- Email: [email protected]
An APETALA1-like gene of soybean regulates flowering time and specifies floral organs
Journal of Plant Physiology 168 (2011) 2251–2259
Contents lists available at SciVerse ScienceDirect
Journal of Plant Physiology journal homepage: www.elsevier.de/jplph
An APETALA1-like gene of soybean regulates flowering time and specifies floral organs Yingjun Chi, Fang Huang, Haicui Liu, Shouping Yang, Deyue Yu ∗ National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Nanjing Agricultural University, Weigang No. 1, Nanjing 210095, China
a r t i c l e
i n f o
Article history: Received 13 April 2011 Received in revised form 4 August 2011 Accepted 5 August 2011 Keywords: APETALA1 Floral organs Flowering time MADS-box transcription factor Soybean
a b s t r a c t MADS-box proteins are key transcription factors involved in plant reproductive development. APETALA1 (AP1) in Arabidopsis is a MIKC-type MADS-box gene and plays important roles in flower development. In this research, we isolated and characterized GmAP1, which encoded an AP1-like protein in soybean. GmAP1 contained eight exons and seven introns and was specifically expressed in the flower, especially in the sepal and petal. GmAP1 was a nucleus-localized transcription factor and displayed transactivation activity. It caused early flowering and alteration of floral organs when ectopically expressed in tobacco. To our knowledge, this is the first report characterizing an AP1-like gene from soybean. © 2011 Elsevier GmbH. All rights reserved.
Introduction Vegetative and floral developments are the key developmental processes in flowering plants that determine the overall structure of plants. The transition between the two phases is controlled by complicated regulatory pathways that respond to different environmental and endogenous signals. In the model species Arabidopsis thaliana, many genes have been identified that are responsible for the transition to flowering. It was reported that several genes, namely GIGANTEA (GI), CONSTANS (CO) and FLOWER LOCUS T (FT), were circadian-regulated and promoted flowering; FLOWERING LOCUS C (FLC) is a repressor of flowering and is negatively regulated by vernalization (Li et al., 2008). Most angiosperm flowers are composed of four types of organs arranged in concentric whorls: sepals, petals, stamens and carpels. The identities of the floral organs are specified by groups of genes. Based on analysis of homeotic floral mutants in Arabidopsis, Petunia hybrida and Antirrhinum majus, the ABCDE model was proposed to demonstrate how five classes of genes work together to specify floral organ identities (Theissen and Saedler, 2001). A (APETALA1, AP1; APETALA2, AP2) alone determines sepals; A and B (APETALA3, AP3; PISTILLATA, PI) together specify petals; B and C (AGAMOUS, AG)
Abbreviations: 3-AT, 3-amino-triazole; DAF, days after flowering; EST, expressed sequence tag; gDNA, genomic DNA; ORF, open reading frame; RT-PCR, reverse transcriptase polymerase chain reaction; SAM, shoot apical meristem. ∗ Corresponding author. Tel.: +86 25 8439 6410; fax: +86 25 8439 6410. E-mail address: [email protected] (D. Yu). 0176-1617/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.jplph.2011.08.007
specify stamens; C alone determines carpels; D (SHATTERPROOF1/2, SHP1/2) specifies the ovule; and E class genes (SEPALLATA1/2/3/4, SEP1/2/3/4) determine the identities of all four whorls of floral organs. Except for AP2, all of these genes encode proteins with high similarities and belong to the MIKC-type MADS-box gene family. MADS-box transcription factors regulate a diverse range of developmental procedures in eukaryotes. MIKC-type MADS-box genes belong to the group only found in plants and were named after four conserved domains that exist in those proteins: MADS domain, Intervening (I) domain, Keratin (K) domain and C-terminal domain (Gramzow and Theissen, 2010). The MADS domain is highly conserved and is a DNA-binding domain that binds to consensus sequences known as CArG box [CC(A/T)6 GG]. The I domain is more diverse in sequence and structure, while the K domain is conserved and characterized by a coiled-coil structure. These two domains are involved in protein–protein interactions. The C-terminal domain is the least conserved and likely to be involved in transactivation. MIKC-type genes are well characterized and are recognized to have roles in plant development and signal transduction. AP1 is a MIKC-type MADS-box factor. It appears to establish floral meristem identity by regulation of genes that are related to phase transition and flower initiation (Mandel et al., 1992; Kaufmann et al., 2010). AP1 belongs to the A class in the ABCDE model, and also orchestrates the formation of floral primordia by regulation of genes involved in organ growth and patterning (Kaufmann et al., 2010). Mutation in AP1 of Arabidopsis causes partial flower transformation into inflorescence shoots with alterations in sepal and petal identities (Bowman et al., 1993). In contrast, constitutive expression of AP1 or its orthologues in
2252
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Arabidopsis usually cause early flowering and conversion of inflorescence to the terminal flower (Mandel and Yanofsky, 1995). If controlling expression of AP1-like genes is able to control flowering time and alter floral organ identity in other species, it might produce valuable phenotypic changes that would be used for crop improvement. Soybean is one of the most economically important crops, as it is a major source of vegetable oil and protein. Reproductive growth directly affects seed yield and quality. Therefore, to unravel the genetic mechanisms underlying the regulation of flower development is of great significance to improve soybean production. In this study, we isolated an AP1-like gene, GmAP1, from soybean and characterized its expression pattern. As a transcription activator, GmAP1 promoted flowering time and determined floral organ formation when overexpressed in tobacco.
Materials and methods Plant materials and growth conditions Seeds of soybean (Glycine max (L.) Merr. cv. Jackson) were provided by the National Center for Soybean Improvement, China. The seeds were germinated and grown in the experimental field of Nanjing Agricultural University, Nanjing, China. Leaves, roots and stems were collected at the third euphyll expanding stage. Seeds and pods were harvested at 25 days after flowering (DAF). Flowers at different developmental stages were collected. Four types of floral organs, namely sepals, petals, stamens and carpels, were collected from mature flowers. All samples were frozen in liquid nitrogen and stored at −80 ◦ C until analysis. Tobacco (Nicotiana tabacum cv. SamSun), both transgenic and wild-type plants, were grown in a growth room at 25 ◦ C under a 16 h light/8 h dark photoperiod.
RNA isolation and first-strand cDNA synthesis Total RNA was isolated using an RNA Plant Extraction Kit (TIANGEN, China) and treated with RNase-free DNase I (Takara, Japan) to remove contamination by genomic DNA (gDNA). About 2 g of purified total RNA was reverse-transcribed by AMV reverse transcriptase (Takara) using oligo(dT)18 as primer (Takara) following the manufacturer’s instructions.
Full-length cDNA cloning of GmAP1 The full-length cDNA of GmAP1 was amplified from flower cDNA with the following primers (sense: 5 -ATGGGAAGGGGTAGGGTT3 ; anti-sense: 5 -TGTCAAATGCCATACCAAAGC-3 ). Similarly, the full-length gDNA of GmAP1 was amplified from leaves. All PCR products were gel-purified (Axygen, USA) and cloned into the pGEM® -T easy vector (Promega, USA) followed by sequencing (Invitrogen, China).
Sequence and phylogenetic analysis Conserved domains were searched with SMART (http://smart.embl-heidelberg.de/). Sequences of published MADS-box genes were obtained from the NCBI databases (http://www.ncbi.nlm.nih.gov/). Multiple alignment of the sequences was conducted with Clustal X 2.0 and viewed with GeneDOC. A phylogenetic tree was constructed by MEGA 4 using the neighbor-joining method.
DNA gel blot analysis Genomic DNA was extracted from leaves using the CTAB method and digested with EcoRI or XbaI (Takara) at 37 ◦ C for 16 h. The digested DNA was separated on a 0.8% (w/v) agarose gel and transferred onto a Hybond N+ nylon membrane (Roche, Germany) by capillary transfer (Reed and Mann, 1985). A fragment encoding the C-terminus of GmAP1 was amplified and used as a probe. The probe-labeling, hybridization and detection procedures were performed using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Germany) according to the manufacturer’s instructions.
Gene expression analysis Real-time PCR was carried out with the iQ5 real-time PCR system (BIO-RAD, USA) using the SYBR® Green Realtime PCR Master Mix (Toyobo, Japan). Relative expression levels were normalized using tubulin (GenBank accession no. AY907703) as an internal control. Primers used were as follows: TubF (5 -GGAGTTCACAGAGGCAGAG-3 ) TubR (5 -CACTTACGCATCACATAGCA-3 ) for tubulin, and GmAP1F (5 -ATGATTCCGAGTCACAGGGAA-3 ) and GmAP1R (5 -TGTCAAATGCCATACCAAAGC-3 ) for GmAP1. The PCR amplification protocol was 95 ◦ C for 1 min, followed by 45 cycles at 95 ◦ C for 15 s, 60 ◦ C for 15 s and at 72 ◦ C for 45 s, with a final extension at 72 ◦ C for 10 min. The relative expression of GmAP1 was calculated according to the 2−Ct method (Livak and Schmittgen, 2001). The threshold cycle (Ct) values were the means of two replicate independent PCRs. RNA in situ hybridization was performed on longitudinal sections of the soybean apical inflorescence as previously described (Coen et al., 1990). RNA antisense and sense probes were generated from a 300 bp fragment in the 3 region of the GmAP1 cDNA, and were labeled with digoxigenin.
Subcellular localization of the GmAP1–GFP fusion protein The WoLF PSORT Prediction (http://wolfpsort.org) was employed to predict the subcellular localization of GmAP1. The GmAP1 open reading frame (ORF) without the stop codon was inserted into the BamHI–XbaI sites of pBI121-GFP vector (Clontech, USA), resulting in translational GFP fusion at the C-terminus of GmAP1. This construct was transferred into onion epidermal cells by Agrobacterium tumefaciens strain EHA105 (Sun et al., 2007). Cells harboring the empty pBI121-GFP vector (35S:GFP) were used as a control. The GFP signals were monitored under a confocal spectral microscope (Leica CP SP2, Germany).
Transcriptional activities assay The GAL4 DNA-binding domain vector, pBD-GAL4 Cam (Stratagene, USA), was used for transcriptional activities analysis. The entire coding region of GmAP1 was inserted into the EcoRI–SalI sites of the vector. This construct was introduced into the yeast YRG-2 strain, which contained the His3 reporter gene in the genome. The transactivation activities were evaluated according to the growth status of these cells on the synthetic defined medium lacking histidine (SD/−His + 10 mM 3-AT). The pBD-GAL4 Cam empty vector (pBD-GAL4) and pGAL4 (Stratagene, USA) were transformed into yeast cells, and the transformants were streaked on plates, as negative and positive controls, respectively.
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 1. Organization of GmAP1 in the soybean genome. (A) Schematic diagram of the gene structure of GmAP1 and its putative orthologues in Arabidopsis thaliana (AP1), Antirrhinum majus (SQUA), Medicago truncatula (MtPIM) and Pisum sativum (PEAM4). Positions of exons (boxes) and introns (lines) are shown. The dashed arrow indicates the position of the probe used for DNA gel blot analysis. (B) DNA gel blot analysis of GmAP1 in the soybean genome. Genomic DNA was digested with EcoRI and XbaI, respectively. A molecular weight marker is indicated on the left.
Ectopic expression in tobacco The GmAP1 ORF was amplified with the following primers (F: 5 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGAAGGGGTAGG GTTCAGCTGA-3 ; R: 5 -GGGGACCACTTTGTACAAGAAAGCTGGGTCT CAAAAGCATCCAAGGTGACAGGAA-3 ) flanked with the attB1 and attB2 sites, respectively. The PCR product was introduced into the pDONR221 vector using the GatewayTM BP clonase (Invitrogen, USA), and subsequently integrated into pMDC32 using LR clonase (Invitrogen, USA). The resultant construct, pMDC32-GmAP1, was introduced into A. tumefaciens via the freeze–thaw method and used to transform tobacco by the leaf disc transformation method (Horsch et al., 1985). Transgenic plants were selected on Murashige and Skoog medium containing hygromycin B. Results Isolation and sequence analysis of AP1-like gene from soybean Based on analysis of microarray and real-time PCR data, we previously identified 12 MADS-box genes involved in soybean flower development (Huang et al., 2009). Among these genes, an AP1like gene (Gma.16141.1.A1 at) was chosen for further study, herein named GmAP1. A 763 bp cDNA clone that included a full-length open reading frame (ORF) was obtained for GmAP1 from flower cDNA (Supplementary file 1). We cloned the genomic fragment of GmAP1 with a full length of 5.7 kb. Alignment of the cDNA with the genomic sequence revealed that eight exons and seven introns were present in GmAP1 (Fig. 1A). The distribution of exons in GmAP1 coincided with that of AP1 in Arabidopsis, SQUA in Antirrhinum, MtPIM in Medicago truncatula and PEAM4 in Pisum sativum (Fig. 1A). It is intriguing that the exons at the same position were of identical size between AP1-like genes in these four species, except for the last two exons. In contrast, the introns were more variable in sequence and length, which resulted in different gene lengths. A Blast search of the soybean genomic DNA (gDNA) database (http://www.phytozome.net), using the ORF of GmAP1 as the query sequence, found that GmAP1 is located on chromosome 16 and was identical to the gene with the locus tag Glyma16g13070.1. However, comparison of our cloned genomic sequence of GmAP1 with
2253
that in the soybean genome database indicated that nucleotide differences existed between GmAP1 and Glyma16g13070.1 in introns, although the exon sequences were identical. These differences could reflect variation among cultivars. DNA hybridization was performed to further study the organization of GmAP1 in the soybean genome. Because the 3 genomic fragments of AP1-like genes were divergent, a fragment amplified from this region of GmAP1 was used as a specific probe (Fig. 1A). One band was detected in both of two digestions (Fig. 1B). These results indicated that GmAP1 is a single-copy gene in the soybean genome. GmAP1 consisted of 236 amino acids. Sequence comparison showed that GmAP1 is similar to other AP1-like proteins. GmAP1 shared 92% identity with MtPIM (Medicago), 70% identity with AP1 (Arabidopsis) and 73% identity with SQUA (Antirrhinum). GmAP1 contained the conserved domains that characterize MADS-box proteins (Fig. 2). The typical MIKC-type MADS domain was located at the N-terminus from 1 to 60 aa. A highly conserved K domain is located from 75 to 174 aa. An I domain was located between the MADS domain and K domain. The C-terminal region contained an euAP1-motif (Litt and Irish, 2003). In addition, one LxLxL type of ERF-associated amphiphilic repression (EAR) motif was recognized in the C-terminus (Fig. 2). This motif is distinct for negative transcriptional regulation (Kagale et al., 2010). Interestingly, GmAP1 lacked the prenylation motif (CFAA) that is present at the Cterminus of AP1 orthologues (Berbel et al., 2001). The phylogenetic tree indicated GmAP1 grouped together with AP1/FUL/CAL in Arabidopsis and belonged to the A class in the ABCDE model (Fig. 3). GmAP1 is most similar to AP1 orthologues in other legumes, such as Lotus japonicus, Medicago and Pisum. Expression patterns of GmAP1 during reproductive growth In order to examine the expression patterns of GmAP1, we performed quantitative real-time PCR analysis. GmAP1 was specifically expressed in the flower, and not in the root, stem, leaf, pod and seed (Fig. 4A). Fig. 4C shows that GmAP1 was expressed throughout flower development, with the highest expression occurring at the stage in which the sepals elongated. GmAP1 showed expression in both sepals and petals (Fig. 4B), but not in stamens and carpels. The transcript abundance in sepals was about nine-fold higher than that in petals. GmAP1 transcription was not detected in either seeds on seven different time-points after flowering (15, 20, 25, 35, 40, 45 and 50 days after flowering (DAF)) or seed organs including the seed coat, cotyledons and embryo (data not shown). RNA in situ hybridization analysis was also carried out with both GmAP1 sense and antisense probes to investigate gene expression. GmAP1 transcripts accumulated at the early stage of meristem differentiation (Fig. 5). GmAP1 transcription was detected in both the apical inflorescence meristem and lateral floral meristems of soybean, whereas no signal was detected in young developing seeds (5 and 8 DAF) (data not shown). Subcellular localization GmAP1 contained the putative conserved bipartite NLS consensus sequence in the MADS domain (Fig. 2) (Immink et al., 2002). Based on this finding, GmAP1 was predicted to be localized in the nucleus. In order to determine the localization of GmAP1 in vivo, the coding region of GmAP1 was fused with GFP under the control of the cauliflower mosaic virus (CaMV) 35S promoter and transiently expressed in onion epidermal cells. Confocal imaging of GFP fluorescence revealed that the GmAP1–GFP fusion protein was localized in the nucleus, whereas the control construct, 35S:GFP, was distributed throughout the whole cell (Fig. 6).
2254
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 2. Clustal X alignment of the deduced amino acid sequence of GmAP1 and other AP1 orthologues from Lotus japonicus: LjAP1a (AAX13296), Medicago truncatula: MtPIM (AAZ67068), Pisum sativum: PEAM4 (CAC35027), Arabidopsis thaliana: AP1 (CAA78909) and Antirrhinum majus: SQUA (CAA45228). The highly conserved region, MADS domain, K domain and euAP1-like motif, are underlined. The bipartite NLS is double-underlined. The box indicates the CaaX prenylation motif (CFAA) in AP1 and SQUA. marks the consensus sequence of the EAR motif.
Fig. 3. Phylogenetic relationships of ABCDE class proteins in Arabidopsis and AP1-like proteins in Antirrhinum majus (SQUA) and legume species (GmAP1, LjAP1a, LjAP1b, MtPIM and PEAM4). A phylogenetic tree was generated from the putative amino acid sequences by MEGA 4 using the neighbor-joining method. Numbers below branches indicate bootstrap support percentages from 1000 replicates. AGL63 was used as an outgroup.
GmAP1 exhibits transactivation activity GmAP1 contains the euAP1-motif, which confers protein transactivation ability (Litt and Irish, 2003). To test whether GmAP1 showed transactivation activity, a yeast hybrid assay was performed. The coding region of GmAP1 was cloned into the GAL4 DNA-binding domain vector to generate pBD-GmAP1. This plasmid was introduced into yeast strain YRG-2. The transformants
were tested for activation of the His3 selectable marker. The yeast cells containing pBD-GAL4 (the negative control) did not grow well on the selective medium of SD/−His + 10 mM 3-amino-triazole (3-AT) compared with on medium of YPAD (Fig. 7). However, the yeast cells containing pBD-GmAP1 or pGAL4 (the positive control) showed good growth on the same selective medium (Fig. 7), which indicated that GmAP1 showed transactivation ability.
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
2255
Fig. 4. Real-time PCR analysis of GmAP1 expression in different organs and at different developmental stages. (A) Gene expression profile of GmAP1 in vegetative organs, flower, pod and seed. (B) Expression profile of GmAP1 in floral organs. (C) Expression profile of GmAP1 in developing flowers at four developmental stages (1–4). The four developmental stages are illustrated in (D).
Fig. 5. RNA in situ hybridization of GmAP1 in the soybean apical inflorescence. (A) Longitudinal section hybridized with sense GmAP1 probe, as a negative control. No signal was detected. (B) Hybridization of antisense GmAP1 probe showed gene expression in the inflorescence meristem (im) and floral meristem (fm). (C) High-power magnification of the floral meristem (highlighted with a white box in B). GmAP1 transcripts accumulated in the region of primordia that will give rise to petals and sepals. Scale bars: 100 m.
Overexpression of GmAP1 in tobacco altered flowering time and flower morphology To gain further insight into the function of GmAP1, we chose a gain-of-function approach to characterize GmAP1. The cDNA of GmAP1 was transferred to tobacco under the control of the CaMV 35S promoter. Eight independent transgenic lines were selected for analysis. Compared with wild-type plants, all lines showed an early-flowering phenotype in both the T0 and T1 generations under a long-day photoperiod (LD) (Fig. 8A–C). The flowering time was evaluated by counting the number of leaves produced until flowering. The transgenic lines produced on average 27 leaves prior to the onset of flowering, whereas wild-type plants produced approximately 36 leaves (Fig. 9A). In addition, the height of transgenic plants was reduced (Fig. 9B). In contrast to wild-type plants (Fig. 8D), new leaves were observed in the leaf axils (Fig. 8E) and lateral inflorescences developed in the axils of the upper leaves while the terminal inflorescence was blooming (Fig. 8F) in
transgenic tobacco. Most lateral inflorescences developed normally and bore flowers. In three out of eight transgenic lines, the lateral inflorescences carried a defective terminal flower, which only had sepals and did not flower normally (Fig. 8F). Although the floral morphology frequently resembled that of wild-type flowers, some organ alterations were also observed in 35S::GmAP1 transgenic plants. One of the stamens was converted to a petal-like structure in two lines (Fig. 10B). An additional stamen-like structure was observed on a normal petal of one flower in one line (Fig. 10C). The configuration of petals and sepals was changed with four units present in each whorl (Fig. 10D–F). No phenotypic alteration in the fruits and seeds was observed. Discussion GmAP1 contains eight exons and seven introns and is a singlecopy gene in the soybean genome. Comparison of the exon–intron
2256
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 6. Subcellular localization of GmAP1. GmAP1–GFP fusion proteins were transiently expressed in onion epidermal cells (A–C). 35S:GFP was used as a control (D–F). Photographs were taken with a confocal microscope. A and D are bright field images; B and E are fluorescent images of GFP; C and F are merged images. The arrow shows the location of GmAP1. Scale bars: 100 m.
Fig. 7. Assay of GmAP1 transcriptional activity. (A) Schematic diagram of His reporter gene expression activated by GmAP1 in a yeast cell. UAS represents upstream activating sequences; GAL4-BD represents the binding domain of GAL4; the arrow indicates the direction of His gene expression. (B–D) Yeast cells YRG-2 were transformed by pBDGmAP1, pGAL4 (positive control) and pBD-GAL4 (negative control), respectively. The transformants were streaked on YPAD and selective medium (SD/−His + 10 mM 3-AT) for examination of growth. (D) A sketch panel indicating the position of each yeast strain.
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
2257
Fig. 8. Phenotypic analysis of transgenic tobacco ectopically expressing GmAP1. (A) The 35S::GmAP1 plant (left) flowered after producing about 15 leaves under long-day (LD) conditions, whereas the wild-type plant (right) was still in the vegetative growth stage. (B) Wild-type tobacco (right) started flowering after producing 33 leaves under LD conditions, whereas the transgenic plant had already produced seeds (left). The transgenic plant was dwarfed as a result of the early onset of flowering. (C) Example of extremely early flowering, showing a transgenic plant with nine leaves and dramatic dwarfism. (D–F) Compared with the wild-type plant (D), additional leaves developed in the leaf axils of transgenic plants (E). A lateral inflorescence (F) was produced at the nodes below the terminal inflorescence, some of which developed a defective terminal flower bud.
Fig. 9. Effects of GmAP1 overexpression on aerial architecture of plants. (A) Comparison of leaf number produced by transgenic (35S::GmAP1) and wild-type (WT) plants before flowering. (B) Comparison of plant height between transgenic (35S::GmAP1) and wild-type (WT) plants. Values correspond to the average number of total leaves or height of aerial parts (n = 8). Error bars represent the standard deviation. An asterisk indicates a significant difference (P < 0.001) between transgenic and wild-type plants.
structure of GmAP1 with other AP1 orthologues shows that they have the same number of exons and introns, whereas the fulllength cDNAs are largely different because of the divergent length of introns. The length of each exon is highly conserved. These results
indicate that mutations in the introns might distinguish divergent AP1-like genes in different cultivars and species. The nuclear localization of GmAP1 was determined by fusion of GmAP1 with GFP. GmAP1 contains the MADS and K domains and
2258
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 10. Flower morphology of 35S::GmAP1 plants. (A) and (G) The normal morphology of a wild-type flower (A) and sepals (G). (B) Petal-like stamens were observed in plants that flowered extremely early. (C) A stamen-like petal was produced on the normal petal of flower of a 35S::GmAP1 plant. (D–F) The configurations of both petals and sepals were altered.
shows high identities with AP1 orthologues in Medicago and Lotus (Dong et al., 2005). It is well known that the C-terminal domains of plant MADS-box proteins are variable, but the euAP1-like motif is well characterized within AP1-like proteins. The euAP1-like sequences contain two conserved motifs: a transcription activation domain, RRNaLaLT/NLa, and a farnesylation motif, CaaX (Litt and Irish, 2003). As already described for PIM, MtPIM and LjAP1, the farnesylation motif is absent in GmAP1. This finding supports the hypothesis that this kind of posttranslational modification is not essential for AP1 function in legumes (Berbel et al., 2001; Benlloch et al., 2006). All bioinformatic analyses indicated that GmAP1 is a MADS-box transcription factor. It is very likely that GmAP1 is expressed during reproductive development. Our previous results showed that GmAP1 is exclusively expressed in the flower (Huang et al., 2009). To analyze the expression pattern in greater detail, more samples were collected and monitored by quantitative real-time PCR. We found that GmAP1 was only expressed in the flower and was not detected in other tissues examined, even in other reproductive organs such as the seed. During flower development, expression was observed early in flower bud development and was maintained until flower maturity. In the mature flower, expression of GmAP1 was restricted to the sepals and petals. RNA in situ hybridization analysis indicated that the expression of GmAP1 was initiated early in flower development. GmAP1 was detectable in the outer region of the inflorescence meristem, indicating that GmAP1 might be involved in floral meristem identity. Subsequently, GmAP1 transcripts strongly accumulated in the floral meristem. We further speculate that GmAP1 has a role in initiation of floral primordia and determines their identities. It is well known that AP1-like genes act as important regulators in the floral transition and determination of sepal and petal identities. Thus, we predict that GmAP1 might
play a role in determination of flowering time and floral organ identity. GmAP1 contains a transcription activation domain and displays transactivation ability in a yeast hybrid assay. Consistent with a role as a transcriptional factor, GmAP1 is localized in the nucleus. AP1 in Arabidopsis activates regulatory genes required for floral organ formation, but acts predominantly as a transcriptional repressor during the earliest stages of flower development (Kaufmann et al., 2010). Although the exact mechanism by which AP1 mediates the inhibition of gene expression is currently unknown, available evidence indicates involvement of an interaction between AP1 and other factors. The EAR-motif mediates the recruitment of protein complexes to confer repression of target genes (Kagale et al., 2010). Therefore, it is possible that the EAR-motif at the C-terminus of GmAP1 might allow transcriptional down-regulation of target genes during flower initiation (Fig. 2). Further research is required to identify the target genes of GmAP1 and analyze their expression. The in planta function of GmAP1 was demonstrated by expression in tobacco. The 35S::GmAP1 transgenic lines exhibited early flowering under LD conditions in comparison with wild-type plants. Concomitantly, the transgenic lines displayed a dwarf phenotype that is the result of transition to reproductive growth early in development. This finding was consistent with ectopic overexpression of AP1-like genes in other species (Berbel et al., 2001; Lin et al., 2009), which indicates AP1-like genes are functionally conserved as a floral promoter in plants. Overexpression of GmAP1 in tobacco induced development of leaves in leaf axils and lateral inflorescences developed in the axils around the terminal inflorescence. Some lateral inflorescences developed a defective terminal flower. These phenotypes could
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
have arisen because GmAP1 overexpression induced abnormal meristem development and suggest GmAP1 has a critical role in determination of floral meristem identity. Previous studies showed that AP1 alone can convert inflorescence meristems into floral meristems and cause a terminal flower-like phenotype when ectopically expressed in Arabidopsis (Mandel and Yanofsky, 1995). Many AP1-like genes from different species have been functionally characterized and are known to cause early flowering in plants. However, their phenotypic effects on floral organs differ between species. AP1 can specify Arabidopsis sepal and petal identities, and ap1 mutants exhibit conversion of sepals to bract-like structures (Irish and Sussex, 1990). PEAM4, which is an AP1 functional homologue in pea, is able to restore perianth organ identity in ap1-1 Arabidopsis mutants. The flowers of 35S::PEAM4 transgenic Arabidopsis and tobacco were indistinguishable from those of wild-type plants (Berbel et al., 2001). Expression of an AP1like gene from apple in Arabidopsis caused abnormal floral organ development and reduced fertility (Kotoda et al., 2002). Ectopic expression of an AP1-like gene from lily, LMADS5, caused homeotic conversion of sepals into carpel-like structures and petals into stamen-like structures in one transgenic Arabidopsis plant (Chen et al., 2008). In the present study, ectopic expression of GmAP1 induced alteration of stamens to a petal-like structure and abnormal perianth features in transgenic tobacco plants, indicating that GmAP1 functions in establishment of floral organ identity as an ABCDE-type MADS-box gene. Our data provides evidence that AP1-like genes are able to alter floral organ identity. However, further research is needed to clarify the functional conservation of AP1-like genes in floral organ specification in a variety of plant species. In conclusion, GmAP1 is a nuclear-localized transcription activator. Ectopic expression of GmAP1 causes alteration in flowering time, floral meristem identity and floral organ specification. Our research provides the first insight into the roles of GmAP1. Further work involving GmAP1 mutants and overexpression lines will lead to an improved understanding of the function of GmAP1 in reproductive growth during the soybean life cycle. Acknowledgments We thank Dr. Jun Yang (Chinese Academy of Sciences, Shanghai) for helping with in situ hybridization and Dr. Ji Huang (Nanjing Agricultural University, China) for valuable suggestions. We thank Dr. Weihua Chen (The Australian National University, Australia) for revising the manuscript. This work was supported by the National Basic Research Program of China (973 Program) (2010CB125906, 2009CB118400), National Natural Science Foundation of China (30800692, 31000718) and Jiangsu Provincial Natural Science Foundation (BK2008334). The two anonymous reviewers are thanked for their highly valuable comments and suggestions.
2259
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jplph.2011.08.007. References Benlloch, d’Erfurth I, Ferrandiz C, Cosson V, Beltran JP, Canas LA, et al. Isolation of mtpim proves Tnt1 a useful reverse genetics tool in Medicago truncatula and uncovers new aspects of AP1-like functions in legumes. Plant Physiol 2006;142:972–83. Berbel A, Navarro C, Ferrandiz C, Canas LA, Madueno F, Beltran JP. Analysis of PEAM4, the pea AP1 functional homologue, supports a model for AP1-like genes controlling both floral meristem and floral organ identity in different plant species. Plant J 2001;25:441–51. Bowman JL, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR. Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 1993;119:721–43. Chen MK, Lin IC, Yang CH. Functional analysis of three lily (Lilium longiflorum) APETALA1-like MADS box genes in regulating floral transition and formation. Plant Cell Physiol 2008;49:704–17. Coen ES, Romero JM, Doyle S, Elliott R, Murphy G, Carpenter R. floricaula: a homeotic gene required for flower development in Antirrhinum majus. Cell 1990;63:1311–22. Dong ZC, Zhao Z, Liu CW, Luo JH, Yang J, Huang WH, et al. Floral patterning in Lotus japonicus. Plant Physiol 2005;137:1272–82. Gramzow L, Theissen G. A hitchhiker’s guide to the MADS world of plants. Genome Biol 2010;11:214. Horsch RF, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG, Fraley RT. A simple and general method for transferring genes into plants. Science 1985;227:1229–31. Huang F, Chi YJ, Gai JY, Yu DY. Identification of transcription factors predominantly expressed in soybean flowers and characterization of GmSEP1 encoding a SEPALLATA1-like protein. Gene 2009;438:40–8. Immink RG, Gadella Jr TW, Ferrario S, Busscher M, Angenent GC. Analysis of MADS box protein–protein interactions in living plant cells. Proc Natl Acad Sci U S A 2002;99:2416–21. Irish VF, Sussex IM. Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell 1990;2:741–53. Kagale S, Links MG, Rozwadowski K. Genome-wide analysis of ethylene-responsive element binding factor-associated amphiphilic repression motif-containing transcriptional regulators in Arabidopsis. Plant Physiol 2010;152:1109–34. Kaufmann K, Wellmer F, Muino JM, Ferrier T, Wuest SE, Kumar V, et al. Orchestration of floral initiation by APETALA1. Science 2010;328:85–9. Kotoda N, Wada M, Kusaba S, Kano-Murakami Y, Masuda T, Soejima J. Overexpression of MdMADS5, an APETALA1-like gene of apple, causes early flowering in transgenic Arabidopsis. Plant Sci 2002;162:679–87. Li D, Liu C, Shen L, Wu Y, Chen H, Robertson M, et al. A repressor complex governs the integration of flowering signals in Arabidopsis. Dev Cell 2008;15:110–20. Lin EP, Peng HZ, Jin QY, Deng MJ, Li T, Xiao XC, et al. Identification and characterization of two Bamboo (Phyllostachys praecox) AP1/SQUA-like MADS-box genes during floral transition. Planta 2009;231:109–20. Litt A, Irish VF. Duplication and diversification in the APETALA1/FRUITFULL floral homeotic gene lineage: implications for the evolution of floral development. Genetics 2003;165:821–33. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (−Delta Delta C(T)) method. Methods 2001;25:402–8. Mandel MA, Yanofsky MF. A gene triggering flower formation in Arabidopsis. Nature 1995;377:522–4. Mandel MA, Gustafson-Brown C, Savidge B, Yanofsky MF. Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 1992;360:273–7. Reed KC, Mann DA. Rapid transfer of DNA from agarose gels to nylon membranes. Nucleic Acids Res 1985;13:7207–21. Sun W, Cao Z, Li Y, Zhao YX, Zhang H. A simple and effective method for protein subcellular localization using Agrobacterium-mediated transformation of onion epidermal cells. Biologia 2007;62:529–32. Theissen G, Saedler H. Plant biology: floral quartets. Nature 2001;409:469–71.
Contents lists available at SciVerse ScienceDirect
Journal of Plant Physiology journal homepage: www.elsevier.de/jplph
An APETALA1-like gene of soybean regulates flowering time and specifies floral organs Yingjun Chi, Fang Huang, Haicui Liu, Shouping Yang, Deyue Yu ∗ National Key Laboratory of Crop Genetics and Germplasm Enhancement, National Center for Soybean Improvement, Nanjing Agricultural University, Weigang No. 1, Nanjing 210095, China
a r t i c l e
i n f o
Article history: Received 13 April 2011 Received in revised form 4 August 2011 Accepted 5 August 2011 Keywords: APETALA1 Floral organs Flowering time MADS-box transcription factor Soybean
a b s t r a c t MADS-box proteins are key transcription factors involved in plant reproductive development. APETALA1 (AP1) in Arabidopsis is a MIKC-type MADS-box gene and plays important roles in flower development. In this research, we isolated and characterized GmAP1, which encoded an AP1-like protein in soybean. GmAP1 contained eight exons and seven introns and was specifically expressed in the flower, especially in the sepal and petal. GmAP1 was a nucleus-localized transcription factor and displayed transactivation activity. It caused early flowering and alteration of floral organs when ectopically expressed in tobacco. To our knowledge, this is the first report characterizing an AP1-like gene from soybean. © 2011 Elsevier GmbH. All rights reserved.
Introduction Vegetative and floral developments are the key developmental processes in flowering plants that determine the overall structure of plants. The transition between the two phases is controlled by complicated regulatory pathways that respond to different environmental and endogenous signals. In the model species Arabidopsis thaliana, many genes have been identified that are responsible for the transition to flowering. It was reported that several genes, namely GIGANTEA (GI), CONSTANS (CO) and FLOWER LOCUS T (FT), were circadian-regulated and promoted flowering; FLOWERING LOCUS C (FLC) is a repressor of flowering and is negatively regulated by vernalization (Li et al., 2008). Most angiosperm flowers are composed of four types of organs arranged in concentric whorls: sepals, petals, stamens and carpels. The identities of the floral organs are specified by groups of genes. Based on analysis of homeotic floral mutants in Arabidopsis, Petunia hybrida and Antirrhinum majus, the ABCDE model was proposed to demonstrate how five classes of genes work together to specify floral organ identities (Theissen and Saedler, 2001). A (APETALA1, AP1; APETALA2, AP2) alone determines sepals; A and B (APETALA3, AP3; PISTILLATA, PI) together specify petals; B and C (AGAMOUS, AG)
Abbreviations: 3-AT, 3-amino-triazole; DAF, days after flowering; EST, expressed sequence tag; gDNA, genomic DNA; ORF, open reading frame; RT-PCR, reverse transcriptase polymerase chain reaction; SAM, shoot apical meristem. ∗ Corresponding author. Tel.: +86 25 8439 6410; fax: +86 25 8439 6410. E-mail address: [email protected] (D. Yu). 0176-1617/$ – see front matter © 2011 Elsevier GmbH. All rights reserved. doi:10.1016/j.jplph.2011.08.007
specify stamens; C alone determines carpels; D (SHATTERPROOF1/2, SHP1/2) specifies the ovule; and E class genes (SEPALLATA1/2/3/4, SEP1/2/3/4) determine the identities of all four whorls of floral organs. Except for AP2, all of these genes encode proteins with high similarities and belong to the MIKC-type MADS-box gene family. MADS-box transcription factors regulate a diverse range of developmental procedures in eukaryotes. MIKC-type MADS-box genes belong to the group only found in plants and were named after four conserved domains that exist in those proteins: MADS domain, Intervening (I) domain, Keratin (K) domain and C-terminal domain (Gramzow and Theissen, 2010). The MADS domain is highly conserved and is a DNA-binding domain that binds to consensus sequences known as CArG box [CC(A/T)6 GG]. The I domain is more diverse in sequence and structure, while the K domain is conserved and characterized by a coiled-coil structure. These two domains are involved in protein–protein interactions. The C-terminal domain is the least conserved and likely to be involved in transactivation. MIKC-type genes are well characterized and are recognized to have roles in plant development and signal transduction. AP1 is a MIKC-type MADS-box factor. It appears to establish floral meristem identity by regulation of genes that are related to phase transition and flower initiation (Mandel et al., 1992; Kaufmann et al., 2010). AP1 belongs to the A class in the ABCDE model, and also orchestrates the formation of floral primordia by regulation of genes involved in organ growth and patterning (Kaufmann et al., 2010). Mutation in AP1 of Arabidopsis causes partial flower transformation into inflorescence shoots with alterations in sepal and petal identities (Bowman et al., 1993). In contrast, constitutive expression of AP1 or its orthologues in
2252
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Arabidopsis usually cause early flowering and conversion of inflorescence to the terminal flower (Mandel and Yanofsky, 1995). If controlling expression of AP1-like genes is able to control flowering time and alter floral organ identity in other species, it might produce valuable phenotypic changes that would be used for crop improvement. Soybean is one of the most economically important crops, as it is a major source of vegetable oil and protein. Reproductive growth directly affects seed yield and quality. Therefore, to unravel the genetic mechanisms underlying the regulation of flower development is of great significance to improve soybean production. In this study, we isolated an AP1-like gene, GmAP1, from soybean and characterized its expression pattern. As a transcription activator, GmAP1 promoted flowering time and determined floral organ formation when overexpressed in tobacco.
Materials and methods Plant materials and growth conditions Seeds of soybean (Glycine max (L.) Merr. cv. Jackson) were provided by the National Center for Soybean Improvement, China. The seeds were germinated and grown in the experimental field of Nanjing Agricultural University, Nanjing, China. Leaves, roots and stems were collected at the third euphyll expanding stage. Seeds and pods were harvested at 25 days after flowering (DAF). Flowers at different developmental stages were collected. Four types of floral organs, namely sepals, petals, stamens and carpels, were collected from mature flowers. All samples were frozen in liquid nitrogen and stored at −80 ◦ C until analysis. Tobacco (Nicotiana tabacum cv. SamSun), both transgenic and wild-type plants, were grown in a growth room at 25 ◦ C under a 16 h light/8 h dark photoperiod.
RNA isolation and first-strand cDNA synthesis Total RNA was isolated using an RNA Plant Extraction Kit (TIANGEN, China) and treated with RNase-free DNase I (Takara, Japan) to remove contamination by genomic DNA (gDNA). About 2 g of purified total RNA was reverse-transcribed by AMV reverse transcriptase (Takara) using oligo(dT)18 as primer (Takara) following the manufacturer’s instructions.
Full-length cDNA cloning of GmAP1 The full-length cDNA of GmAP1 was amplified from flower cDNA with the following primers (sense: 5 -ATGGGAAGGGGTAGGGTT3 ; anti-sense: 5 -TGTCAAATGCCATACCAAAGC-3 ). Similarly, the full-length gDNA of GmAP1 was amplified from leaves. All PCR products were gel-purified (Axygen, USA) and cloned into the pGEM® -T easy vector (Promega, USA) followed by sequencing (Invitrogen, China).
Sequence and phylogenetic analysis Conserved domains were searched with SMART (http://smart.embl-heidelberg.de/). Sequences of published MADS-box genes were obtained from the NCBI databases (http://www.ncbi.nlm.nih.gov/). Multiple alignment of the sequences was conducted with Clustal X 2.0 and viewed with GeneDOC. A phylogenetic tree was constructed by MEGA 4 using the neighbor-joining method.
DNA gel blot analysis Genomic DNA was extracted from leaves using the CTAB method and digested with EcoRI or XbaI (Takara) at 37 ◦ C for 16 h. The digested DNA was separated on a 0.8% (w/v) agarose gel and transferred onto a Hybond N+ nylon membrane (Roche, Germany) by capillary transfer (Reed and Mann, 1985). A fragment encoding the C-terminus of GmAP1 was amplified and used as a probe. The probe-labeling, hybridization and detection procedures were performed using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche, Germany) according to the manufacturer’s instructions.
Gene expression analysis Real-time PCR was carried out with the iQ5 real-time PCR system (BIO-RAD, USA) using the SYBR® Green Realtime PCR Master Mix (Toyobo, Japan). Relative expression levels were normalized using tubulin (GenBank accession no. AY907703) as an internal control. Primers used were as follows: TubF (5 -GGAGTTCACAGAGGCAGAG-3 ) TubR (5 -CACTTACGCATCACATAGCA-3 ) for tubulin, and GmAP1F (5 -ATGATTCCGAGTCACAGGGAA-3 ) and GmAP1R (5 -TGTCAAATGCCATACCAAAGC-3 ) for GmAP1. The PCR amplification protocol was 95 ◦ C for 1 min, followed by 45 cycles at 95 ◦ C for 15 s, 60 ◦ C for 15 s and at 72 ◦ C for 45 s, with a final extension at 72 ◦ C for 10 min. The relative expression of GmAP1 was calculated according to the 2−Ct method (Livak and Schmittgen, 2001). The threshold cycle (Ct) values were the means of two replicate independent PCRs. RNA in situ hybridization was performed on longitudinal sections of the soybean apical inflorescence as previously described (Coen et al., 1990). RNA antisense and sense probes were generated from a 300 bp fragment in the 3 region of the GmAP1 cDNA, and were labeled with digoxigenin.
Subcellular localization of the GmAP1–GFP fusion protein The WoLF PSORT Prediction (http://wolfpsort.org) was employed to predict the subcellular localization of GmAP1. The GmAP1 open reading frame (ORF) without the stop codon was inserted into the BamHI–XbaI sites of pBI121-GFP vector (Clontech, USA), resulting in translational GFP fusion at the C-terminus of GmAP1. This construct was transferred into onion epidermal cells by Agrobacterium tumefaciens strain EHA105 (Sun et al., 2007). Cells harboring the empty pBI121-GFP vector (35S:GFP) were used as a control. The GFP signals were monitored under a confocal spectral microscope (Leica CP SP2, Germany).
Transcriptional activities assay The GAL4 DNA-binding domain vector, pBD-GAL4 Cam (Stratagene, USA), was used for transcriptional activities analysis. The entire coding region of GmAP1 was inserted into the EcoRI–SalI sites of the vector. This construct was introduced into the yeast YRG-2 strain, which contained the His3 reporter gene in the genome. The transactivation activities were evaluated according to the growth status of these cells on the synthetic defined medium lacking histidine (SD/−His + 10 mM 3-AT). The pBD-GAL4 Cam empty vector (pBD-GAL4) and pGAL4 (Stratagene, USA) were transformed into yeast cells, and the transformants were streaked on plates, as negative and positive controls, respectively.
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 1. Organization of GmAP1 in the soybean genome. (A) Schematic diagram of the gene structure of GmAP1 and its putative orthologues in Arabidopsis thaliana (AP1), Antirrhinum majus (SQUA), Medicago truncatula (MtPIM) and Pisum sativum (PEAM4). Positions of exons (boxes) and introns (lines) are shown. The dashed arrow indicates the position of the probe used for DNA gel blot analysis. (B) DNA gel blot analysis of GmAP1 in the soybean genome. Genomic DNA was digested with EcoRI and XbaI, respectively. A molecular weight marker is indicated on the left.
Ectopic expression in tobacco The GmAP1 ORF was amplified with the following primers (F: 5 GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGGAAGGGGTAGG GTTCAGCTGA-3 ; R: 5 -GGGGACCACTTTGTACAAGAAAGCTGGGTCT CAAAAGCATCCAAGGTGACAGGAA-3 ) flanked with the attB1 and attB2 sites, respectively. The PCR product was introduced into the pDONR221 vector using the GatewayTM BP clonase (Invitrogen, USA), and subsequently integrated into pMDC32 using LR clonase (Invitrogen, USA). The resultant construct, pMDC32-GmAP1, was introduced into A. tumefaciens via the freeze–thaw method and used to transform tobacco by the leaf disc transformation method (Horsch et al., 1985). Transgenic plants were selected on Murashige and Skoog medium containing hygromycin B. Results Isolation and sequence analysis of AP1-like gene from soybean Based on analysis of microarray and real-time PCR data, we previously identified 12 MADS-box genes involved in soybean flower development (Huang et al., 2009). Among these genes, an AP1like gene (Gma.16141.1.A1 at) was chosen for further study, herein named GmAP1. A 763 bp cDNA clone that included a full-length open reading frame (ORF) was obtained for GmAP1 from flower cDNA (Supplementary file 1). We cloned the genomic fragment of GmAP1 with a full length of 5.7 kb. Alignment of the cDNA with the genomic sequence revealed that eight exons and seven introns were present in GmAP1 (Fig. 1A). The distribution of exons in GmAP1 coincided with that of AP1 in Arabidopsis, SQUA in Antirrhinum, MtPIM in Medicago truncatula and PEAM4 in Pisum sativum (Fig. 1A). It is intriguing that the exons at the same position were of identical size between AP1-like genes in these four species, except for the last two exons. In contrast, the introns were more variable in sequence and length, which resulted in different gene lengths. A Blast search of the soybean genomic DNA (gDNA) database (http://www.phytozome.net), using the ORF of GmAP1 as the query sequence, found that GmAP1 is located on chromosome 16 and was identical to the gene with the locus tag Glyma16g13070.1. However, comparison of our cloned genomic sequence of GmAP1 with
2253
that in the soybean genome database indicated that nucleotide differences existed between GmAP1 and Glyma16g13070.1 in introns, although the exon sequences were identical. These differences could reflect variation among cultivars. DNA hybridization was performed to further study the organization of GmAP1 in the soybean genome. Because the 3 genomic fragments of AP1-like genes were divergent, a fragment amplified from this region of GmAP1 was used as a specific probe (Fig. 1A). One band was detected in both of two digestions (Fig. 1B). These results indicated that GmAP1 is a single-copy gene in the soybean genome. GmAP1 consisted of 236 amino acids. Sequence comparison showed that GmAP1 is similar to other AP1-like proteins. GmAP1 shared 92% identity with MtPIM (Medicago), 70% identity with AP1 (Arabidopsis) and 73% identity with SQUA (Antirrhinum). GmAP1 contained the conserved domains that characterize MADS-box proteins (Fig. 2). The typical MIKC-type MADS domain was located at the N-terminus from 1 to 60 aa. A highly conserved K domain is located from 75 to 174 aa. An I domain was located between the MADS domain and K domain. The C-terminal region contained an euAP1-motif (Litt and Irish, 2003). In addition, one LxLxL type of ERF-associated amphiphilic repression (EAR) motif was recognized in the C-terminus (Fig. 2). This motif is distinct for negative transcriptional regulation (Kagale et al., 2010). Interestingly, GmAP1 lacked the prenylation motif (CFAA) that is present at the Cterminus of AP1 orthologues (Berbel et al., 2001). The phylogenetic tree indicated GmAP1 grouped together with AP1/FUL/CAL in Arabidopsis and belonged to the A class in the ABCDE model (Fig. 3). GmAP1 is most similar to AP1 orthologues in other legumes, such as Lotus japonicus, Medicago and Pisum. Expression patterns of GmAP1 during reproductive growth In order to examine the expression patterns of GmAP1, we performed quantitative real-time PCR analysis. GmAP1 was specifically expressed in the flower, and not in the root, stem, leaf, pod and seed (Fig. 4A). Fig. 4C shows that GmAP1 was expressed throughout flower development, with the highest expression occurring at the stage in which the sepals elongated. GmAP1 showed expression in both sepals and petals (Fig. 4B), but not in stamens and carpels. The transcript abundance in sepals was about nine-fold higher than that in petals. GmAP1 transcription was not detected in either seeds on seven different time-points after flowering (15, 20, 25, 35, 40, 45 and 50 days after flowering (DAF)) or seed organs including the seed coat, cotyledons and embryo (data not shown). RNA in situ hybridization analysis was also carried out with both GmAP1 sense and antisense probes to investigate gene expression. GmAP1 transcripts accumulated at the early stage of meristem differentiation (Fig. 5). GmAP1 transcription was detected in both the apical inflorescence meristem and lateral floral meristems of soybean, whereas no signal was detected in young developing seeds (5 and 8 DAF) (data not shown). Subcellular localization GmAP1 contained the putative conserved bipartite NLS consensus sequence in the MADS domain (Fig. 2) (Immink et al., 2002). Based on this finding, GmAP1 was predicted to be localized in the nucleus. In order to determine the localization of GmAP1 in vivo, the coding region of GmAP1 was fused with GFP under the control of the cauliflower mosaic virus (CaMV) 35S promoter and transiently expressed in onion epidermal cells. Confocal imaging of GFP fluorescence revealed that the GmAP1–GFP fusion protein was localized in the nucleus, whereas the control construct, 35S:GFP, was distributed throughout the whole cell (Fig. 6).
2254
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 2. Clustal X alignment of the deduced amino acid sequence of GmAP1 and other AP1 orthologues from Lotus japonicus: LjAP1a (AAX13296), Medicago truncatula: MtPIM (AAZ67068), Pisum sativum: PEAM4 (CAC35027), Arabidopsis thaliana: AP1 (CAA78909) and Antirrhinum majus: SQUA (CAA45228). The highly conserved region, MADS domain, K domain and euAP1-like motif, are underlined. The bipartite NLS is double-underlined. The box indicates the CaaX prenylation motif (CFAA) in AP1 and SQUA. marks the consensus sequence of the EAR motif.
Fig. 3. Phylogenetic relationships of ABCDE class proteins in Arabidopsis and AP1-like proteins in Antirrhinum majus (SQUA) and legume species (GmAP1, LjAP1a, LjAP1b, MtPIM and PEAM4). A phylogenetic tree was generated from the putative amino acid sequences by MEGA 4 using the neighbor-joining method. Numbers below branches indicate bootstrap support percentages from 1000 replicates. AGL63 was used as an outgroup.
GmAP1 exhibits transactivation activity GmAP1 contains the euAP1-motif, which confers protein transactivation ability (Litt and Irish, 2003). To test whether GmAP1 showed transactivation activity, a yeast hybrid assay was performed. The coding region of GmAP1 was cloned into the GAL4 DNA-binding domain vector to generate pBD-GmAP1. This plasmid was introduced into yeast strain YRG-2. The transformants
were tested for activation of the His3 selectable marker. The yeast cells containing pBD-GAL4 (the negative control) did not grow well on the selective medium of SD/−His + 10 mM 3-amino-triazole (3-AT) compared with on medium of YPAD (Fig. 7). However, the yeast cells containing pBD-GmAP1 or pGAL4 (the positive control) showed good growth on the same selective medium (Fig. 7), which indicated that GmAP1 showed transactivation ability.
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
2255
Fig. 4. Real-time PCR analysis of GmAP1 expression in different organs and at different developmental stages. (A) Gene expression profile of GmAP1 in vegetative organs, flower, pod and seed. (B) Expression profile of GmAP1 in floral organs. (C) Expression profile of GmAP1 in developing flowers at four developmental stages (1–4). The four developmental stages are illustrated in (D).
Fig. 5. RNA in situ hybridization of GmAP1 in the soybean apical inflorescence. (A) Longitudinal section hybridized with sense GmAP1 probe, as a negative control. No signal was detected. (B) Hybridization of antisense GmAP1 probe showed gene expression in the inflorescence meristem (im) and floral meristem (fm). (C) High-power magnification of the floral meristem (highlighted with a white box in B). GmAP1 transcripts accumulated in the region of primordia that will give rise to petals and sepals. Scale bars: 100 m.
Overexpression of GmAP1 in tobacco altered flowering time and flower morphology To gain further insight into the function of GmAP1, we chose a gain-of-function approach to characterize GmAP1. The cDNA of GmAP1 was transferred to tobacco under the control of the CaMV 35S promoter. Eight independent transgenic lines were selected for analysis. Compared with wild-type plants, all lines showed an early-flowering phenotype in both the T0 and T1 generations under a long-day photoperiod (LD) (Fig. 8A–C). The flowering time was evaluated by counting the number of leaves produced until flowering. The transgenic lines produced on average 27 leaves prior to the onset of flowering, whereas wild-type plants produced approximately 36 leaves (Fig. 9A). In addition, the height of transgenic plants was reduced (Fig. 9B). In contrast to wild-type plants (Fig. 8D), new leaves were observed in the leaf axils (Fig. 8E) and lateral inflorescences developed in the axils of the upper leaves while the terminal inflorescence was blooming (Fig. 8F) in
transgenic tobacco. Most lateral inflorescences developed normally and bore flowers. In three out of eight transgenic lines, the lateral inflorescences carried a defective terminal flower, which only had sepals and did not flower normally (Fig. 8F). Although the floral morphology frequently resembled that of wild-type flowers, some organ alterations were also observed in 35S::GmAP1 transgenic plants. One of the stamens was converted to a petal-like structure in two lines (Fig. 10B). An additional stamen-like structure was observed on a normal petal of one flower in one line (Fig. 10C). The configuration of petals and sepals was changed with four units present in each whorl (Fig. 10D–F). No phenotypic alteration in the fruits and seeds was observed. Discussion GmAP1 contains eight exons and seven introns and is a singlecopy gene in the soybean genome. Comparison of the exon–intron
2256
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 6. Subcellular localization of GmAP1. GmAP1–GFP fusion proteins were transiently expressed in onion epidermal cells (A–C). 35S:GFP was used as a control (D–F). Photographs were taken with a confocal microscope. A and D are bright field images; B and E are fluorescent images of GFP; C and F are merged images. The arrow shows the location of GmAP1. Scale bars: 100 m.
Fig. 7. Assay of GmAP1 transcriptional activity. (A) Schematic diagram of His reporter gene expression activated by GmAP1 in a yeast cell. UAS represents upstream activating sequences; GAL4-BD represents the binding domain of GAL4; the arrow indicates the direction of His gene expression. (B–D) Yeast cells YRG-2 were transformed by pBDGmAP1, pGAL4 (positive control) and pBD-GAL4 (negative control), respectively. The transformants were streaked on YPAD and selective medium (SD/−His + 10 mM 3-AT) for examination of growth. (D) A sketch panel indicating the position of each yeast strain.
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
2257
Fig. 8. Phenotypic analysis of transgenic tobacco ectopically expressing GmAP1. (A) The 35S::GmAP1 plant (left) flowered after producing about 15 leaves under long-day (LD) conditions, whereas the wild-type plant (right) was still in the vegetative growth stage. (B) Wild-type tobacco (right) started flowering after producing 33 leaves under LD conditions, whereas the transgenic plant had already produced seeds (left). The transgenic plant was dwarfed as a result of the early onset of flowering. (C) Example of extremely early flowering, showing a transgenic plant with nine leaves and dramatic dwarfism. (D–F) Compared with the wild-type plant (D), additional leaves developed in the leaf axils of transgenic plants (E). A lateral inflorescence (F) was produced at the nodes below the terminal inflorescence, some of which developed a defective terminal flower bud.
Fig. 9. Effects of GmAP1 overexpression on aerial architecture of plants. (A) Comparison of leaf number produced by transgenic (35S::GmAP1) and wild-type (WT) plants before flowering. (B) Comparison of plant height between transgenic (35S::GmAP1) and wild-type (WT) plants. Values correspond to the average number of total leaves or height of aerial parts (n = 8). Error bars represent the standard deviation. An asterisk indicates a significant difference (P < 0.001) between transgenic and wild-type plants.
structure of GmAP1 with other AP1 orthologues shows that they have the same number of exons and introns, whereas the fulllength cDNAs are largely different because of the divergent length of introns. The length of each exon is highly conserved. These results
indicate that mutations in the introns might distinguish divergent AP1-like genes in different cultivars and species. The nuclear localization of GmAP1 was determined by fusion of GmAP1 with GFP. GmAP1 contains the MADS and K domains and
2258
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
Fig. 10. Flower morphology of 35S::GmAP1 plants. (A) and (G) The normal morphology of a wild-type flower (A) and sepals (G). (B) Petal-like stamens were observed in plants that flowered extremely early. (C) A stamen-like petal was produced on the normal petal of flower of a 35S::GmAP1 plant. (D–F) The configurations of both petals and sepals were altered.
shows high identities with AP1 orthologues in Medicago and Lotus (Dong et al., 2005). It is well known that the C-terminal domains of plant MADS-box proteins are variable, but the euAP1-like motif is well characterized within AP1-like proteins. The euAP1-like sequences contain two conserved motifs: a transcription activation domain, RRNaLaLT/NLa, and a farnesylation motif, CaaX (Litt and Irish, 2003). As already described for PIM, MtPIM and LjAP1, the farnesylation motif is absent in GmAP1. This finding supports the hypothesis that this kind of posttranslational modification is not essential for AP1 function in legumes (Berbel et al., 2001; Benlloch et al., 2006). All bioinformatic analyses indicated that GmAP1 is a MADS-box transcription factor. It is very likely that GmAP1 is expressed during reproductive development. Our previous results showed that GmAP1 is exclusively expressed in the flower (Huang et al., 2009). To analyze the expression pattern in greater detail, more samples were collected and monitored by quantitative real-time PCR. We found that GmAP1 was only expressed in the flower and was not detected in other tissues examined, even in other reproductive organs such as the seed. During flower development, expression was observed early in flower bud development and was maintained until flower maturity. In the mature flower, expression of GmAP1 was restricted to the sepals and petals. RNA in situ hybridization analysis indicated that the expression of GmAP1 was initiated early in flower development. GmAP1 was detectable in the outer region of the inflorescence meristem, indicating that GmAP1 might be involved in floral meristem identity. Subsequently, GmAP1 transcripts strongly accumulated in the floral meristem. We further speculate that GmAP1 has a role in initiation of floral primordia and determines their identities. It is well known that AP1-like genes act as important regulators in the floral transition and determination of sepal and petal identities. Thus, we predict that GmAP1 might
play a role in determination of flowering time and floral organ identity. GmAP1 contains a transcription activation domain and displays transactivation ability in a yeast hybrid assay. Consistent with a role as a transcriptional factor, GmAP1 is localized in the nucleus. AP1 in Arabidopsis activates regulatory genes required for floral organ formation, but acts predominantly as a transcriptional repressor during the earliest stages of flower development (Kaufmann et al., 2010). Although the exact mechanism by which AP1 mediates the inhibition of gene expression is currently unknown, available evidence indicates involvement of an interaction between AP1 and other factors. The EAR-motif mediates the recruitment of protein complexes to confer repression of target genes (Kagale et al., 2010). Therefore, it is possible that the EAR-motif at the C-terminus of GmAP1 might allow transcriptional down-regulation of target genes during flower initiation (Fig. 2). Further research is required to identify the target genes of GmAP1 and analyze their expression. The in planta function of GmAP1 was demonstrated by expression in tobacco. The 35S::GmAP1 transgenic lines exhibited early flowering under LD conditions in comparison with wild-type plants. Concomitantly, the transgenic lines displayed a dwarf phenotype that is the result of transition to reproductive growth early in development. This finding was consistent with ectopic overexpression of AP1-like genes in other species (Berbel et al., 2001; Lin et al., 2009), which indicates AP1-like genes are functionally conserved as a floral promoter in plants. Overexpression of GmAP1 in tobacco induced development of leaves in leaf axils and lateral inflorescences developed in the axils around the terminal inflorescence. Some lateral inflorescences developed a defective terminal flower. These phenotypes could
Y. Chi et al. / Journal of Plant Physiology 168 (2011) 2251–2259
have arisen because GmAP1 overexpression induced abnormal meristem development and suggest GmAP1 has a critical role in determination of floral meristem identity. Previous studies showed that AP1 alone can convert inflorescence meristems into floral meristems and cause a terminal flower-like phenotype when ectopically expressed in Arabidopsis (Mandel and Yanofsky, 1995). Many AP1-like genes from different species have been functionally characterized and are known to cause early flowering in plants. However, their phenotypic effects on floral organs differ between species. AP1 can specify Arabidopsis sepal and petal identities, and ap1 mutants exhibit conversion of sepals to bract-like structures (Irish and Sussex, 1990). PEAM4, which is an AP1 functional homologue in pea, is able to restore perianth organ identity in ap1-1 Arabidopsis mutants. The flowers of 35S::PEAM4 transgenic Arabidopsis and tobacco were indistinguishable from those of wild-type plants (Berbel et al., 2001). Expression of an AP1like gene from apple in Arabidopsis caused abnormal floral organ development and reduced fertility (Kotoda et al., 2002). Ectopic expression of an AP1-like gene from lily, LMADS5, caused homeotic conversion of sepals into carpel-like structures and petals into stamen-like structures in one transgenic Arabidopsis plant (Chen et al., 2008). In the present study, ectopic expression of GmAP1 induced alteration of stamens to a petal-like structure and abnormal perianth features in transgenic tobacco plants, indicating that GmAP1 functions in establishment of floral organ identity as an ABCDE-type MADS-box gene. Our data provides evidence that AP1-like genes are able to alter floral organ identity. However, further research is needed to clarify the functional conservation of AP1-like genes in floral organ specification in a variety of plant species. In conclusion, GmAP1 is a nuclear-localized transcription activator. Ectopic expression of GmAP1 causes alteration in flowering time, floral meristem identity and floral organ specification. Our research provides the first insight into the roles of GmAP1. Further work involving GmAP1 mutants and overexpression lines will lead to an improved understanding of the function of GmAP1 in reproductive growth during the soybean life cycle. Acknowledgments We thank Dr. Jun Yang (Chinese Academy of Sciences, Shanghai) for helping with in situ hybridization and Dr. Ji Huang (Nanjing Agricultural University, China) for valuable suggestions. We thank Dr. Weihua Chen (The Australian National University, Australia) for revising the manuscript. This work was supported by the National Basic Research Program of China (973 Program) (2010CB125906, 2009CB118400), National Natural Science Foundation of China (30800692, 31000718) and Jiangsu Provincial Natural Science Foundation (BK2008334). The two anonymous reviewers are thanked for their highly valuable comments and suggestions.
2259
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jplph.2011.08.007. References Benlloch, d’Erfurth I, Ferrandiz C, Cosson V, Beltran JP, Canas LA, et al. Isolation of mtpim proves Tnt1 a useful reverse genetics tool in Medicago truncatula and uncovers new aspects of AP1-like functions in legumes. Plant Physiol 2006;142:972–83. Berbel A, Navarro C, Ferrandiz C, Canas LA, Madueno F, Beltran JP. Analysis of PEAM4, the pea AP1 functional homologue, supports a model for AP1-like genes controlling both floral meristem and floral organ identity in different plant species. Plant J 2001;25:441–51. Bowman JL, Alvarez J, Weigel D, Meyerowitz EM, Smyth DR. Control of flower development in Arabidopsis thaliana by APETALA1 and interacting genes. Development 1993;119:721–43. Chen MK, Lin IC, Yang CH. Functional analysis of three lily (Lilium longiflorum) APETALA1-like MADS box genes in regulating floral transition and formation. Plant Cell Physiol 2008;49:704–17. Coen ES, Romero JM, Doyle S, Elliott R, Murphy G, Carpenter R. floricaula: a homeotic gene required for flower development in Antirrhinum majus. Cell 1990;63:1311–22. Dong ZC, Zhao Z, Liu CW, Luo JH, Yang J, Huang WH, et al. Floral patterning in Lotus japonicus. Plant Physiol 2005;137:1272–82. Gramzow L, Theissen G. A hitchhiker’s guide to the MADS world of plants. Genome Biol 2010;11:214. Horsch RF, Fry JE, Hoffmann NL, Eichholtz D, Rogers SG, Fraley RT. A simple and general method for transferring genes into plants. Science 1985;227:1229–31. Huang F, Chi YJ, Gai JY, Yu DY. Identification of transcription factors predominantly expressed in soybean flowers and characterization of GmSEP1 encoding a SEPALLATA1-like protein. Gene 2009;438:40–8. Immink RG, Gadella Jr TW, Ferrario S, Busscher M, Angenent GC. Analysis of MADS box protein–protein interactions in living plant cells. Proc Natl Acad Sci U S A 2002;99:2416–21. Irish VF, Sussex IM. Function of the apetala-1 gene during Arabidopsis floral development. Plant Cell 1990;2:741–53. Kagale S, Links MG, Rozwadowski K. Genome-wide analysis of ethylene-responsive element binding factor-associated amphiphilic repression motif-containing transcriptional regulators in Arabidopsis. Plant Physiol 2010;152:1109–34. Kaufmann K, Wellmer F, Muino JM, Ferrier T, Wuest SE, Kumar V, et al. Orchestration of floral initiation by APETALA1. Science 2010;328:85–9. Kotoda N, Wada M, Kusaba S, Kano-Murakami Y, Masuda T, Soejima J. Overexpression of MdMADS5, an APETALA1-like gene of apple, causes early flowering in transgenic Arabidopsis. Plant Sci 2002;162:679–87. Li D, Liu C, Shen L, Wu Y, Chen H, Robertson M, et al. A repressor complex governs the integration of flowering signals in Arabidopsis. Dev Cell 2008;15:110–20. Lin EP, Peng HZ, Jin QY, Deng MJ, Li T, Xiao XC, et al. Identification and characterization of two Bamboo (Phyllostachys praecox) AP1/SQUA-like MADS-box genes during floral transition. Planta 2009;231:109–20. Litt A, Irish VF. Duplication and diversification in the APETALA1/FRUITFULL floral homeotic gene lineage: implications for the evolution of floral development. Genetics 2003;165:821–33. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (−Delta Delta C(T)) method. Methods 2001;25:402–8. Mandel MA, Yanofsky MF. A gene triggering flower formation in Arabidopsis. Nature 1995;377:522–4. Mandel MA, Gustafson-Brown C, Savidge B, Yanofsky MF. Molecular characterization of the Arabidopsis floral homeotic gene APETALA1. Nature 1992;360:273–7. Reed KC, Mann DA. Rapid transfer of DNA from agarose gels to nylon membranes. Nucleic Acids Res 1985;13:7207–21. Sun W, Cao Z, Li Y, Zhao YX, Zhang H. A simple and effective method for protein subcellular localization using Agrobacterium-mediated transformation of onion epidermal cells. Biologia 2007;62:529–32. Theissen G, Saedler H. Plant biology: floral quartets. Nature 2001;409:469–71.