (LET) radiation, may influence the pattern of responses
0273-1177/$30 2005 COSPAR. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.asr.2005.02.062
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
(Redpath, 2004). Previous studies have shown that induction of human radiation-responsive genes by low-LET radiation has a different dependence on the time after irradiation than induction by high LET irradiation (Woloschak and Chang-Liu, 1990; Amundson et al., 2001). The cellular response to ionizing radiation involves complex signalling pathways, which activate cell cycle checkpoints, coupled with the activation of DNA repair pathways and apoptosis. The tumour-suppressor p53 plays a central role in the complex molecular response, but other pathways also play important roles (El-Diery et al., 1993; Fei and El-Diery, 2003). p53 is a transcription factor which up-regulates a number of important cell-cycle modulating genes, including CDKN1A (p21/ WAF) and GADD45 (GADD45a). p53 is also though to be involved in DNA repair by the transcriptional activation of RRM2b (p53R2), which encodes a modified ribonucleotide reductase that is directly involved in the p53 checkpoint for repair of damaged DNA (Tanaka et al., 2000). The breast cancer tumour suppressor gene BRCA2 appears to be an essential cofactor in the RAD51-dependent DNA repair of double-strand breaks (Sharan et al., 1997; Chen et al., 1998). As a model organism for a well-characterized, wild-type p53 cell line we used MCF-7 cells. The fluorescence-based real-time reverse transcription PCR (RT-PCR) is widely used for the quantification of steady-state mRNA levels and has led to widespread adoption as the method of choice for quantification changes in gene expression dependent on environmental changes. RT-PCR has a detection limit 10- to 100-fold better than other methods, e.g., RNA-Protection-Assay or Northern-Hybridisation, respectively. We utilized qRT-PCR technology to compile gene expression profiles obtained at various time-points after exposure to increasing doses of 36-argon ions and X-rays. The expression profiles reflect the molecular response to ionizing radiation related to the recognition of DNA damage, an arrest in cell-cycle progression and activation of DNA-repair pathways. Here, we present results on alteration of gene expression caused by high- and low-LET radiation on human breast cancer cells.
2. Materials and methods 2.1. Cell lines and growth conditions The MCF-7 human breast carcinoma cell line, expressing wild type p53, was obtained from Prof. Franke, German Cancer Research Center, Heidelberg. MCF-7 cells were grown under standard conditions in a-MEM (modified MEM, Biochrom KG, Berlin, Germany) supplemented with 10% fetal bovine serum (FBS) + 1 mM sodium pyruvate + 10 lg/ml bovine insulin at 37 C saturated humidity and 5% CO2/95% air
1681
atmosphere. Cells were cultured according to standard procedures and split (1:5) every 7 days. Medium was changed after a growth period of 4 days. 2.2. Irradiation with heavy ions (high LET-irradiation) MCF-7 cells were seeded into Petri-Dishes (B 3 cm) with reduced growth area (B 1.6 cm) with densities of 5 · 104 cells/cm2 and grown for four days before irradiation. Irradiation with 36-Ar ions was performed at the French heavy ion accelerator GANIL (Caen, France). Cells were exposed to high LET heavy ion particles (95 MeV/amu Ar, LET 232.2 keV/lm) with fluences from 1.25 · 106 particles cm2 (P cm2) (0.4625 Gy equivalents) to 4 · 107 P cm2 (14.8 Gy equivalents) and harvested for analysis at indicated intervals. Control cells were treated similarly but without heavy ion exposure. The effective dose was calculated as Dose/Gy = 1.6 · 109 · LET/(keV lm1) · F/(P cm2) (Wulf et al., 1985). 2.3. Irradiation with X-rays (low LET-irradiation) MCF-7 cells were seeded into petri dishes (B 3 cm) with cell densities of 5 · 104 cells/cm2. After a growth period of four days cells were irradiated at room temperature with X-rays (150 kV, 19 mA) generated by an Xray tube (Mu¨ller Type MG 150, Germany). The dose rate was 1.8 Gy/min. Cells were harvested for analysis at indicated time points. Control cells were treated similarly but without X-ray exposure. 2.4. Total RNA extraction and cDNA synthesis Total RNA of irradiated and non-irradiated cells was isolated using RNeasy Mini Kit (Qiagen, Hilden, Germany) including an on-column DNase-digestion according to the manufacturerÕs recommendations. The integrity of the total RNA was determined by electrophoresis under denaturing conditions in an agaroseformaldehyde gel (1.2% w/v). Nucleic acid concentration was measured at 260 nm (Genequant pro, Amersham Biosciences, Freiburg, Germany). Purity of the RNA preparation was determined as the 260/280 nm ratio with expected values between 1.8 and 2. The RNA was first denatured at 65 C for 5 min. For the subsequent RT reaction, constant amounts of 1 lg total RNA were converted to double-stranded cDNA using the iScript cDNA synthesis kit (Bio-Rad Ltd, Munich, Germany) according to the manufacturerÕs instructions. The cDNA was stored at 20 C until qRT-PCR analysis was performed. 2.5. Oligonucleotide primers Primer pairs were designed using published human nucleic acid cDNA/mRNA sequences (NCBI (http://
1682
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
ncbi.nlm.nih.gov), RTPrimerDB (http://medgen.ugent. ben/rtprimerdb)) with regard to primer dimer formation, self-priming formation and primer melting temperature (Netprimer, PREMIER Biosoft Interna- tional Palo Alto, CA). Primer sequences of RRM2b (p53R2), GADD45A (DDIT1), GADD45B (MYD118), BRCA2 (FANCD1), CDKN1A (p21/WAF1), UBC (Ubiquitin C), HPRT (hypoxanthine phosphoribosyltransferase 1), G6PDH (glucose-6-phosphate dehydrogenase) were designed to span at least one intron and synthesized commercially (Invitrogen, Karlsruhe, Germany). Primer information of the genes of interest and the housekeeping genes (HKG) are listed in Table 1. PCR conditions were optimized on a thermal cycler (Biometra, Go¨ttingen, Germany) and subsequently on an Opticon2 (MJ Research Inc., Waltham, MA) by analyzing the melting curves of the products. 2.6. Quantification by real-time PCR Real-time PCR using SYBR Green I technology was performed in the Opticon2 with 20 ng reversely transcribed total RNA. All samples of different total cDNA were analysed in triplets. To generate the data basis for determination of PCR efficiency of each transcript, dilution series in triplets of a pool of all available cDNA was performed (Pfaffl, 2001). Master-mix for each PCR run was then performed as follows: 12.5 ll qPCR Mastermix for SYBR Green I (Eurogentec Inc., Cologne, Germany), 9.5 ll water and 0.5 ll (200 nM) for each primer set. The following amplification protocol was applied: After 10 min of denaturation at 95 C to activate the Hot Start DNA polymerase, 40 cycles of amplification were accomplished with: (i) 15 s at 95 C for denaturation, (ii) 30 s at respective annealing temperature (Table 1) and (iii) 30 s for at 60 C for elongation. Subsequently,
a melting step was performed with slow heating starting at 60 C with a rate of 0.3 C/s up to 95 C with continuous measurement of fluorescence. The same gene was always quantified in each run to prevent any inter-run variation. 2.7. Data acquisition Expression level data of the studied genes were obtained by measuring crossing points (CP). The CP is defined as the point at which the fluorescence rises appreciably above the background fluorescence. The threshold level was calculated by fitting the intersection line upon the ten-times value of ground fluorescence standard deviation. The real-time PCR efficiencies (E) were calculated from the slope, according to the following equation (Rasmussen, 2001): E ¼ 10½1=slope ; where E is in the range from 1 (minimal value) to 2 (theoretical maximum and optimum). In relative quantification (Serazin-Leroy et al., 1998), the expression of a target gene is standardised by a reference gene, whose expression is considered to be constant (Suzuki et al., 2000; Thellin et al., 1999). The stability of standard gene expression is an elementary prerequisite for internal standardisation of target gene expression. Commonly used internal controls can quantitatively vary in response to various factors (Thellin et al., 1999). In order to measure expression levels accurately, normalization by multiple housekeeping genes instead of one is required (Vandesompele et al., 2002). To determine the best suited housekeeping gene under the chosen experimental conditions, the BestKeeper software, an Excel-based tool using pair-wise correlations, was used (Pfaffl et al., 2004).
Table 1 Primer sequences used to amplify target genes and housekeeping genes Gene
Primers
Amplicon length (bp)
Annealing temperature (C)
CDKN1A
fwd: GACACCACTGGAGGGTGACT rev: CAGGTCCACATGGTCTTCCTC fwd: GAGAGCAGAAGACCGAAAGGA rev: CACAACACCACGTTATCGGG fwd: ACAGTGGGGGTGTACGAGTC rev: TTGATGTCGTTGTCACAGCA fwd: TTTCTTCAGAAGCTCCACCC rev: TCAGCCCTTGCTCTTTGAAT fwd: TATAAACAGGCACAGGCTTCC rev: CGATGAGAATTTGAAAGCCA fwd: ATTTGGGTCGCGGTTCTTG rev: TGCCTTGACATTCTCGATGGT fwd: TGACACTGGCAAAACAATGCA rev: GGTCCTTTTCACCAGCAAGCT fwd: CAACCACATCTCCTCCCTGT rev: CGAAGATCCTGTTGGCAAAT
172
62
145
60
155
62
155
60
155
60
133
60
120
62
113
62
GADD45a GADD45b BRCA2 RRM2b UBC HPRT G6PDH
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
Analysis of relative expression results was performed using the relative expression software tool (REST) allowing group-wise comparison of sample and control group for reference and target genes (Pfaffl et al., 2002). The relative expression ratio of a target gene was computed, based on its real-time PCR efficiencies (E) and the crossing point (CP) difference (D) of one unknown sample (treatment) versus one control (DCPcontrol-treatment) (Eq. (1)). Using the software application REST the relative calculation procedure was based on the MEAN CP of the experimental groups (Eq. (2)) Ratio ¼
Ratio ¼
ðEtarget Þ ðEref Þ ðEtarget Þ
DCP target ðcontrol sampleÞ DCP ref ðcontrol sampleÞ
ð1Þ
;
DCP target ðMEAN control MEAN sampleÞ
ðEref ÞDCP
ref ðMEAN control MEAN sampleÞ
:
ð2Þ
The expression ratio results were tested for significance by a randomisation test (Pfaffl et al., 2002). The statistical significance of differences in mRNA expression in the investigated samples was calculated by a pair-wise fixed reallocation test. The expression ratio was computed in regard to the untreated control group and was normalized by the individual reference gene. REST also indicates coefficients of variations in percentage mean values for CV (%) and standard deviations based on CPs of the target genes. The expression ratio was determined as mean difference (D) ± SEM of CPs between the control group and the irradiation induced gene expression of target genes.
1683
3.2. Real-time PCR amplification efficiencies and linearity Real-time PCR efficiencies were calculated from the given slopes in the Opticon Monitor software. Transcripts showed real-time PCR efficiency rates from 1.60 to 2.08 in the investigated range from 120 pg to 75 ng cDNA input with high linearity (Pearson coefficient r > 0.95, Table 2). 3.3. Analysis of expression stability of housekeeping genes To determine the most stable reference gene, individual sample descriptive statistics of the derived crossing points were computed for each housekeeping gene. All CP data were compared over the entire study, including control and treatment groups. The BestKeeper software calculated the x-fold over- or under-expression of individual samples towards the geometric mean CP and the multiple factor of their minimal and maximal values, expressed as the x-fold ratio and its standard deviation (Pfaffl et al., 2004) (data not shown). Results of housekeeping gene stability after irradiation with Xrays and heavy ions, respectively, are shown in Table 3. For each of the individual assays a specific housekeeping gene was chosen according to the results obtained form the BestKeeper software. The expression level of HPRT showed no significant changes within the investigated samples of X-irradiated cells and of Ar-ion exposed cells (2 h after exposure). Thus, it was determined to be suitable as a reference gene for these sample groups. For the group of samples investigated 12 h after irradiation with 36 Ar ions, UBC seemed to be the most stably expressed housekeeping gene.
3. Results
3.4. Relative quantification of target gene expression
3.1. Confirmation of primer specificity
On the basis of the mathematical model shown in Eq. (2) the relative expression software tool Rest calculates the relative expression ratios on the basis of group means for target genes (genes of interest) versus a reference gene (housekeeping gene) and tests the group ratio results for significance as shown in Tables 4 and 5. In case of down-regulation, the regulation factor is illustrated as a reciprocal value (1/expression ratio).
Specificity of RT-PCR products was documented with high resolution gel electrophoresis and resulted in single products with the desired length. In addition, a melting curve analysis was performed resulting in single product-specific melting temperatures. After optimisation no primer-dimer formations were observed.
Table 2 qPCR efficiencies and linearity Irradiation condition
G6PDH
HPRT
UBC
GADD45a
GADD45b
RRM2B
CDKN1A
BRCA2
2 h after 95 MeV/amu Ar
E r
1.69 0.992
1.71 0.994
1.90 0.994
1.64 0.977
1.70 0.987
1.65 0.992
1.60 0.989
1.85 0.985
12 h after 95 MeV/amu Ar
E r
1.96 0.996
1.81 0.992
1.94 0.986
1.78 0.993
1.80 0.987
1.76 0.995
1.61 0.994
1.86 0.988
X-rays 4 Gy
E r
2.13 0.974
1.92 0.995
2.04 0.986
1.97 0.981
1.93 0.983
1.97 0.980
2.05 0.964
2.08 0.983
1684
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
Table 3 Results of housekeeping gene stability after irradiation qPCR assay
Housekeeping gene
p-Value
Power of HKG (x-fold)
2 h after 95 MeV/amu Ar
G6PDH HPRT UBC
0.001 0.001 0.001
2.00 1.43 1.91
12 h after 95 MeV/amu Ar
G6PDH
0.001
2.15
HPRT UBC
0.001 0.001
1.82 1.76
G6PDH HPRT UBC
0.001 0.027 0.638
6,32 1.41 1.10
X-rays 4 Gy
3.4.1. Relative changes in mRNA expression due to low LET radiation We have studied the time course of gene expression modulation after irradiation with 4 Gy X-rays (Fig. 1). Gene expression of CDKN1A (p21/WAF) was significantly up-regulated by a factor of 2.2 after 2 h and 4.3 after 4 h post-irradiation. There was a strong and significant up-regulation by a factor of 7.06 for GADD45a-
mRNA expression 2 h after damage-induction. The up-regulation at later time-points with increasing values from 3.2 (4 h post-irradiation) up until 2.1 (48 h postirradiation) was highly significant during the investigated time course except at 12 h. Expression levels of GADD45b showed a moderate, but significant up-regulation 24 h after induction by a factor of 1.6, respectively, by a factor of 1.7 after 48 h. Gene expression of RRM2b was induced by a factor of 3.7 after 2 h and stays on elevated levels from 2.3 (4, 12 and 24 h) to 2.1 (48 h) for the investigated time span, significantly at 2, 12, 48 h. The mRNA expression for BRCA2 showed a time-depended decreasing gene expression profile from 1.22-fold down-regulation at the investigated time point of 2 h to a maximal down-regulation of 4.8-fold at 48 h. Significant down-regulation was found at 12, 24 and 48 h. 3.4.2. Relative changes in mRNA expression due to high LET radiation We have investigated the mRNA expression of the genes of interest 2 and 12 h after exposure to accelerated 95 MeV/amu argon ions (Fig. 2). Among the human
Table 4 Relative gene expression after exposure to accelerated 95 MeV/amu Ar ions normalized against the house-keeping gene of choice Gene of interest
2 h after 95 MeV/amu Ar Fluence
12 h after 95 MeV/amu Ar
Relative expression ratio
p-Value
Relative expression ratio
p-Value
GADD45a
6
1.25 · 10 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
0.688 0.842 0.695 0.246 0.721 n.d.
0.076 0.186 0.056 0.022 0.086 n.d.
1.648 1.367 1.496 2.873 1.848 2.779
0.086 0.209 0.001 0.001 0.001 0.001
GADD45b
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
0.290 0.264 0.187 0.116 0.305 n.d.
0.001 0.081 0.026 0.001 0.073 n.d.
1.099 1.234 0.616 0.973 0.641 0.816
0.563 0.411 0.046 0.893 0.319 0.470
CDKN1A
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
1.791 1.240 0.953 0.343 1.423 n.d.
0.001 0.102 0.623 0.034 0.019 n.d.
1.215 1.385 1.218 1.629 1.590 2.248
0.585 0.225 0.209 0.041 0.012 0.001
RRM2b
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
0.725 0.846 0.598 0.248 1.004 n.d.
0.296 0.278 0.038 0.001 0.804 n.d.
0.866 1.039 1.431 1.458 1.378 1.578
0.594 0.696 0.038 0.131 0.131 0.046
BRCA2
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
2.462 1.386 0.838 0.389 1.681 n.d.
0.001 0.198 0.071 0.033 0.001 n.d.
0.741 0.643 0.577 0.350 0.397 0.415
0.201 0.123 0.032 0.001 0.032 0.137
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688 Table 5 Time course of relative gene expression after 4 Gy X-irradiation normalized against the house-keeping gene of choice Gene of interest
Time after irradiation (h)
Relative expression ratio
p-Value
GADD45a
2 4 12 24 48
7.056 3.180 1.281 2.314 2.128
0.001 0.030 0.396 0.001 0.001
GADD45b
2 4 12 24 48
0.697 1.215 1.045 1.632 1.702
0.255 0.732 0.591 0.035 0.001
CDKN1A
2 4 12 24 48
2.189 4.303 0.537 1.097 0.241
0.001 0.001 0.090 0.721 0.229
RRM2b
2 4 12 24 48
3.675 2.301 2.309 2.319 2.070
0.001 0.128 0.001 0.197 0.001
BRCA2
2 4 12 24 48
0.819 0.551 0.495 0.363 0.208
0.143 0.128 0.001 0.034 0.001
1685
expression profile 2 h after exposure to 95 MeV/amu Ar ions of CDKN1A as well as BRCA2 showed no obvious trend of regulation, nevertheless the calculated values showed a high statistical significance. A different tendency of expression level profile was found at the investigated time point of 12 h. The gene expression for CDNK1A showed an increasing tendency from 1.2to 2.2-fold with increasing dose of 95 MeV/amu Ar ions, indicating significance at investigated fluences from 1 · 107 to 4 · 107 P cm2. Also GADD45a, down-regulated 2 h after argon ion exposure, showed a fluencedependent up-regulation from 1.4 to 2.9 at the later time point of gene expression quantification. Four of these expression levels were highly significant. The mRNA expression 12 h after damage induction of RRM2b showed a slight up-regulation up to 1.6-fold at the highest fluence in contrast to the observed down-regulation tendency 2 h after exposure. Two of these expression levels tend to be significant (0.038 < P < 0.046). The observed trend of down-regulation 2 h after exposure to argon ions for GADD45b gene expression was attenuated at the examined time point of 12 h with maximum values of 1.6 (P < 0.05). The mRNA expression of BRCA2 was suppressed to gene expression levels from 1.3- to 2.9-fold due to the graded fluences of argon ions, significantly at 5 · 106, 1 · 107, 2 · 107 P cm2.
4. Discussion radiation-responsive genes investigated three (GADD45a, GADD45b and RRM2b) were shown to be consistently down-regulated by 1.2- to 4-fold at the examined time point 2 h after exposure to argon ion beam. The gene
In radiation-exposed cells, pathways of cellular defence mechanisms in addition to DNA repair are invoked as a response to the DNA damage and include
Fig. 1. Gene expression profile after 4 Gy X-irradiation of five human radiation responsive genes detected by real time RT-PCR. Relative expression ratios were calculated on the basis of group means for target genes versus a housekeeping gene (HPRT). Significances are indicated in relation to the control group P < 0.05; n = 3.
1686
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
Fig. 2. (a) Gene expression profile 2 h after exposure to accelerated 95 MeV/amu argon ions. Changes in mRNA expression of five human radiation responsive genes were detected by real time RT-PCR. Relative expression ratios were calculated on the basis of group means for target genes versus a housekeeping gene (UBC). Significances are indicated in relation to the control group P < 0.05; n = 3. (b) Gene expression profile 12 h after exposure to accelerated 95 MeV/amu argon ions. Changes in mRNA expression of five human radiation responsive genes were detected by real time RT-PCR. Relative expression ratios were calculated on the basis of group means for target genes versus a housekeeping gene (HPRT). Significances are indicated in relation to the control group P < 0.05; n = 3.
the cell cycle and cell-death pathways (Akerman et al., 2005). Many of the defence responses are modulated by the tumour-suppressor gene p53, which serves as a transcriptional regulator in addition to its interactions with other proteins important in these pathways (Morris, 2002; Fei and El-Diery, 2003). p53 mediates cell cycle arrest and apoptosis by binding to DNA and activating the transcription of specific genes. p53 is also
thought to be involved in DNA repair by the transcriptional activation of RRM2b (p53R2), which encodes a modified ribonucleotide reductase that is directly involved in the p53 checkpoint for repair of damaged DNA. In case of genotoxic stress, RRM2b is responsible for the urgent supply of dNTPs in G1 and G2 phases of the cell cycle for DNA repair synthesis. Although RRM2b shows a significant similarity (80%) to the small
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
subunit (RRM2) of ribonucleotide reductase, it can be induced in response to several genotoxic damages, in contrast to the RRM2 subunit which is active during the S-phase of the mitotic cell cycle (Tanaka et al., 2000). After high-LET radiation with accelerated 95 MeV/amu argon ions gene expression for RRM2b was up-regulated, as measured in the kinetic RT-PCR experiment. The same was true after low-LET radiation; however, there were differences between the magnitude and the time course of induction. The induction by argon ions appeared later and reached a lower level. As a key player in genotoxic stress response, p53 participates in the DNA-damage induced G1 arrest by transcriptional induction of CDKN1A (p21/WAF), an inhibitor of cyclin-dependent kinases thereby controlling the entry of cells into S-phase (El-Diery et al., 1993). The p21 family includes the structurally-related proteins p21CIP1/WAF (CDKN1A), p27KIP1 and p57KIP2, all of which inhibit a variety of CDK/cyclin complexes by binding to both cyclin and CDK subunits. In addition to its key role in G1/S arrest, CDKN1A may also play a role in the G2/M checkpoint through a p53dependent mechanism. After DNA damage, many cells appear to enter a sustained arrest in the G2 phase of the cell cycle. Bunz et al. (1998) demonstrated that this arrest could be sustained only when p53 was present in the cell and capable of transcriptionally activating of CDKN1A. After disruption of either the p53 or the CDKN1A gene, c-radiated cells progressed into mitosis and exhibited a G2 DNA content because of a failure of cytokines. Thus, p53 and CDKN1A appear to be essential for maintaining the G2 checkpoint in human cells. In our experiments, CDKN1A shows a time-dependent gene expression with maximum peak 4 h after X-rays and was down-regulated at later time points. As for RRM2b, the gene expression response to accelerated argon ions was slower and weaker compared to X-rays. Growth arrest and DNA damage gene 45 (GADD45), a p53-regulated and stress-inducible gene plays an important role in cellular response to DNA damage. GADD45a (Gadd45), GADD45b (MyD118), and GADD45c (CR6) constitute a family of evolutionarily conserved, small, acidic, nuclear proteins, which have been implicated in terminal differentiation, growth suppression, and apoptosis. How Gadd45 proteins function in negative growth control is not fully understood. Recent evidence has implicated Gadd45a in inhibition of cdc2/cyclinB1 kinase and in G2/M cell cycle arrest whereas Gadd45b and Gadd45g specifically seem to interact with the Cdk1/CyclinB1 complex, both of which are required for IR induced cell cycle regulation and radioresistance (Vairapandi et al., 2002). GADD45b is a TNFa-inducible gene and a physiological target of NFjB (De Smaele et al., 2001). The genes in this group respond to environmental stresses by mediating activation of the p38/JNK pathway. This activation is medi-
1687
ated via their proteins binding and activating MTK1/ MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. JNK is crucial to programmed cell death. GADD45a showed the highest induction 2 h after irradiation with X-rays. After exposure to argon ions the gene expression of GADD45a displays a delayed reaction in comparison to X-radiation at the investigated time points. The gene expression profile for GADD45b after induction of cell damage showed a late response 24 h after irradiation on a moderate level. After argon ion exposure, the gene showed an early down-regulation which attenuates at the later time point. BRCA2 is thought to be an essential cofactor in the Rad51-dependent DNA repair of double-strand breaks (Sharan et al., 1997). BRCA1 and BRCA2 participate together in a pathway (or pathways) associated with the activation of double-strand break repair and/or homologous recombination. BRCA2 mRNA and protein levels were shown to be down-regulated in breast cancer cell lines in response to specific DNA-damaging agents, but the mechanism by which this occurs is not completely understood. It was shown, that in response to Adriamycin-associated DNA damage p53 mediates repression of the BRCA2 promotor (Wu et al., 2003). The underlying mechanism of BRCA2 down-regulation after exposure to other DNA-damaging agents such as UV-irradiation and c-irradiation is unknown. The gene expression profile for BRCA2 in the kinetic RT-PCR assay after X-irradiation displays a clear down-regulation. The response to argon ions is inconsistent, showing at the early time point of investigation an up-regulation followed by a distinct down-regulation at the later time point. Interestingly, some of the DNA repair genes appear to be up-regulated during post-irradiation incubation in spite of the fact that most of the DNA damage is already repaired. This shows that some gene expression patterns reflect part of the regulatory network of the overall cellular radiation response. Comparing the tendency of gene expression pattern we observed differences in the magnitude of induction of the investigated radiation-responsive genes after high LET radiation and low LET radiation. The results are highly suggestive that the response to the clustered damage and high complex DNA lesions induced by densely ionizing radiation differs from the cellular reaction induced by low LET irradiation and that these clustered damages appear more difficult to repair. Even though the data reported above cannot be considered complete and/or definitive, nevertheless, in whole, they confirm that the chosen method of qRTPCR may constitute a suitable model system to study, at molecular level, the effects of cosmic radiation. In addition, ongoing experiments are identifying large numbers of potential human-radiation responsive
1688
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
genes using micro-array hybridization and various irradiation protocols including expression at different times after exposure to low- and high-LET radiation.
Acknowledgements This work was initially supported by the German Academy of Aviation and Travel Medicine (Deutsche Akademie fu¨r Flug- und Reisemedizin). The authors would like to thank Isabelle Testard and Hermann Rothard from the Centre Interdisciplinaire de Recherche Ions Lourds (CIRIL, Caen, France) for valuable advice and many help given during numerous night shifts at the French Heavy Ion Accelerator GANIL.
References Akerman, G.S., Rosenzweig, B.A., Domon, O.E., et al. Alterations in gene expression profiles and the DNA-damage response in ionizing radiation exposed TK6 cell. Environ. Mol. Mutagen. 45, 188–205, 2005. Amundson, S.A., Bittner, M., Meltzer, P., et al. Induction of gene expression as a monitor of exposure to ionizing radiation. Radiat. Res. 156, 657–661, 2001. Bunz, F., Dutriaux, A., et al. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 282, 1497–1501, 1998. Chen, J., Silver, D.P., Walpita, D. Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Molec. Cell 2, 317–328, 1998. De Smaele, E., Zazzeroni, F., Papa, S., et al. Induction of gadd45 beta by NF-kappa-B downregulates pro-apoptotic JNK signaling. Nature 414, 308–313, 2001. El-Diery, W.S., Tokino, T., Velculisci, V.E., et al. WAF1, a potential mediator of 53 tumour suppression. Cell 75, 817–825, 1993. Fei, P., El-Diery, W.S. p53 and radiation responses. Oncogene 22, 5774–5783, 2003. Horneck, G., Facius, R., Reichert, M., et al. HUMEX, a study on the survivability and adaptation of humans to long-duration exploratory missions, part I: lunar missions. Adv. Space Res. 31 (11), 2389–2401, 2003a. Horneck, G., Facius, R., Reichert, M., et al. HUMEX, a study on the survivability and adaptation of humans to long-duration exploratory missions ESA SP-1264, 2003b. Iliakis, G., Wang, Y., Guan, J., et al. DNA damage checkpoint control in cells exposed to ionizing radiation. Oncogene 22, 5834–5847, 2003. Jackson, S.P. Sensing and repairing DNA double-strand breaks. Carcinogenesis 23, 687–696, 2002.
Jakel, O. Radiation hazard during a manned mission to Mars. Z. Med. Phys. 14 (4), 267–272, 2004. Morris, S.M. A role for p53 in the frequency and mechanism of mutation. Mutat. Res. 511, 45–62, 2002. Pfaffl, M.W., Horgan, G.W., Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36, 2002. Pfaffl, M.W., Tichopad, A., Prgomet, C., et al. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515, 2004. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45, 2001. Rasmussen, R. Quantification on the LightCycler. in: Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real Time PCR: Methods and Applications. Springer, Heidelberg, pp. 21– 34, 2001. Redpath, J.L. Radiation-induced neoplastic transformation in vitro: evidence for a protective effect at low doses of low LET radiation. Cancer Metast. Rev. 23, 333–339, 2004. Serazin-Leroy, V., Denis-Henriot, D., Morot, M., et al. Semi-quantitative RT-PCR for comparison of mRNAs in cells with different amounts of housekeeping gene transcripts. Mol. Cell. Probes 12, 283–291, 1998. Sharan, S.K., Morimatsu, M., Albrecht, U., et al. Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature 386, 804–810, 1997. Suzuki, T., Higgins, P.J., Crawford, D.R. Control selection for RNA quantitation. Biotechniques 29, 332–337, 2000. Tanaka, H., Arakawa, H., Yamaguchi, T., et al. A ribonucleotide reductase gene involved in a p53-dependent cell-cycle checkpoint for DNA damage. Nature 404, 42–49, 2000. Thellin, O., Zorzi, W., Lakaye, B., et al. Housekeeping genes as internal standards: use and limits. J. Biotechnol. 75, 291–295, 1999. Vairapandi, M., Balliet, A.G., Hoffman, B., et al. GADD45b and GADD45g are cdc2/cyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J. Cell. Physiol. 192, 327–338, 2002. Vandesompele, J., De Preter, K., Pattyn, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3(7): research 0034.1research 0034.11, 2002. Woloschak, G.E., Chang-Liu, C.M. Differential modulation of specific gene expression following high- and low-LET radiations. Radiat. Res. 124, 183–187, 1990. Wu, K., Jiang, S.W., Couch, F.J. p53 mediates repression of the BRCA2 promoter and down-regulation of BRCA2 mRNA and protein levels in response to DNA damage. J. Biol. Chem. 278, 15652–15660, 2003. Wulf, H.W., Kraft-Weyrather, H.G., Miltenburger, E.A., et al. Heavy ions effects on mammalian cells inactivation measurements with different cell lines. Radiat. Res. Suppl. 8, S122–S134, 1985.
Gene expression in mammalian cells after exposure to 95 MeV/amu argon ions Andrea Arenz *, Christine E. Hellweg, Matthias M. Meier, Christa Baumstark-Khan DLR German Aerospace Center, Institut fu¨r Luft- und Raumfahrtmedizin, Strahlenbiologie, Linder Hoehe, 51147 Ko¨ln, Germany Received 18 November 2004; received in revised form 16 February 2005; accepted 22 February 2005
Abstract High LET radiations, such as heavy ions or neutrons, have an increased biological effectiveness compared to X-rays for gene mutation, genomic instability and carcinogenesis. Estimating the biological risks from space radiation encountered by cosmonauts will continue to influence long term duration in space, such as the planned mission to Mars. The human radiation responsive genes CDKN1A (p21/WAF), GADD45a (GADD45), GADD45b (MyD118), RRM2b (p53R2) and BRCA2 (FancD1), involved in cell cycle control or damage repair, were screened for gene expression changes in MCF-7 cells by quantitative real-time reverse transcription PCR (qRT-PCR) assay, using cDNA obtained from total RNA isolated at various time points after irradiation with accelerated doses of 36-argon ions and X-rays. Examination of the expression profiles 2 and 12 h after exposure reveals a pattern consistent with a population of cells in the early response to DNA damage and invoking cell stress responses. Interesting new data showing different expression patterns according to the gene and the type of ionizing radiation used could be obtained. Results show, that the signaling and repair activities induced after heavy ion or X-ray exposure are not the same and gene expression patterns may become useful indicators for distinguishing different types of radiation in relation to their biological effects. 2005 COSPAR. Published by Elsevier Ltd. All rights reserved. Keywords: Space; Human radiation-responsive genes; Gene activation; Quantitative RT-PCR
1. Introduction Human space discovery programs, such as the utilization of the international space station (ISS) and the planned mission to Mars, require extended attendance of crews in the outer space. It is well recognized that space radiation represents a major hazard to astronauts involved in interplanetary missions, and that an increase in the duration of space flights may result in an increase in the associated cancer risk. The space radiation environment is a complex mixture of different radiation
*
Corresponding author. Tel.: +49 2203 6012435; fax: +49 2203 61970. E-mail address: [email protected] (A. Arenz).
types. Highly energetic, heavy charged particles from galactic cosmic radiation cannot be sufficiently shielded in space vehicles and space suits for work in outer space (Horneck et al., 2003a,b; Jakel, 2004). Radiation effects to humans of these particles are largely unknown. Therefore direct biological measurements are necessary. Identifying genes that are differently expressed in response to DNA damage caused by different qualities of radiation may help to elucidate markers for genetic damage. Radiation-induced DNA damage initiates a complex series of overlapping gene responses responsible for the maintenance of genome integrity (Jackson, 2002; Iliakis et al., 2003). In addition, differences in radiation quality, such as the exposure to high-linear energy transfer (LET) radiation, may influence the pattern of responses
0273-1177/$30 2005 COSPAR. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.asr.2005.02.062
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
(Redpath, 2004). Previous studies have shown that induction of human radiation-responsive genes by low-LET radiation has a different dependence on the time after irradiation than induction by high LET irradiation (Woloschak and Chang-Liu, 1990; Amundson et al., 2001). The cellular response to ionizing radiation involves complex signalling pathways, which activate cell cycle checkpoints, coupled with the activation of DNA repair pathways and apoptosis. The tumour-suppressor p53 plays a central role in the complex molecular response, but other pathways also play important roles (El-Diery et al., 1993; Fei and El-Diery, 2003). p53 is a transcription factor which up-regulates a number of important cell-cycle modulating genes, including CDKN1A (p21/ WAF) and GADD45 (GADD45a). p53 is also though to be involved in DNA repair by the transcriptional activation of RRM2b (p53R2), which encodes a modified ribonucleotide reductase that is directly involved in the p53 checkpoint for repair of damaged DNA (Tanaka et al., 2000). The breast cancer tumour suppressor gene BRCA2 appears to be an essential cofactor in the RAD51-dependent DNA repair of double-strand breaks (Sharan et al., 1997; Chen et al., 1998). As a model organism for a well-characterized, wild-type p53 cell line we used MCF-7 cells. The fluorescence-based real-time reverse transcription PCR (RT-PCR) is widely used for the quantification of steady-state mRNA levels and has led to widespread adoption as the method of choice for quantification changes in gene expression dependent on environmental changes. RT-PCR has a detection limit 10- to 100-fold better than other methods, e.g., RNA-Protection-Assay or Northern-Hybridisation, respectively. We utilized qRT-PCR technology to compile gene expression profiles obtained at various time-points after exposure to increasing doses of 36-argon ions and X-rays. The expression profiles reflect the molecular response to ionizing radiation related to the recognition of DNA damage, an arrest in cell-cycle progression and activation of DNA-repair pathways. Here, we present results on alteration of gene expression caused by high- and low-LET radiation on human breast cancer cells.
2. Materials and methods 2.1. Cell lines and growth conditions The MCF-7 human breast carcinoma cell line, expressing wild type p53, was obtained from Prof. Franke, German Cancer Research Center, Heidelberg. MCF-7 cells were grown under standard conditions in a-MEM (modified MEM, Biochrom KG, Berlin, Germany) supplemented with 10% fetal bovine serum (FBS) + 1 mM sodium pyruvate + 10 lg/ml bovine insulin at 37 C saturated humidity and 5% CO2/95% air
1681
atmosphere. Cells were cultured according to standard procedures and split (1:5) every 7 days. Medium was changed after a growth period of 4 days. 2.2. Irradiation with heavy ions (high LET-irradiation) MCF-7 cells were seeded into Petri-Dishes (B 3 cm) with reduced growth area (B 1.6 cm) with densities of 5 · 104 cells/cm2 and grown for four days before irradiation. Irradiation with 36-Ar ions was performed at the French heavy ion accelerator GANIL (Caen, France). Cells were exposed to high LET heavy ion particles (95 MeV/amu Ar, LET 232.2 keV/lm) with fluences from 1.25 · 106 particles cm2 (P cm2) (0.4625 Gy equivalents) to 4 · 107 P cm2 (14.8 Gy equivalents) and harvested for analysis at indicated intervals. Control cells were treated similarly but without heavy ion exposure. The effective dose was calculated as Dose/Gy = 1.6 · 109 · LET/(keV lm1) · F/(P cm2) (Wulf et al., 1985). 2.3. Irradiation with X-rays (low LET-irradiation) MCF-7 cells were seeded into petri dishes (B 3 cm) with cell densities of 5 · 104 cells/cm2. After a growth period of four days cells were irradiated at room temperature with X-rays (150 kV, 19 mA) generated by an Xray tube (Mu¨ller Type MG 150, Germany). The dose rate was 1.8 Gy/min. Cells were harvested for analysis at indicated time points. Control cells were treated similarly but without X-ray exposure. 2.4. Total RNA extraction and cDNA synthesis Total RNA of irradiated and non-irradiated cells was isolated using RNeasy Mini Kit (Qiagen, Hilden, Germany) including an on-column DNase-digestion according to the manufacturerÕs recommendations. The integrity of the total RNA was determined by electrophoresis under denaturing conditions in an agaroseformaldehyde gel (1.2% w/v). Nucleic acid concentration was measured at 260 nm (Genequant pro, Amersham Biosciences, Freiburg, Germany). Purity of the RNA preparation was determined as the 260/280 nm ratio with expected values between 1.8 and 2. The RNA was first denatured at 65 C for 5 min. For the subsequent RT reaction, constant amounts of 1 lg total RNA were converted to double-stranded cDNA using the iScript cDNA synthesis kit (Bio-Rad Ltd, Munich, Germany) according to the manufacturerÕs instructions. The cDNA was stored at 20 C until qRT-PCR analysis was performed. 2.5. Oligonucleotide primers Primer pairs were designed using published human nucleic acid cDNA/mRNA sequences (NCBI (http://
1682
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
ncbi.nlm.nih.gov), RTPrimerDB (http://medgen.ugent. ben/rtprimerdb)) with regard to primer dimer formation, self-priming formation and primer melting temperature (Netprimer, PREMIER Biosoft Interna- tional Palo Alto, CA). Primer sequences of RRM2b (p53R2), GADD45A (DDIT1), GADD45B (MYD118), BRCA2 (FANCD1), CDKN1A (p21/WAF1), UBC (Ubiquitin C), HPRT (hypoxanthine phosphoribosyltransferase 1), G6PDH (glucose-6-phosphate dehydrogenase) were designed to span at least one intron and synthesized commercially (Invitrogen, Karlsruhe, Germany). Primer information of the genes of interest and the housekeeping genes (HKG) are listed in Table 1. PCR conditions were optimized on a thermal cycler (Biometra, Go¨ttingen, Germany) and subsequently on an Opticon2 (MJ Research Inc., Waltham, MA) by analyzing the melting curves of the products. 2.6. Quantification by real-time PCR Real-time PCR using SYBR Green I technology was performed in the Opticon2 with 20 ng reversely transcribed total RNA. All samples of different total cDNA were analysed in triplets. To generate the data basis for determination of PCR efficiency of each transcript, dilution series in triplets of a pool of all available cDNA was performed (Pfaffl, 2001). Master-mix for each PCR run was then performed as follows: 12.5 ll qPCR Mastermix for SYBR Green I (Eurogentec Inc., Cologne, Germany), 9.5 ll water and 0.5 ll (200 nM) for each primer set. The following amplification protocol was applied: After 10 min of denaturation at 95 C to activate the Hot Start DNA polymerase, 40 cycles of amplification were accomplished with: (i) 15 s at 95 C for denaturation, (ii) 30 s at respective annealing temperature (Table 1) and (iii) 30 s for at 60 C for elongation. Subsequently,
a melting step was performed with slow heating starting at 60 C with a rate of 0.3 C/s up to 95 C with continuous measurement of fluorescence. The same gene was always quantified in each run to prevent any inter-run variation. 2.7. Data acquisition Expression level data of the studied genes were obtained by measuring crossing points (CP). The CP is defined as the point at which the fluorescence rises appreciably above the background fluorescence. The threshold level was calculated by fitting the intersection line upon the ten-times value of ground fluorescence standard deviation. The real-time PCR efficiencies (E) were calculated from the slope, according to the following equation (Rasmussen, 2001): E ¼ 10½1=slope ; where E is in the range from 1 (minimal value) to 2 (theoretical maximum and optimum). In relative quantification (Serazin-Leroy et al., 1998), the expression of a target gene is standardised by a reference gene, whose expression is considered to be constant (Suzuki et al., 2000; Thellin et al., 1999). The stability of standard gene expression is an elementary prerequisite for internal standardisation of target gene expression. Commonly used internal controls can quantitatively vary in response to various factors (Thellin et al., 1999). In order to measure expression levels accurately, normalization by multiple housekeeping genes instead of one is required (Vandesompele et al., 2002). To determine the best suited housekeeping gene under the chosen experimental conditions, the BestKeeper software, an Excel-based tool using pair-wise correlations, was used (Pfaffl et al., 2004).
Table 1 Primer sequences used to amplify target genes and housekeeping genes Gene
Primers
Amplicon length (bp)
Annealing temperature (C)
CDKN1A
fwd: GACACCACTGGAGGGTGACT rev: CAGGTCCACATGGTCTTCCTC fwd: GAGAGCAGAAGACCGAAAGGA rev: CACAACACCACGTTATCGGG fwd: ACAGTGGGGGTGTACGAGTC rev: TTGATGTCGTTGTCACAGCA fwd: TTTCTTCAGAAGCTCCACCC rev: TCAGCCCTTGCTCTTTGAAT fwd: TATAAACAGGCACAGGCTTCC rev: CGATGAGAATTTGAAAGCCA fwd: ATTTGGGTCGCGGTTCTTG rev: TGCCTTGACATTCTCGATGGT fwd: TGACACTGGCAAAACAATGCA rev: GGTCCTTTTCACCAGCAAGCT fwd: CAACCACATCTCCTCCCTGT rev: CGAAGATCCTGTTGGCAAAT
172
62
145
60
155
62
155
60
155
60
133
60
120
62
113
62
GADD45a GADD45b BRCA2 RRM2b UBC HPRT G6PDH
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
Analysis of relative expression results was performed using the relative expression software tool (REST) allowing group-wise comparison of sample and control group for reference and target genes (Pfaffl et al., 2002). The relative expression ratio of a target gene was computed, based on its real-time PCR efficiencies (E) and the crossing point (CP) difference (D) of one unknown sample (treatment) versus one control (DCPcontrol-treatment) (Eq. (1)). Using the software application REST the relative calculation procedure was based on the MEAN CP of the experimental groups (Eq. (2)) Ratio ¼
Ratio ¼
ðEtarget Þ ðEref Þ ðEtarget Þ
DCP target ðcontrol sampleÞ DCP ref ðcontrol sampleÞ
ð1Þ
;
DCP target ðMEAN control MEAN sampleÞ
ðEref ÞDCP
ref ðMEAN control MEAN sampleÞ
:
ð2Þ
The expression ratio results were tested for significance by a randomisation test (Pfaffl et al., 2002). The statistical significance of differences in mRNA expression in the investigated samples was calculated by a pair-wise fixed reallocation test. The expression ratio was computed in regard to the untreated control group and was normalized by the individual reference gene. REST also indicates coefficients of variations in percentage mean values for CV (%) and standard deviations based on CPs of the target genes. The expression ratio was determined as mean difference (D) ± SEM of CPs between the control group and the irradiation induced gene expression of target genes.
1683
3.2. Real-time PCR amplification efficiencies and linearity Real-time PCR efficiencies were calculated from the given slopes in the Opticon Monitor software. Transcripts showed real-time PCR efficiency rates from 1.60 to 2.08 in the investigated range from 120 pg to 75 ng cDNA input with high linearity (Pearson coefficient r > 0.95, Table 2). 3.3. Analysis of expression stability of housekeeping genes To determine the most stable reference gene, individual sample descriptive statistics of the derived crossing points were computed for each housekeeping gene. All CP data were compared over the entire study, including control and treatment groups. The BestKeeper software calculated the x-fold over- or under-expression of individual samples towards the geometric mean CP and the multiple factor of their minimal and maximal values, expressed as the x-fold ratio and its standard deviation (Pfaffl et al., 2004) (data not shown). Results of housekeeping gene stability after irradiation with Xrays and heavy ions, respectively, are shown in Table 3. For each of the individual assays a specific housekeeping gene was chosen according to the results obtained form the BestKeeper software. The expression level of HPRT showed no significant changes within the investigated samples of X-irradiated cells and of Ar-ion exposed cells (2 h after exposure). Thus, it was determined to be suitable as a reference gene for these sample groups. For the group of samples investigated 12 h after irradiation with 36 Ar ions, UBC seemed to be the most stably expressed housekeeping gene.
3. Results
3.4. Relative quantification of target gene expression
3.1. Confirmation of primer specificity
On the basis of the mathematical model shown in Eq. (2) the relative expression software tool Rest calculates the relative expression ratios on the basis of group means for target genes (genes of interest) versus a reference gene (housekeeping gene) and tests the group ratio results for significance as shown in Tables 4 and 5. In case of down-regulation, the regulation factor is illustrated as a reciprocal value (1/expression ratio).
Specificity of RT-PCR products was documented with high resolution gel electrophoresis and resulted in single products with the desired length. In addition, a melting curve analysis was performed resulting in single product-specific melting temperatures. After optimisation no primer-dimer formations were observed.
Table 2 qPCR efficiencies and linearity Irradiation condition
G6PDH
HPRT
UBC
GADD45a
GADD45b
RRM2B
CDKN1A
BRCA2
2 h after 95 MeV/amu Ar
E r
1.69 0.992
1.71 0.994
1.90 0.994
1.64 0.977
1.70 0.987
1.65 0.992
1.60 0.989
1.85 0.985
12 h after 95 MeV/amu Ar
E r
1.96 0.996
1.81 0.992
1.94 0.986
1.78 0.993
1.80 0.987
1.76 0.995
1.61 0.994
1.86 0.988
X-rays 4 Gy
E r
2.13 0.974
1.92 0.995
2.04 0.986
1.97 0.981
1.93 0.983
1.97 0.980
2.05 0.964
2.08 0.983
1684
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
Table 3 Results of housekeeping gene stability after irradiation qPCR assay
Housekeeping gene
p-Value
Power of HKG (x-fold)
2 h after 95 MeV/amu Ar
G6PDH HPRT UBC
0.001 0.001 0.001
2.00 1.43 1.91
12 h after 95 MeV/amu Ar
G6PDH
0.001
2.15
HPRT UBC
0.001 0.001
1.82 1.76
G6PDH HPRT UBC
0.001 0.027 0.638
6,32 1.41 1.10
X-rays 4 Gy
3.4.1. Relative changes in mRNA expression due to low LET radiation We have studied the time course of gene expression modulation after irradiation with 4 Gy X-rays (Fig. 1). Gene expression of CDKN1A (p21/WAF) was significantly up-regulated by a factor of 2.2 after 2 h and 4.3 after 4 h post-irradiation. There was a strong and significant up-regulation by a factor of 7.06 for GADD45a-
mRNA expression 2 h after damage-induction. The up-regulation at later time-points with increasing values from 3.2 (4 h post-irradiation) up until 2.1 (48 h postirradiation) was highly significant during the investigated time course except at 12 h. Expression levels of GADD45b showed a moderate, but significant up-regulation 24 h after induction by a factor of 1.6, respectively, by a factor of 1.7 after 48 h. Gene expression of RRM2b was induced by a factor of 3.7 after 2 h and stays on elevated levels from 2.3 (4, 12 and 24 h) to 2.1 (48 h) for the investigated time span, significantly at 2, 12, 48 h. The mRNA expression for BRCA2 showed a time-depended decreasing gene expression profile from 1.22-fold down-regulation at the investigated time point of 2 h to a maximal down-regulation of 4.8-fold at 48 h. Significant down-regulation was found at 12, 24 and 48 h. 3.4.2. Relative changes in mRNA expression due to high LET radiation We have investigated the mRNA expression of the genes of interest 2 and 12 h after exposure to accelerated 95 MeV/amu argon ions (Fig. 2). Among the human
Table 4 Relative gene expression after exposure to accelerated 95 MeV/amu Ar ions normalized against the house-keeping gene of choice Gene of interest
2 h after 95 MeV/amu Ar Fluence
12 h after 95 MeV/amu Ar
Relative expression ratio
p-Value
Relative expression ratio
p-Value
GADD45a
6
1.25 · 10 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
0.688 0.842 0.695 0.246 0.721 n.d.
0.076 0.186 0.056 0.022 0.086 n.d.
1.648 1.367 1.496 2.873 1.848 2.779
0.086 0.209 0.001 0.001 0.001 0.001
GADD45b
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
0.290 0.264 0.187 0.116 0.305 n.d.
0.001 0.081 0.026 0.001 0.073 n.d.
1.099 1.234 0.616 0.973 0.641 0.816
0.563 0.411 0.046 0.893 0.319 0.470
CDKN1A
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
1.791 1.240 0.953 0.343 1.423 n.d.
0.001 0.102 0.623 0.034 0.019 n.d.
1.215 1.385 1.218 1.629 1.590 2.248
0.585 0.225 0.209 0.041 0.012 0.001
RRM2b
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
0.725 0.846 0.598 0.248 1.004 n.d.
0.296 0.278 0.038 0.001 0.804 n.d.
0.866 1.039 1.431 1.458 1.378 1.578
0.594 0.696 0.038 0.131 0.131 0.046
BRCA2
1.25 · 106 2.5 · 106 5 · 106 1 · 107 2 · 107 4 · 107
2.462 1.386 0.838 0.389 1.681 n.d.
0.001 0.198 0.071 0.033 0.001 n.d.
0.741 0.643 0.577 0.350 0.397 0.415
0.201 0.123 0.032 0.001 0.032 0.137
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688 Table 5 Time course of relative gene expression after 4 Gy X-irradiation normalized against the house-keeping gene of choice Gene of interest
Time after irradiation (h)
Relative expression ratio
p-Value
GADD45a
2 4 12 24 48
7.056 3.180 1.281 2.314 2.128
0.001 0.030 0.396 0.001 0.001
GADD45b
2 4 12 24 48
0.697 1.215 1.045 1.632 1.702
0.255 0.732 0.591 0.035 0.001
CDKN1A
2 4 12 24 48
2.189 4.303 0.537 1.097 0.241
0.001 0.001 0.090 0.721 0.229
RRM2b
2 4 12 24 48
3.675 2.301 2.309 2.319 2.070
0.001 0.128 0.001 0.197 0.001
BRCA2
2 4 12 24 48
0.819 0.551 0.495 0.363 0.208
0.143 0.128 0.001 0.034 0.001
1685
expression profile 2 h after exposure to 95 MeV/amu Ar ions of CDKN1A as well as BRCA2 showed no obvious trend of regulation, nevertheless the calculated values showed a high statistical significance. A different tendency of expression level profile was found at the investigated time point of 12 h. The gene expression for CDNK1A showed an increasing tendency from 1.2to 2.2-fold with increasing dose of 95 MeV/amu Ar ions, indicating significance at investigated fluences from 1 · 107 to 4 · 107 P cm2. Also GADD45a, down-regulated 2 h after argon ion exposure, showed a fluencedependent up-regulation from 1.4 to 2.9 at the later time point of gene expression quantification. Four of these expression levels were highly significant. The mRNA expression 12 h after damage induction of RRM2b showed a slight up-regulation up to 1.6-fold at the highest fluence in contrast to the observed down-regulation tendency 2 h after exposure. Two of these expression levels tend to be significant (0.038 < P < 0.046). The observed trend of down-regulation 2 h after exposure to argon ions for GADD45b gene expression was attenuated at the examined time point of 12 h with maximum values of 1.6 (P < 0.05). The mRNA expression of BRCA2 was suppressed to gene expression levels from 1.3- to 2.9-fold due to the graded fluences of argon ions, significantly at 5 · 106, 1 · 107, 2 · 107 P cm2.
4. Discussion radiation-responsive genes investigated three (GADD45a, GADD45b and RRM2b) were shown to be consistently down-regulated by 1.2- to 4-fold at the examined time point 2 h after exposure to argon ion beam. The gene
In radiation-exposed cells, pathways of cellular defence mechanisms in addition to DNA repair are invoked as a response to the DNA damage and include
Fig. 1. Gene expression profile after 4 Gy X-irradiation of five human radiation responsive genes detected by real time RT-PCR. Relative expression ratios were calculated on the basis of group means for target genes versus a housekeeping gene (HPRT). Significances are indicated in relation to the control group P < 0.05; n = 3.
1686
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
Fig. 2. (a) Gene expression profile 2 h after exposure to accelerated 95 MeV/amu argon ions. Changes in mRNA expression of five human radiation responsive genes were detected by real time RT-PCR. Relative expression ratios were calculated on the basis of group means for target genes versus a housekeeping gene (UBC). Significances are indicated in relation to the control group P < 0.05; n = 3. (b) Gene expression profile 12 h after exposure to accelerated 95 MeV/amu argon ions. Changes in mRNA expression of five human radiation responsive genes were detected by real time RT-PCR. Relative expression ratios were calculated on the basis of group means for target genes versus a housekeeping gene (HPRT). Significances are indicated in relation to the control group P < 0.05; n = 3.
the cell cycle and cell-death pathways (Akerman et al., 2005). Many of the defence responses are modulated by the tumour-suppressor gene p53, which serves as a transcriptional regulator in addition to its interactions with other proteins important in these pathways (Morris, 2002; Fei and El-Diery, 2003). p53 mediates cell cycle arrest and apoptosis by binding to DNA and activating the transcription of specific genes. p53 is also
thought to be involved in DNA repair by the transcriptional activation of RRM2b (p53R2), which encodes a modified ribonucleotide reductase that is directly involved in the p53 checkpoint for repair of damaged DNA. In case of genotoxic stress, RRM2b is responsible for the urgent supply of dNTPs in G1 and G2 phases of the cell cycle for DNA repair synthesis. Although RRM2b shows a significant similarity (80%) to the small
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
subunit (RRM2) of ribonucleotide reductase, it can be induced in response to several genotoxic damages, in contrast to the RRM2 subunit which is active during the S-phase of the mitotic cell cycle (Tanaka et al., 2000). After high-LET radiation with accelerated 95 MeV/amu argon ions gene expression for RRM2b was up-regulated, as measured in the kinetic RT-PCR experiment. The same was true after low-LET radiation; however, there were differences between the magnitude and the time course of induction. The induction by argon ions appeared later and reached a lower level. As a key player in genotoxic stress response, p53 participates in the DNA-damage induced G1 arrest by transcriptional induction of CDKN1A (p21/WAF), an inhibitor of cyclin-dependent kinases thereby controlling the entry of cells into S-phase (El-Diery et al., 1993). The p21 family includes the structurally-related proteins p21CIP1/WAF (CDKN1A), p27KIP1 and p57KIP2, all of which inhibit a variety of CDK/cyclin complexes by binding to both cyclin and CDK subunits. In addition to its key role in G1/S arrest, CDKN1A may also play a role in the G2/M checkpoint through a p53dependent mechanism. After DNA damage, many cells appear to enter a sustained arrest in the G2 phase of the cell cycle. Bunz et al. (1998) demonstrated that this arrest could be sustained only when p53 was present in the cell and capable of transcriptionally activating of CDKN1A. After disruption of either the p53 or the CDKN1A gene, c-radiated cells progressed into mitosis and exhibited a G2 DNA content because of a failure of cytokines. Thus, p53 and CDKN1A appear to be essential for maintaining the G2 checkpoint in human cells. In our experiments, CDKN1A shows a time-dependent gene expression with maximum peak 4 h after X-rays and was down-regulated at later time points. As for RRM2b, the gene expression response to accelerated argon ions was slower and weaker compared to X-rays. Growth arrest and DNA damage gene 45 (GADD45), a p53-regulated and stress-inducible gene plays an important role in cellular response to DNA damage. GADD45a (Gadd45), GADD45b (MyD118), and GADD45c (CR6) constitute a family of evolutionarily conserved, small, acidic, nuclear proteins, which have been implicated in terminal differentiation, growth suppression, and apoptosis. How Gadd45 proteins function in negative growth control is not fully understood. Recent evidence has implicated Gadd45a in inhibition of cdc2/cyclinB1 kinase and in G2/M cell cycle arrest whereas Gadd45b and Gadd45g specifically seem to interact with the Cdk1/CyclinB1 complex, both of which are required for IR induced cell cycle regulation and radioresistance (Vairapandi et al., 2002). GADD45b is a TNFa-inducible gene and a physiological target of NFjB (De Smaele et al., 2001). The genes in this group respond to environmental stresses by mediating activation of the p38/JNK pathway. This activation is medi-
1687
ated via their proteins binding and activating MTK1/ MEKK4 kinase, which is an upstream activator of both p38 and JNK MAPKs. JNK is crucial to programmed cell death. GADD45a showed the highest induction 2 h after irradiation with X-rays. After exposure to argon ions the gene expression of GADD45a displays a delayed reaction in comparison to X-radiation at the investigated time points. The gene expression profile for GADD45b after induction of cell damage showed a late response 24 h after irradiation on a moderate level. After argon ion exposure, the gene showed an early down-regulation which attenuates at the later time point. BRCA2 is thought to be an essential cofactor in the Rad51-dependent DNA repair of double-strand breaks (Sharan et al., 1997). BRCA1 and BRCA2 participate together in a pathway (or pathways) associated with the activation of double-strand break repair and/or homologous recombination. BRCA2 mRNA and protein levels were shown to be down-regulated in breast cancer cell lines in response to specific DNA-damaging agents, but the mechanism by which this occurs is not completely understood. It was shown, that in response to Adriamycin-associated DNA damage p53 mediates repression of the BRCA2 promotor (Wu et al., 2003). The underlying mechanism of BRCA2 down-regulation after exposure to other DNA-damaging agents such as UV-irradiation and c-irradiation is unknown. The gene expression profile for BRCA2 in the kinetic RT-PCR assay after X-irradiation displays a clear down-regulation. The response to argon ions is inconsistent, showing at the early time point of investigation an up-regulation followed by a distinct down-regulation at the later time point. Interestingly, some of the DNA repair genes appear to be up-regulated during post-irradiation incubation in spite of the fact that most of the DNA damage is already repaired. This shows that some gene expression patterns reflect part of the regulatory network of the overall cellular radiation response. Comparing the tendency of gene expression pattern we observed differences in the magnitude of induction of the investigated radiation-responsive genes after high LET radiation and low LET radiation. The results are highly suggestive that the response to the clustered damage and high complex DNA lesions induced by densely ionizing radiation differs from the cellular reaction induced by low LET irradiation and that these clustered damages appear more difficult to repair. Even though the data reported above cannot be considered complete and/or definitive, nevertheless, in whole, they confirm that the chosen method of qRTPCR may constitute a suitable model system to study, at molecular level, the effects of cosmic radiation. In addition, ongoing experiments are identifying large numbers of potential human-radiation responsive
1688
A. Arenz et al. / Advances in Space Research 36 (2005) 1680–1688
genes using micro-array hybridization and various irradiation protocols including expression at different times after exposure to low- and high-LET radiation.
Acknowledgements This work was initially supported by the German Academy of Aviation and Travel Medicine (Deutsche Akademie fu¨r Flug- und Reisemedizin). The authors would like to thank Isabelle Testard and Hermann Rothard from the Centre Interdisciplinaire de Recherche Ions Lourds (CIRIL, Caen, France) for valuable advice and many help given during numerous night shifts at the French Heavy Ion Accelerator GANIL.
References Akerman, G.S., Rosenzweig, B.A., Domon, O.E., et al. Alterations in gene expression profiles and the DNA-damage response in ionizing radiation exposed TK6 cell. Environ. Mol. Mutagen. 45, 188–205, 2005. Amundson, S.A., Bittner, M., Meltzer, P., et al. Induction of gene expression as a monitor of exposure to ionizing radiation. Radiat. Res. 156, 657–661, 2001. Bunz, F., Dutriaux, A., et al. Requirement for p53 and p21 to sustain G2 arrest after DNA damage. Science 282, 1497–1501, 1998. Chen, J., Silver, D.P., Walpita, D. Stable interaction between the products of the BRCA1 and BRCA2 tumor suppressor genes in mitotic and meiotic cells. Molec. Cell 2, 317–328, 1998. De Smaele, E., Zazzeroni, F., Papa, S., et al. Induction of gadd45 beta by NF-kappa-B downregulates pro-apoptotic JNK signaling. Nature 414, 308–313, 2001. El-Diery, W.S., Tokino, T., Velculisci, V.E., et al. WAF1, a potential mediator of 53 tumour suppression. Cell 75, 817–825, 1993. Fei, P., El-Diery, W.S. p53 and radiation responses. Oncogene 22, 5774–5783, 2003. Horneck, G., Facius, R., Reichert, M., et al. HUMEX, a study on the survivability and adaptation of humans to long-duration exploratory missions, part I: lunar missions. Adv. Space Res. 31 (11), 2389–2401, 2003a. Horneck, G., Facius, R., Reichert, M., et al. HUMEX, a study on the survivability and adaptation of humans to long-duration exploratory missions ESA SP-1264, 2003b. Iliakis, G., Wang, Y., Guan, J., et al. DNA damage checkpoint control in cells exposed to ionizing radiation. Oncogene 22, 5834–5847, 2003. Jackson, S.P. Sensing and repairing DNA double-strand breaks. Carcinogenesis 23, 687–696, 2002.
Jakel, O. Radiation hazard during a manned mission to Mars. Z. Med. Phys. 14 (4), 267–272, 2004. Morris, S.M. A role for p53 in the frequency and mechanism of mutation. Mutat. Res. 511, 45–62, 2002. Pfaffl, M.W., Horgan, G.W., Dempfle, L. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36, 2002. Pfaffl, M.W., Tichopad, A., Prgomet, C., et al. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper-Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515, 2004. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45, 2001. Rasmussen, R. Quantification on the LightCycler. in: Meuer, S., Wittwer, C., Nakagawara, K. (Eds.), Rapid Cycle Real Time PCR: Methods and Applications. Springer, Heidelberg, pp. 21– 34, 2001. Redpath, J.L. Radiation-induced neoplastic transformation in vitro: evidence for a protective effect at low doses of low LET radiation. Cancer Metast. Rev. 23, 333–339, 2004. Serazin-Leroy, V., Denis-Henriot, D., Morot, M., et al. Semi-quantitative RT-PCR for comparison of mRNAs in cells with different amounts of housekeeping gene transcripts. Mol. Cell. Probes 12, 283–291, 1998. Sharan, S.K., Morimatsu, M., Albrecht, U., et al. Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2. Nature 386, 804–810, 1997. Suzuki, T., Higgins, P.J., Crawford, D.R. Control selection for RNA quantitation. Biotechniques 29, 332–337, 2000. Tanaka, H., Arakawa, H., Yamaguchi, T., et al. A ribonucleotide reductase gene involved in a p53-dependent cell-cycle checkpoint for DNA damage. Nature 404, 42–49, 2000. Thellin, O., Zorzi, W., Lakaye, B., et al. Housekeeping genes as internal standards: use and limits. J. Biotechnol. 75, 291–295, 1999. Vairapandi, M., Balliet, A.G., Hoffman, B., et al. GADD45b and GADD45g are cdc2/cyclinB1 kinase inhibitors with a role in S and G2/M cell cycle checkpoints induced by genotoxic stress. J. Cell. Physiol. 192, 327–338, 2002. Vandesompele, J., De Preter, K., Pattyn, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3(7): research 0034.1research 0034.11, 2002. Woloschak, G.E., Chang-Liu, C.M. Differential modulation of specific gene expression following high- and low-LET radiations. Radiat. Res. 124, 183–187, 1990. Wu, K., Jiang, S.W., Couch, F.J. p53 mediates repression of the BRCA2 promoter and down-regulation of BRCA2 mRNA and protein levels in response to DNA damage. J. Biol. Chem. 278, 15652–15660, 2003. Wulf, H.W., Kraft-Weyrather, H.G., Miltenburger, E.A., et al. Heavy ions effects on mammalian cells inactivation measurements with different cell lines. Radiat. Res. Suppl. 8, S122–S134, 1985.