An extracellular laccase with antiproliferative activity from the sanghuang mushroom Inonotus baumii

Journal of Molecular Catalysis B: Enzymatic 99 (2014) 20–25

Contents lists available at ScienceDirect

Journal of Molecular Catalysis B: Enzymatic journal homepage: www.elsevier.com/locate/molcatb

An extracellular laccase with antiproliferative activity from the sanghuang mushroom Inonotus baumii Jian Sun a,b , Qing-Jun Chen a , Meng-Juan Zhu b , He-Xiang Wang b,∗∗ , Guo-Qing Zhang a,∗ a College of Biological Sciences and Engineering, Key Laboratory of Urban Agriculture (North) of Ministry of Agriculture, Beijing University of Agriculture, Beijing 102206, China b State Key Laboratory of Agro-Biotechnology and MOA, Key Laboratory of Soil Microbiology, College of Biological Sciences, China Agricultural University, Beijing 100193, China

a r t i c l e

i n f o

Article history: Received 22 April 2013 Received in revised form 4 October 2013 Accepted 5 October 2013 Available online 17 October 2013 Keywords: Inonotus baumii Laccase Enzyme purification Characterization Antiproliferative activity

a b s t r a c t We described the purification and characterization of a novel extracellular laccase from the traditional Chinese medicinal mushroom Inonotus baumii with antiproliferative activity. The laccase (IBL) was purified from fermentation broth of I. baumii by employing initial filtration and centrifugation steps, followed by three ion-exchange chromatography steps comprising DEAE-cellulose, CM-cellulose, and Q-Sepharose, and a final gel-filtration step by fast protein liquid chromatography (FPLC) on Superdex 75. The purified enzyme was a monomeric protein with a molecular mass of 66 kDa calculated by FPLC and SDS-PAGE. It possessed an N-terminal amino acid sequence of AIGPVDEV (SPIN: C0HJB2), a temperature optimum of 20 ◦ C, pH optima of 2.4 and 3.2 toward ABTS and guaiacol respectively, and Km values of 1.31 mM and 2.27 mM toward ABTS and guaiacol respectively at pH 2.4 and 30 ◦ C. The ranking of its oxidative activity toward various aromatic substrates was ATBS > guaiacol > 4-methylcatechol > 4hydroxyindole > catechol > hydroquinone > 2,6-dimethoxy-phenol (19.6%) > pyrogallol > ferulic acid > N, N-dimethyl-1, 4-phenylenediamine. Cu2+ can enhance the enzyme activity of 10.8–14.6 fold in the ion concentration range of 1.25–10 mM. IBL manifested antiproliferative activities toward HepG2 and L1210 cells with IC50 values of 2.4 ␮M and 3.2 ␮M, respectively, but is devoid of inhibitory activity toward HIV-1 reverse transcriptase. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Laccase (-diphenol: dioxygen oxidoreductase, EC 1.10.3.2) is a multicopper oxidase that is widespread among plants, bacteria, and especially fungi [1,2]. It catalyzes the oxidation of a broad range of organic and inorganic substrates, including aromatic amines, ascorbate, diamines, diphenols, and polyphenols [3]. As one of the oldest enzymes first described at 1883, laccase can be divided into two major groups with clear differences, including those in higher plants and those in fungi [1]. Laccases from higher plants play very important roles in lignin biosynthesis, whereas fungal laccases are involved in wood degradation, pigmentation, and pathogenesis [2]. Recently, the occurrence and properties of the laccases have been comprehensively reviewed due to their wide applications in pulp and paper, textile, pharmaceutical industries [4]. Inonotus baumii (used to be identified as Phellinus baumii), commonly called ‘Sanghuang’ in China and ‘meshimakobu’ in

∗ Corresponding author. Tel.: +86 10 8079 7308; fax: +86 10 8079 7308. ∗∗ Corresponding author. Tel.: +86 10 6273 2578; fax: +86 10 6273 2578. E-mail addresses: [email protected] (H.-X. Wang), [email protected] (G.-Q. Zhang). 1381-1177/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.molcatb.2013.10.004

Japan, is a famous traditional Chinese medicinal mushroom used in China, Japan, Korea, and other Asian countries for centuries [5]. Technically, it belongs to Order Hymenochaetales, Family Hymenochaetaceae. As a famous herbal medicine, I. baumii has been described to be effective on a diversity of ailments, including anti-cancer, anti-diabetes, hepatoprotection, improving blood circulation, alleviating gastroenteric disorder, etc. [6,7]. In the present study, we report for the first time the purification and characterization of an extracellular laccase from fermentation broth of I. baumii. Enzyme characteristics and in vitro antiproliferative and anti-virus studies are also investigated. 2. Materials and methods 2.1. Strain and culture condition Strain MW0801 was isolated from fresh fruiting bodies of Inonotus sp. occurring on the tree truck of Syringa reticulata in the campus of China Agricultural University (Beijing, China), and collected in Agricultural Culture Collection of China (ACCC52850). The fungus was cultured at 26 ◦ C, stored at 4 ◦ C, and monthly transferred to fresh PDA slants which contained (g/L): potato, 200; glucose, 20; and agar, 20. For purification of the laccase, strain MW0801 was

J. Sun et al. / Journal of Molecular Catalysis B: Enzymatic 99 (2014) 20–25

inoculated into the liquid PD media which contained (g/L): potato, 200 and glucose, 20. The media were cultured using an orbital shaking incubator at 200 rpm and 26 ◦ C for 10 days. Then, the fermentation broth was collected for further laccase purification. 2.2. Identification by rDNA sequence analysis Total genomic DNA of Strain MW0801 mycelia was extracted using the CTAB method [8]. The ITS region (ITS-1, 5.8S, and ITS-2) was amplified by PCR, using universal primers ITS1 (5 TCCGTAGGTGAACCTGCGG 3 ) and ITS4 (5 TCCTCCGCTTATTGATATGC 3 ). PCR reactions were performed in a volume of 50 ␮L under standard conditions [9]. The PCR production was sequenced by Beijing Genomics Institute (Beijing, China), and compared with ITS sequences in GenBank using the Blast tool in NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi). 2.3. Assay for laccase activity The activity of laccase was spectrophotometrically determined using ABTS (2, 2 -azinobis [3-ethylbenzothiazolone-6-sulfonic acid] diammonium salt) as the substrate [10]. In brief, enzyme solution (5 ␮L) was mixed with 1 mM ABTS solution (145 ␮L, in 50 mM sodium acetate buffer, pH 5.2) at 30 ◦ C for 5 min, followed by ending the reaction by an addition of 10% TCA (250 ␮L). The change in the absorbance due to the oxidation was monitored at 405 nm for enzyme activity. One unit (U) of enzyme activity was defined as the amount of enzyme required to produce one absorbance increase at 405 nm per minute per milliliter of the reaction mixture under the assay conditions. Protein concentration was determined according to Bradford using a protein assay kit (Bio-Rad Lab, Richmind, California, USA) with bovine serum albumin (BSA) as the standard [11]. All determinations were performed in triplicate. 2.4. Purification of extracellular laccase Fermentation broth containing laccase was initially filtered through absorbent gauze, followed by centrifugation at 8000 rpm and 4 ◦ C for 15 min. Subsequently, the supernatant was dialyzed with distilled water and further purified by three successive steps of ion exchange chromatography, firstly on DEAE-cellulose (10 mM Tris–HCl buffer, pH 8.0), secondly on CM-cellulose (10 mM sodium acetate buffer, pH 5.2), and finally on Q-Sepharose (10 mM Tris–HCl buffer, pH 7.6). The laccase fraction was ultimately purified by FPLC on a Superdex 75 HR 10/30 gel filtration column (0.2 M NH4 HCO3 buffer, pH 8.5).

21

2.7. Determination of pH and temperature optima of purified laccase In this assay, pH optimum of IBL was determined using ABTS and guaiacol as substrates, respectively. A series ABTS and guaiacol solution in different pH value was used instead of the ABTS solution at pH 5.2 in the standard enzyme assay. The assay buffers were prepared in citric acid-Na2 HPO4 buffers (pH 2.2–8.0). In the assay for temperature optimum determination, the reaction mixture was incubated at different temperature including 4, 20, 40, 50, and 60 ◦ C instead of 30 ◦ C in the standard enzyme assay. All determinations were performed in triplicate. 2.8. Determination of pH stability and thermostability of purified laccase In the pH stability assay, enzyme solutions were previously incubated in 50 mM citric acid-Na2 HPO4 buffers at different pH values (2.4, 3.2, 5.2, and 7.2, respectively) for different durations (10, 20, 30, 40, 50, and 60 min, respectively) at 4 ◦ C. Subsequently, the residual laccase activity was triplicately assayed using the standard assay. In the thermostability assay, enzyme solutions were previously incubated at various temperatures (50, 60, 70, and 80 ◦ C, respectively) for various durations (10, 20, 30, 40, 50, and 60 min, respectively). The residual laccase activity was measured in triplicate using the standard assay after the reaction mixture had been cooled down to room temperature. 2.9. Assay for enzyme kinetic and substrate specificity of purified laccase The Michaelis-Menten constants of the purified laccase were determined using ABTS at pH 2.4 and guaiacol at pH 3.2 in various concentiration (0.5, 1.0, 1.5, 2.0, 3.0, 4.0, and 5.0 mM) and at 30 ◦ C. The Km values were obtained from a Lineweaver–Burk plot [14]. To determine the substrate specificity of the purified laccase, seven aromatic substrates (at 5.0 mM concentration) instead of ABTS were used in the standard enzyme assay at optimal pH (pH 2.4, 50 mM citric acid-Na2 HPO4 buffers) and 30 ◦ C. The assayed substrates included 2,6-dimethoxy-phenol, 4-hydroxyindole, 4methylcatechol, catechol, ferulic acid, guaiacol, hydroquinone, N,N-dimethyl-1,4-phenylenediamine, pyrogallol, and tyrosine. The substrate oxidation rate was followed by measuring the change in absorbance using the molar extinction coefficient (ε) obtained from the literature [15]. All determinations were performed in triplicate. Laccase activity toward ABTS was regarded as 100%. 2.10. Assay for metal ions and EDTA on laccase activity

2.5. Molecular mass determination by SDS-PAGE and FPLC gel filtration The molecular mass (Mr) of the purified laccase was determined using both sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and FPLC-gel filtration. SDS-PAGE was carried out following the protocol of Laemmli and Favre [12] with a 12% resolving gel and a 5% stacking gel. After electrophoresis, the gel was stained with Coomassie brilliant blue R-250. The Mr was calculated based on SDS-PAGE and FPLC-gel filtration [10]. 2.6. Determination of N-terminal amino acid sequence of purified laccase After SDS-PAGE and membrane transfer procedures, N-terminal amino acid sequence analysis was performed using an HP G1000A Edman degradation unit and an HP1000 HPLC system [13].

To estimate metal ions and EDTA on enzyme activity, equal volumes of the purified laccase solution were pre-incubated with metal ions or EDTA solutions (at a final concentrations of 1.25, 2.5, 5.0, and 10 mM, respectively) at 4 ◦ C for 1 h before the standard laccase assay was performed. The chemical reagents of metal ions were including KCl, CaCl2 , CdCl2 , CuCl2 , FeCl2 , MgCl2 , MnCl2 , ZnCl2 , and AlCl3 . Control samples were assayed without the metal ions. All determinations were performed in triplicate. 2.11. Assay of anti-proliferative activity and HIV-1 reverse transcriptase inhibitory activity of purified laccase Anti-proliferative activity of the purified laccase toward tumor cell lines hepatoma HepG2 and mouse lymphocytic leukemia L1210 was tested by using the MTT assay as described by Fang et al. using heat-inactivated IBL as negative control [16]. Inhibitory activity toward human immunodeficiency virus type 1 (HIV-1) reverse

22

J. Sun et al. / Journal of Molecular Catalysis B: Enzymatic 99 (2014) 20–25

Table 1 Summary of purification procedure of I. baumii laccase (from 10 L fermentation broth). Purification step

Yield (mg)

Specific activity (U/mg)

Total activity (U)

Recovery of activity (%)

Purification fold

Fermentation broth DEAE-cellulose (D3) CM-cellulose (C1) Q-sepharose (Q2) Superdex 75 (SU1)

294 19.4 1.90 0.43 0.20

10.0 69.1 466 1679 2020

2940 1341 885 722 404

100 45.6 30.0 24.6 13.7

1 6.9 46.6 168 202

transcriptase (RT) was determined by using the assay kit from Boehringer-Mannheim (Germany) and following Zhang’s asssay protocol using heat-inactivated IBL as negative control [17]. 3. Results and discussion 3.1. Identification of the laccase producing fungus Strain MW0801 was initially identified as species from genus Inonotus (used to be genus Phellinus) based on its morphological properties. The product of internal transcribed spacer (ITS) region amplification (739 bp, GenBank: KC590327) was sequenced and compared to GenBank using BLAST. Maximum homology was found in comparison with I. baumii with 97% identity (JN642566.1). Although the sanghuang mushroom is a legendary medicinal fungus known in China for more than 2000 years, its species identity and scientific name have not been satisfactorily answered until recently. Based on Wu’s newly report, the sanghuang mushrooms belong to at least 6 species including I. baumii, I. lonicericola, I. lonicerinus, I. sanghuang, I. vaninii, and I. weigelae [5]. On the other hand, sanghuang mushrooms in Asia manifest their specific host tree species: I. baumii on Syringa, I. lonicericola on Lonicera, I. lonicerinus comb. nov. on Lonicera, I. sanghuang on Morus, I. vaninii on Populus, and I. weigelae sp. nov. on Weigela [5]. Strain MW0801 was collected from the tree truck of S. reticulate. Based on both rDNA sequence analysis and morphological properties, the strain MW0801 was identified to be I. baumii. 3.2. Laccase purification and molecular mass determination The present study described the purification of laccase from fermentation broth of I. baumii strain MW0801 with a protocol that entailed three consecutive steps of ion exchange chromatography and a single step of gel filtration, resulting in a 13.7% recovery of activity and a purification factor of 202-fold (Table 1). After the filtration and centrifugation, fermentation broth was fractioned on DEAE-cellulose into four fractions: D1, D2, D3, and D4 after elution with 0, 50, 150, and 1000 mM NaCl, respectively, in Tris–HCl buffer (10 mM, pH8.0). Subsequently, fraction D3 containing laccase activity was applied to CM-cellulose and eluted with sodium acetate buffer (10 mM, pH 5.2). It was separated into three fractions C1, C2, and C3 with 0, 50, and 1000 mM NaCl in the sodium acetate buffers, respectively. Laccase active fraction C2 was further applied to Q-Sepharose and eluted with a linear gradient of 0–500 mM NaCl in Tris-HCl buffer (10 mM, pH 7.6). It was again separated into three fractions: an unadsorbed fraction Q1 and two adsorbed fractions Q2 and Q3. The laccase-containing fraction Q2 was finally subjected to an FPLC-Superdex 75 HR 10/30 column to yield a major fraction SU1 containing purified laccae and a minor fraction SU2 devoid of laccase activity (Fig. 1a). SU1 fraction possessed a Mr of 66 kDa as estimated by FPLC based on the standard curve of elution volumelgMr. In SDS-PAGE, SU1 fraction appeared as a single band with a Mr of 66 kDa (Fig. 1b). This suggested that the native laccase is a monomeric protein. Since fungal laccases act very important degradation activities during the fungi life cycles, most of the fungi secrete more than

Table 2 Comparison of the N-terminal sequence of IBL with other fungal laccases. Species

N-terminal sequence

Inonotus baumii (C0HJB2, present study) Abortiporus biennis [19] Agaricus bisporus (AAC18877.1) Agaricus placomyces (B3EWI3) Cerrena unicolor (ACL93462.1) Clitocybe maxima [17] Ganoderma lucidum (ACR24357.1) Lentinus tigrinus (AAX07469.1) Neurospora crassa (AAA33591.1) Phellinus ribis (Inonotus ribis) [18] Panus rudis (AAR13230.1) Phlebia radiata (CAI56705.1) Pleurotus eryngii [29] Pleurotus nebrodensis [15] Polyporus brumalis (ABN13592.1) Trametes gibbosa (ADK13091.1)

1 AIGPV DEV 8 1 AIGPV ADLTI 10 1 MRLSN ALVLV 10 2 VIGPQ AQVTL 11 21 AIGPV ADLHI 30 1 DIGPV TPLAI 10 21 GIGPK ADLTI 30 1 AVGPV ADLTV 10 374 GVAPV DHQCL 383 1 AIVST PLLIP 10 1 AIGPV TDLHI 10 23 GIGPV TDLRI 32 1 AVGPV LGPDA 10 1 AIGPD DTINF 10 23 AIGPV ADLTI 32 21 AIGPV ADLTI 30

Amino acid residues identical to corresponding residues of IBL are underlined.

one kind of laccase, such as Agaricus bisporus, Armillaria mellea, and Cerrena unicolor [2]. In the present, the isolated laccase IBL is one but the most kind of the isozymes. IBL demonstrates a Mr of 66 kDa which falls well within the range of molecular masses of most of the fungal laccases reported (50–90 kDa) [2]. IBL is a monomeric protein just like other fungal laccases, whereas another extracellular laccase from Phellinus ribis (now identified as Inonotus ribis), which also belongs to genus Inonotus, is a homodimeric protein of 152 kDa with subunit Mr of 76 kDa. 3.3. N-terminal amino acid sequencing of purified laccase The N-terminal amino acid sequence of IBL is AIGPVDEV (SPIN: C0HJB2). A comparison of N-terminal amino acid sequence of IBL with other fungal laccases is presented in Table 2. IBL manifests considerably high sequence similarity with those laccases from white rotting fungi, such as Abortiporus biennis [19], Cerrena unicolor (ACL93462.1), and Panus rudis (AAR13230.1). On the other hand, the P. ribis laccase possesses a unique N-terminal amino acid sequence of AIVSTPLLIPNANCL with low sequence similarity with IBL and other fungal laccases [18]. 3.4. pH optimum, temperature optimum, pH stability, and thermostability of purified laccase The purified laccase achieves its maximal oxidizing activity toward ABTS at pH 2.4 and guaiacol at pH 3.2 (Fig. 2a), and possesses a very low optimal temperature of 20 ◦ C (Fig. 2b). In the pH stability assay, IBL shows strong stability at pH 7.2 and 5.2. Most of the oxidizing activity remained after 60 min pre-incubation at pH 7.2 and 5.2, whereas it lost its activity with increasing time, with a 10% activity loss at pH 3.2 for 60 min and 18% activity loss at pH 2.4 for 60 min (Fig. 3a). Although IBL manifests a quite low optimal temperature of 20 ◦ C, it possesses considerably high thermostability (Fig. 3b). Most of the enzyme activity maintains when IBL underwent 60 min pre-incubation at 50 ◦ C and 60 ◦ C. There is a

J. Sun et al. / Journal of Molecular Catalysis B: Enzymatic 99 (2014) 20–25

23

Fig. 1. (A) FPLC-gel filtration on Superdex 75 HR 10/30 column. Eluent: 0.2 M NH4 HCO3 buffer (pH 8.5). Fraction size: 0.8 mL. Flow rate: 0.4 mL/min. Fraction SU1 represents purified laccase. (B) SDS-PAGE of fraction SU1 from FPLC. Right lane: molecular weight markers, from top downwards, phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa), soybean trypsin inhibitor (20 kDa), and lactalbumin (14.4 kDa).

sharp and continuous decrease in enzyme activity as IBL solution was previously incubated at 70 ◦ C for 0–60 min. Approximately 50% and 90% of total activity loses when IBL was pre-incubated at 70 ◦ C and 80 ◦ C for 60 min, respectively.

The purified laccase requires an acidic conditions for optimal oxidizing activity toward ABTS just like a number of fungal laccases. The optimal pH value of IBL toward ABTS is very close to that of Agaricus blazei (pH 2.3), Sclerotium rolfsii (pH 2.4), Coriolopsis

Fig. 2. pH and temperature optima of the purified laccase. (a) pH optimum of IBL. Laccase activity was assayed toward ABTS () and guaiacol () in 50 mM citric acidNa2 HPO4 buffers (pH 2.2–8.0). (b) Temperature optimum of IBL. Assay solution was assayed at 4, 20, 40, 50, and 60 ◦ C instead of 30 ◦ C in the standard enzyme assay.

Fig. 3. pH stability and thermostability of purified laccase. (a) pH stability of IBL. Laccase activity was measured using the standard assay after incubating at pH values for 10–60 min. The assay pH values were 2.4 (), 3.2 (), 5.2 (×), and 7.2 (). (b) Thermostability of IBL. Laccase activity was measured using the standard assay after incubating at various temperatures for 10–60 min. The assay temperatures were 50 ◦ C (×), 60 ◦ C (), 70 ◦ C (), and 80 ◦ C (䊉).

24

J. Sun et al. / Journal of Molecular Catalysis B: Enzymatic 99 (2014) 20–25

Table 3 Substrate specificity of IBL. Substrate ABTS Guaiacol 4-Methylcatechol 4-Hydroxyindole Catechol Hydroquinone 2,6-Dimethoxy-phenol Pyrogallol Ferulic acid N,N-dimethyl-1,4phenylenediamine Tyrosine

Table 4 Effect of metal ions and EDTA on IBL activity. Wavelength (nm)

Relative activity (%)

36,000 6740 2091 2685 2211 10,400 35,645 4400 12,483 43,160

420 470 420 615 410 248 470 450 283 515

100 67.6 33.6 31.7 28.5 25.8 19.6 4.40 3.56 1.00

–

280

0.00

Molar extinction coefficient (M−1 cm−1 )

Metal ions

K+ Ca2+ Cd2+ Cu2+ Fe2+ Mg2+ Mn2+ Zn2+ Al3+ EDTA

Residual activity (% of control) 10 mM

5 mM

2.5 mM

1.25 mM

95.1 56.0 101 1460 40.5 104 99.6 104 62.6 97.1

101 75.5 95.2 1361 50.3 104 101 103 73.5 98.4

104 80.7 107 1240 54.8 98.7 104 107 75.9 97.7

106 90.3 102 1083 65.9 101 99.3 103 85.6 96.1

Laccase activity in the absence of metal ions was regarded as 100%.

–, no data available. Laccase activity toward ABTS at pH 2.4 and 30 ◦ C was regarded as 100%.

rigida (pH 2.5), Physisporinus rivulosus (pH 2.5), Trametes versicolor (pH 2.5), and Marasmius quercophilus (pH 2.6) [2]. IBL possesses an optimal temperature of 20 ◦ C just like A. blazei [20], but lower than most of other fungal laccases including Agrocybe cylindracea (50 ◦ C) [13], Albatrella dispansus (70 ◦ C) [21], Ganoderma lucidum (70 ◦ C), Lentinus edodes (70 ◦ C) [22], and Pleurotus nebrodensis (70 ◦ C) [15]. Although the optimal temperature of IBL is very low, it is quite thermostable even higher than A. placomyces laccase which manifests an optimal temperature of 30 ◦ C and loses more than 20% total activity after a 60 min incubation at 60 ◦ C [10]. IBL is stable at pH 5.2 and 7.2, but slightly inactive at pH 2.4 and 3.2, which are optimal pH values for ABTS and guaiacol oxidation respectively. It might because acidic conditions of pH 2.4 and 3.2 are essential for enzyme activity. On the other hand, IBL, as a protein, is sensitive in low pH conditions. The enzyme is stable at 50–60 ◦ C but reaches its optimal oxidative activity at 20 ◦ C. It might because of its microcosmic structure. The structural domain of the enzyme might be very sensitive to temperature. In slightly high temperature of 50 ◦ C and 60 ◦ C IBL loses its oxidative activity but in a reversible denaturation process. When the temperature is decreased, oxidative activity will regain. 3.5. Enzyme kinetic and substrate specificity of IBL After incubation of the purified laccase with various substrate concentrations (0.5–5.0 mM), the reactions are found to follow Michaelis-Menten kinetics, displaying Km values of 1.3 mM toward ABTS and 2.27 mM toward guaiacol using Lineweaver–Burk plots (data not shown). The purified enzyme exhibits a broad substrate specificity on a range of aromatic compounds (shown in Table 3). At pH 2.4 and 30 ◦ C, IBL demonstrates the highest oxidative activity toward ABTS with a ranking of its activity toward various aromatic substrates as follows: ATBS (100.0%) > guaiacol (67.6%) > 4-methylcatechol (33.6%) > 4(31.7%) > catechol (28.5%) > hydroquinone hydroxyindole (25.8%) > 2,6-dimethoxy-phenol (19.6%) > pyrogallol (4.4%) > ferulic acid (3.56%) > N, N-dimethyl-1, 4-phenylenediamine (1.0%). It is devoid of oxidative activity toward tyrosine. Compared with IBL, P. ribis laccase possesses a higher oxidative activity toward ABTS with a Km value of 0.21 mM [18]. The optimal substrate of IBL is ABTS, which is just like laccases from A. cylindracea [13], Clitocybe maxima [17], and L. edodes [22]. On the other hand, P. ribis laccase demonstrates the highest oxidative activity toward syringaldazine with a Km value of 11 ␮M [18]. 3.6. Effects of metal ions and EDTA on laccase activity The sensitivity of IBL to metal ions and EDTA is shown in Table 4. The purified enzyme activity is not significantly affected by the

Fig. 4. Antiproliferative activities of IBL toward HepG2 and L1210 cell lines. IC50 value, the concentration of IBL that results in an inhibition ratio of 50%, is 2.4 ␮M for HepG2 cells () and 3.2 ␮M for L1210 cells () using heat-inactivated IBL () as negative control.

presence of K+ , Cd2+ , Mg2+ , Mn2+ , Zn2+ and EDTA at an assay concentration of 1.25–10 mM, but is continuous reduced by Ca2+ , Fe2+ , and Al3+ when the ion concentration raises from 1.25 mM to 10 mM. Cu2+ can enhance the enzyme activity of 10.8–14.6 fold in the assay concentration range of 1.25–10 mM. Previous studies indicate that fungal laccases can be strengthened by low levels of Cu2+ (0.5–3.5 mM). Pleurotus ostreatus laccase can be increased by eight-fold with an addition of 1 mM Cu2+ [23]. On the other hand, Cu2+ can reduce approximately 30% of total laccase activity toward A. biennis laccase [19] and Fusarium solani laccase [24] at a concentration of 5.0 mM and 20 mM, respectively. 3.7. Anti-proliferative and HIV-1 reverse transcriptase inhibitory activities of IBL Anti-proliferative activity toward tumor cell lines was determined using IC50 value which is the concentration of IBL that results in an inhibition ratio of 50%. The purified laccase demonstrates anti-proliferative activity toward tumor cell lines hepatoma HepG2 and mouse lymphocytic leukemia L1210 with IC50 values of 2.4 ␮M and 3.2 ␮M, respectively (Fig. 4). IBL lacked any inhibitory activity toward HIV-1 reverse transcriptase when the tested concentration was up to 50 ␮M. As one of the most valuable traditional Chinese medicinal fungus, Sanghuang mushroom possesses highly effective anti-proliferative activities toward tumor cell lines. An active phenolic compound of Phellinus igniarius induces apoptosis human hepatocellular carcinoma Hep3B cells [25]. A proteoglycan

J. Sun et al. / Journal of Molecular Catalysis B: Enzymatic 99 (2014) 20–25 Table 5 Characteristic comparison of laccases from P. ribis (I. ribis) [18] and I. baumii (this study).

Moleculr mass (kDa) Molecular structure Purification fold N-terminal sequence Km value (toward ABTS) Optimal pH (toward ABTS) Optimal temperature (toward ABTS) Anti-proliferative activity toward tumor cell lines (IC50 )

P. ribis

I. baumii

152 Homodimeric 502 AIVSTPLLIPNANCL 0.21 mM 5.0 –

66 Monomeric 202 AIGPVDEV 1.31 mM 2.4 20 ◦ C

–

2.4 ␮M toward HepG2 3.2 ␮M toward L1210

–, no data available.

from Phellinus linteus possesses immunomodulating and inhibiting activity toward colorectal carcinoma [26], while intracellular and extracellular polysaccharides from P. igniarius manifest decreasing toxicity and synergistic effects toward S180 mice [27]. Other fungal laccases also demonstrate anti- proliferative activities toward HepG2 cell: A. placomyces laccase with an IC50 value of 1.7 ␮M [10], A. cylindracea with an IC50 value of 5.6 ␮M [13], and A. biennis with an IC50 value of 12.5 ␮M [19]. IBL is devoid of anti-HIV RT activity, just like laccases from A. dispansus [21] and Cantharellus cibarius [28]. 3.8. Characteristic comparison with P. ribis laccase The comparison is shown in Table 5. Although both of the two fungi belong to the same genus, their laccases possess many differences in Mr, number of subunit, purification behavior, Nterminal sequence, Km, optimal pH and temperature [18]. IBL in the present study is a monomeric enzyme with a Mr of 66 kDa like many other fungal laccases, while P. ribis laccase is homodimeric. On the other hand, subunit of P. ribis laccase manifests a Mr of 76 kDa, which is close to that of IBL. P. ribis laccase is more effective toward ABTS than IBL, while anti-proliferative activity of IBL indicates its potential application in agents for cancer therapy.

25

Acknowledgments This work was financially supported by National Grants of China (31200070, 2010CB732202, and 2012BAD14B09) and Beijing Innovative Grant of Modern Agricultural Technology System. References [1] A.M. Mayer, R.C. Staples, Phytochemistry 60 (2002) 551–565. [2] P. Baldrian, FEMS Microbiol. Rev. 30 (2006) 215–242. [3] V.M. Halaburgi, S. Sharma, M. Sinha, T.P. Singh, T.B. Karegoudar, Process Biochem. 46 (2011) 2336–2340. [4] U.N. Dwivedi, P. Singh, V.P. Pandey, A. Kumar, J. Mol. Catal. B: Enzym. 68 (2011) 117–128. [5] S.H. Wu, Y.C. Dai, T. Hattori, T.W. Yu, D.M. Wang, E. Parmaso, H.Y. Chang, S.Y. Shih, Botanical Stud. 53 (2012) 135–149. [6] T. Zhu, S.H. Kim, C.Y. Chen, Curr. Med. Chem. 15 (2008) 1330–1335. [7] D. Sliva, Exp. Ther. Med. 1 (2010) 407–411. [8] J.J. Doyle, J.L. Doyle, Phytochem. Bull. 19 (1987) 11–15. [9] P. Wang, Y. Liu, Y. Yin, H. Jin, S. Wang, F. Xu, S. Zhao, X. Geng, Int. J. Biol. Sci. 7 (2011) 209–220. [10] J. Sun, Q.J. Chen, Q.Q. Cao, Y.Y. Wu, L.J. Xu, M.J. Zhu, T.B. Ng, H.X. Wang, G.Q. Zhang, J. Biomed. Biotechnol. 2012 (2012) 736472. [11] M.M. Bradford, Anal. Biochem. 72 (1976) 248–254. [12] U.K. Laemmli, M. Favre, J. Mol. Biol. 80 (1973) 575–599. [13] D.D. Hu, R.Y. Zhang, G.Q. Zhang, H.X. Wang, T.B. Ng, Phytomedicine 18 (2011) 374–379. [14] S.B. Younes, S. Sayadi, J. Mol. Catal. B: Enzym. 73 (2011) 35–42. [15] G.T. Tian, G.Q. Zhang, H.X. Wang, T.B. Ng, Acta Biochim. Pol. 59 (2012) 407–412. [16] E.F. Fang, W.L. Pan, J.H. Wong, Y.S. Chan, X.J. Ye, T.B. Ng, Arch. Toxicol. 85 (2011) 1551–1563. [17] G.Q. Zhang, Y.F. Wang, X.Q.N.T.B. Zhang, H.X. Wang, Process Biochem. 45 (2010) 627–633. [18] K.L. Min, Y.H. Kim, Y.W. Kim, H.S. Jung, Y.C. Hah, Arch. Biochem. Biophys. 392 (2001) 279–286. [19] G.Q. Zhang, T. Tian, Y.P. Liu, H.X. Wang, Q.J. Chen, Process Biochem. 46 (2011) 2336–2340. [20] R. Ullrich, M. Huong le, N.L. Dung, M. Hofrichter, Appl. Microbiol. Biotechnol. 67 (2005) 357–363. [21] H.X. Wang, T.B. Ng, Biochem. Biophys. Res. Commun. 319 (2004) 381–385. [22] J. Sun, H. Wang, T.B. Ng, Indian J. Biochem. Biophys. 48 (2011) 88–94. [23] P. Baldrian, J. Gabriel, FEMS Microbiol. Lett. 206 (2002) 69–74. [24] Y.R. Wu, Z.H. Luo, R. Kwok-Kei Chow, L.L. Vrijmoed, Bioresour. Technol. 101 (2010) 9772–9777. [25] G.J. Huang, J.S. Deng, S.S. Huang, M.L. Hu, J. Agric. Food Chem. 59 (2011) 7104–7113. [26] Y.G. Li, D.F. Ji, S. Zhong, J.X. Zhu, S. Chen, G.Y. Hu, Int. J. Biol. Macromol. 48 (2011) 511–517. [27] Q. Meng, J. Pan, L. Chen, F. Liu, Q. Wang, Zhongguo Zhong Yao Za Zhi 37 (2012) 847–852. [28] T.B. Ng, H.X. Wang, Biochem. Biophys. Res. Commun. 313 (2004) 37–41. [29] H.X. Wang, T.B. Ng, Appl. Microbiol. Biotechnol. 69 (2006) 521–525.