An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells

YPEST-03840; No of Pages 9 Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Pesticide Biochemistry and Physiology journal homepage: www.elsevier.com/locate/ypest

An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells Deepa Gandhi a, Prashant Tarale a, Pravin K. Naoghare a, Amit Bafana a, Kannan Krishnamurthi a, Patrizio Arrigo b, Sivanesan Saravanadevi a,⁎ a b

Environmental Health Division, CSIR—National Environmental Engineering Research Institute (NEERI), Nagpur, India CNR Institute for Macromolecular Studies, Genoa, Italy

a r t i c l e

i n f o

Article history: Received 10 March 2015 Received in revised form 16 May 2015 Accepted 19 June 2015 Available online xxxx Keywords: Endosulfan Hepatocellular carcinoma cells (HepG2) Gene microarray Proteomics Common signatures

a b s t r a c t Present study reports the identification of genomic and proteomic signatures of endosulfan exposure in hepatocellular carcinoma cells (HepG2). HepG2 cells were exposed to sublethal concentration (15 μM) of endosulfan for 24 h. DNA microarray and MALDI–TOF–MS analyses revealed that endosulfan induced significant alterations in the expression level of genes and proteins involved in multiple cellular pathways (apoptosis, transcription, immune/inflammatory response, carbohydrate metabolism, etc.). Furthermore, downregulation of PHLDA gene, upregulation of ACIN1 protein and caspase-3 activation in exposed cells indicated that endosulfan can trigger apoptotic cascade in hepatocellular carcinoma cells. In total 135 transcripts and 19 proteins were differentially expressed. This study presents an integrated approach to identify the alteration of biological/cellular pathways in HepG2 cells upon endosulfan exposure. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Endosulfan is a synthetic chlorinated cyclic hydrocarbon insecticide which controls insects by contact action and ingestion [1]. Since 1960, it has been widely used in agriculture, horticulture and viticulture [2]. Endosulfan, which is sold with different trade names (Melix, Thiovel, Hildan, Endox, etc.), is composed of two stereoisomers: 70% αendosulfan and 30% β-endosulfan. Even after its global phase out and restrictions, endosulfan residues are still detected in the atmosphere, sediments, water and food samples [3,4]. The presence of endosulfan residues in remote ecosystems like Antarctica and Arctic revealed its ability to travel long distance and persist in all ecosystems [5]. Endosulfan is still being extensively used in many developed and developing countries including India due to its low cost. During the period from 2005 to 2010, total consumption of endosulfan in India was estimated

Abbreviations: ACIN1, apoptotic chromatin condensation inducer 1 isoform 1; ARNT2, aryl-hydrocarbon receptor nuclear translocator 2; CYP8B1, cytochrome P450 family 8 subfamily B polypeptide; H2BFWT, histone H1.2, H2B histone family member W, testisspecific (T); HIST2H4A, histone cluster 2, H4a; NFAT5, nuclear factor of activated T-cells 5; PHLDA1, pleckstrin homology-like domain family A member 1; PLAA, phospholipase A2-activating protein; PAX1, paired box 1; PRDX3, peroxiredoxin; NRAP, nebulin-related anchoring protein; UPP1, uridine phosphorylase 1; ZNF, zinc finger protein. ⁎ Corresponding author. E-mail address: [email protected] (S. Saravanadevi).

as 15,537 metric tonnes [6]. India has agreed to phase out use of endosulfan by 2017 in the Stockholm convention 2011 [7]. Due to its lipophilic nature, endosulfan has been reported to bioaccumulate and biomagnify in animals and humans [8]. Studies have shown that endosulfan exposure affects various organ systems and physiological functions in mammals, including reproductive [9], nervous [10], endocrine [11], immune [12] and hepatic systems [2]. It is also reported to exert genotoxic effects in mammalian germ cells [13], bacterial cells [14], human lymphocytes [3], and HepG2 cells [15]. In addition, endosulfan exposure can induce teratogenic effects [16] and oxidative stress [17] in mammalian cells. In recent times, studies are considering genomic [4] and proteomic profiling [18] of different experimental models to understand the molecular or biological pathways of toxicity induced by xenobiotic compounds. Hepatic cell line (HepG2 cells) is increasingly being used as in vitro model to determine the metabolism and actions of xenobiotics [2,19]. Hepatic cells play an important role in metabolism, detoxification, storage and excretion of xenobiotics. This makes them the most sensitive model for studying chemical induced toxicity [20]. Till date, there are no available reports on the effect of endosulfan on global gene and protein expression profile of hepatic cells. Thus, a comparative analysis of gene expression and proteomic analysis may enhance the understanding of the possible molecular mechanisms of endosulfan induced toxicity in mammalian system. Herein, we report multiple genomic and proteomic signatures involved in endosulfan induced toxicity in hepatocellular carcinoma cells using an integrated approach.

http://dx.doi.org/10.1016/j.pestbp.2015.06.008 0048-3575/© 2015 Elsevier Inc. All rights reserved.

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

2

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

2. Materials and methods

functional annotation clustering tool, Database for Annotation, Visualization, and Integrated Discovery (DAVID, http://david.abcc.ncifcrf.gov/).

2.1. Chemicals and cell culture 2.5. Quantitative polymerase chain reaction (qPCR) Dulbeco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), penicillin, streptomycin and 3-(4, 5-dimethylthiazol-2-yl)-2, 5diphenyltetrazolium bromide (MTT) were obtained from Gibco (Life Technology, Spain). Dimethyl sulfoxide (DMSO) and endosulfan [mixture of endosulfan α and β isomers (7:3)] were obtained from Sigma Aldrich (USA). HepG2 cell line was obtained from National Cell Centre for Cell Science (NCCS, India) and maintained in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin. The cells were grown in humidified 5% CO2 incubator at 37 °C. The stock solution of endosulfan was prepared in DMSO (vehicle). In all the experiments the final vehicle concentration was maintained at 0.01% of the culture medium while adding different concentrations of endosulfan to the cells. 0.01% DMSO was used as vehicle control. 2.2. Cell viability assay Cytotoxicity of endosulfan was determined on HepG2 cells. The cells were seeded in 96-well plate at a density of 1 × 104 cells per well in 200 μl DMEM medium and incubated for 24 h. After the incubation cells were exposed to different concentrations of endosulfan (5, 10, 20, 30, 40, 50 and 100 μM) and 0.01% DMSO (control) for 24 h. The cells were further processed for MTT assay as described earlier [21]. The assay was done in triplicate, and the results were expressed as % viability using negative control as 100%. Lethal concentration-50 (LC50) of endosulfan was estimated using dose response curve analysis. 2.3. Microarray preparation and processing HepG2 cells were exposed to sublethal concentration (15 μM) of endosulfan and 0.01% DMSO (control) for 24 h. Total RNA was isolated using RNeasy mini kit (Qiagen, UK). The quality of the isolated RNA was estimated using Bioanalyzer 2100 (Agilent, USA). Gene expression analysis was performed on Singlecolor.27114 (Human), 8*60 array format gene chip (Agilent, USA). RNA samples with 28S/18S rRNA ratio greater than 1.5 and RIN value ≥ 7 were used for microarray analysis [22]. Fifty ng of total RNA was converted into Cy3 labeled cRNA using Quick Amp kit (Agilent, USA) following the manufacturer's protocol. The A260/280 nm ratio and yield of the cRNAs were determined using Agilent Bioanalyzer. cRNA from each samples were hybridized on slides for 16 h at 65 °C. Slides were washed twice with 2× saline sodium citrate (SSC) containing 1% sodium dodecyl sulphate (SDS) at 68 °C for 30 min each, followed by washing with 0.5× SSC containing 0.5% SDS at room temperature for 30 min at 10 rpm. The slides were then scanned using microarray scanner (Agilent, USA). 2.4. Microarray data analysis Gene expression data was normalized with Gene spring Gx12.5 software (Agilent, USA). Genes showing low intensity were filtered by excluding the probes of intensities less than 20.0 percentile in the raw data. This was followed by pre-processing, normalization and quality control analysis. The total number of probe sets selected for the experiment was 50,294. One way ANOVA was applied to determine the statistical significance of the differentially expressed genes between the control and exposed cells at the p-value cut off of 0.05. Gene microarray data was submitted to National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) repository and can be accessible under accession no. GSE58257. Gene functional annotation analysis was performed to determine molecular function, biological processes and cellular component of differentially expressed genes using

Total RNA was extracted from the endosulfan exposed and control cells as described above. RNA was converted to cDNA using high capacity cDNA reverse transcription kit (Applied Biosystems, USA). Prior to the gene expression analysis, primer efficiency (80–120%) was confirmed. qPCR was performed using SYBR Green PCR master mix (Applied Biosystems, USA) on ABI 7200 thermal cycler. List of PCR primers of the selected genes used for validation of microarray result is given in Table 1. RNA polymerase II (RPII) was used as internal control as described earlier [23]. Initial denaturation at 95 °C for 10 min was followed by 40 cycles of reaction using following parameters: 95 °C for 15 s, primer annealing at 54–59 °C for 10 s, and primer extension at 72 °C for 30 s. The Ct value of each target gene was normalized with Ct value of internal control gene (RPII). The experiment was performed with three biological replicates, and each replicate was analyzed in duplicate. Relative fold change between exposed and control samples was calculated using ddCT method (2^-ddCt) and statistical significance was determined using t-test. 2.6. Two-dimensional electrophoresis (2DE) After 24 h exposure to 15 μM of endosulfan and 0.01% DMSO (control), the cells were washed with serum free medium and protein was extracted [24]. Cell lysate was centrifuged at 15,000 g for 10 min at 4 °C. Isoelectric focusing (IEF) was carried out on a non-linear 17 cm immobilized pH gradient (IPG) strips (pH 3–10) followed by electrophoresis on 12% SDS-PAGE gel. Image analysis and densitometry were performed as described in our earlier publication [24]. The experiment was performed in triplicate and the spots showing significant (p b 0.05) differential expression were excised by robotic spot cutter (Bio-Rad, USA). 2.7. Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI–TOF–MS) Excised protein spots were destained and digested with trypsin using In–gel tryptic digestion kit as per manufacturer's instructions (Thermo Scientific, USA). The digested peptides were extracted, dried completely by lyophilization and suspended in Tris–acetate buffer. The peptide suspension was mixed with equal volume of matrix solution containing 5 mg/ml α-cyano-4-hydroxycinnamic acid (CHCA) in 50% acetonitrile, 0.1% (v/v) TFA and 2% (w/v) ammonium citrate. 2 ul of peptide–matrix mix was spotted onto the MALDI plate (Bruker Daltonics, USA). After air drying, the sample was analyzed on ULTRAFLEX III MALDI–TOF–MS (Bruker Daltonics, USA) and peptide mass finger print was obtained by using Flex analysis software (Bruker Daltonics, USA). The masses obtained in the peptide mass fingerprints were submitted to Mascot (Matrix Science, UK) search conducted against NCBI protein database for identification of the respective proteins. Biological function of the identified proteins was determined using UniProt database. 2.8. Western Blotting analysis Expression pattern of ACIN1 was determined by western blot analysis. β-actin expression was used for normalization. 150 μg of protein extract from control and endosulfan-exposed cells was electrophoresed on 10% SDS-PAGE gel followed by blotting onto nitrocellulose membrane. β-actin was detected with mouse anti-β-actin monoclonal antibody (Santa Cruz Biotechnology, USA) at 1:200 dilution, while ACIN1 was detected with mouse anti-β-acinus monoclonal antibody (Santa Cruz Biotechnology, USA) at 1:100 dilution. The blot was visualized by

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

3

Table 1 List of qPCR primers. Genea

Forward primer

Reverse primer

Annealing temperature (°C)

Product size (bp)

ARNT2 UPP1 LAMA3 CYP20A1 KDSR CDKN2B PHLDA1 PRDX3 SOX9 ALDOA MAOA SAP30L CYP8B1 IC (RPII)

GCCGGCAGAGAATTTCAGGA ATTCAGGGCTTGGTGAGGTG GGCCAAGGACCTGAGGAATC GATGCCCTCATGCAACTGGA CGCATGTGGTGGTTACAGGA AGAGTGTCTCAGGGTGCAGA TCAACCGAAAGGGCAGATCC GTTGTCGCAGTCTCAGTGGA ACAATGCAAGCATGTGTCATCC GAGGCGTCCATCAACCTCAA GGAGGTGGCATTTCAGGACT ACCAGGCTTCAATAAGGCCC CTACCGCCTGCATCCTACAG GCACCACGTCCAATGACAT

GGTAGCCACCTGGGCAGAAA TGACGGGGCAATCATTGTGA CTTTTGCGCTTTGTGTTGCC ACAGATTGCCCAGGTACACA TGCAAAGCACCACCTGTTTG GACATCCCACGAGCCATCAT CAGTGAGGCAAGAGACAGCA AACAGCACACCGTAGTCTCG TCAAACTCTCTAGCCACAGCA GCAGCCTTCAGGTTCTCCTT TGGGTTGGTCCCACATAAGC CTTGCCACCCTCCGATTTCT CGAGGACAGGCAGAACAGAG GTGCGGCTGCTTCCATAA

59 58 58 56 56 54 54 54 54 56 56 56 56 54–59

175 200 197 195 171 164 230 143 124 137 164 148 170 267

a ARNT2 = aryl-hydrocarbon receptor nuclear translocator 2; UPP1 = uridine phosphorylase 1; LAMA3 = laminin alpha 3; CYP20A1 = cytochrome P450 monooxygenase; KDSR = 3ketodihydrosphingosine reductase; CDKN2B = cyclin-dependent kinase inhibitor 2B; PHLDA1 = pleckstrin homology-like domain, family A, member 1; PRDX3 = peroxiredoxin 3; SOX9 = SRY (sex determining region Y)-box 9; ALDOA = aldolase A, fructose-bisphosphate; MAOA = monoamine oxidase type A; SAP30L = SAP30-like; CYP8B1 = cytochrome P450 family 8 subfamily B polypeptide; IC = internal control; RPII = RNA polymerase II.

For the assessment of caspase-3 enzymatic activity, HepG2 cells were seeded in 96-well plate at a density of 20,000 cells/well and incubated for 24 h. Cells were exposed to different concentrations (3, 6, 7.5, 15 μM) of endosulfan and 0.01% DMSO (control) for 24 h. Caspase-3 activity was determined in cell lysates using fluorescence based caspase-3 assay kit according to manufacturer's protocol (Sigma-Aldrich, USA).

differentially expressed genes between control and endosulfan exposed cells. In Fig. 2B, the points (red) above the upper threshold are the upregulated genes (n = 94) upon endosulfan exposure, while those below the lower threshold line are the downregulated genes (n = 41). Further analysis using DAVID database revealed involvement of the differentially expressed genes in different cellular pathways (Table 2). Genes involved in transcription, oxidation reduction, transition metal ion binding, DNA binding, inflammatory response, carbohydrate metabolism, etc., were found to be upregulated. On the other hand, genes involved in cell surface receptor linked signal transduction, olfactory receptor activity, intracellular non-membrane-bounded organelle, etc., were found to be downregulated.

2.10. Statistical analysis

3.3. Validation of gene microarray results through qPCR

All results were expressed as mean ± standard error of the mean (SEM). The statistical significance was determined by Student's t-test using SPSS 19 software (USA). The difference between control and endosulfan treatment was considered significant at p b 0.05.

In order to validate the results obtained from gene microarray analysis, twelve representative genes showing ≥2 fold change in expression were chosen for qPCR analysis (Fig. 3). Table 3 shows the list of representative genes, their biological functions and fold change in their expression in microarray and qPCR analyses (p b 0.05). The genes found to be up and downregulated in microarray analysis followed similar expression pattern even in qPCR assay. Thus, results of qPCR analysis

using biotin labeled goat anti-mouse antibody followed by streptavidin conjugated quantum dots (Invitrogen, USA). The image was acquired under UV light using Versa Doc instrument (Bio-Rad Laboratories, CA). 2.9. Caspase-3 activity

3. Results 3.1. Cytotoxicity assessment of endosulfan MTT assay is a colorimetric assay to measure mitochondrial NAD(P)H-dependent oxidoreductase enzymes that reduce MTT to purple colored formazan. Since reduction of MTT can only occur in metabolically active cells, the level of activity is a measure of the viability of the cells. In the current study, MTT assay displayed dose dependent cytotoxicity at different concentrations of endosulfan in HepG2 cells (Fig. 1). Lethal concentration-50 (LC50) of endosulfan was observed to be 32 μM. Sublethal concentration (15 μM) of endosulfan was used for further studies. 3.2. Microarray analysis Microarray analysis (Fig. 2A) revealed differential expression of genes in hepatocellular carcinoma cells upon exposure to sublethal concentration (15 μM) of endosulfan. Bivariate scatter plot (Fig. 2B) showed the distribution of intensity values for each probe (representing gene) in control and exposed cells. Majority of the genes were clustered around the diagonal indicating nearly equal expression levels in control and exposed cells. However, some genes farther apart from the diagonal on either side showed differential expression. Based on these results, an optimum cut-off of 2.0 was selected which resulted in a false discovery rate (FDR) of 0.23. This analysis resulted in the identification of 135

Fig. 1. MTT assay showing dose-dependent cytotoxic effect of endosulfan on HepG2 cell viability. Error bars represent standard error (n = 3) and * indicates statistical significance (p b 0.05).

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

4

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Fig. 2. (A) Heat map of gene expression data from microarray analysis. The scale bar in the upper left corner shows the relative gene expression levels corresponding to the colors in the heat map. The degree of redness and blueness represent the degree of up and downregulation respectively. (B) Bivariate scatter plot showing the distribution of up and downregulated genes. Red spots represent differentially expressed genes with cut-off fold change ≥2. The red spots above the upper threshold line are the upregulated genes, while those below the lower threshold line are the downregulated genes in exposed sample as compared to control sample. Black spots represent no change in expression pattern. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).

corroborated the findings from microarray analysis. However, the fold change in expression was significantly different between the two analyses for few genes. For example, CYP8B1, which was 2.07 fold downregulated in microarray results, was the most downregulated gene (21.94 fold) in qPCR analysis. 3.4. Proteomic analysis 2DE and MALDI–TOF–MS analysis revealed the differential expressions of proteins in control and exposed cells after 24 h of exposure (Fig. 4). Table 4 presents the functions and fold change of the 19 significantly differentially expressed proteins (p b 0.05). These proteins were involved in multiple biological functions such as carbohydrate metabolism, apoptotic processes, protein transport, regulation of cytoskeleton organization, regulation of transcription, etc. In order to find out the consensus signatures of cellular response in endosulfan exposed cells, the results obtained through proteomic analysis were compared with those of microarray analysis. The consensus signatures specific to endosulfan exposure are presented in Table 5. It can be seen that they are involved in different cellular pathways like

carbohydrate metabolism, nucleosome assembly, actin filament-based movement, actin cytoskeleton organization, regulation of transcription and regulation of apoptosis. To confirm the results of proteomic analysis, over expression of ACIN1 (2.12 fold in proteomic analysis) was further analyzed by western blotting. ACIN1 is an important player in induction of apoptosis. It was found to be upregulated by 2.3 fold as compared to control in blotting results (Fig. 5), which is in agreement with the protein gel data.

3.5. Activation of apoptotic pathway The Caspase-3 activity was assayed in order to elucidate the involvement of endosulfan in triggering apoptotic signaling pathway (Fig. 6). Exposure to endosulfan showed a dose dependent increase in caspase3 activity. The caspase-3 activity at 3, 6, 7.5 and 15 μM of endosulfan was found to be 5.87, 5.89, 9.30 and 13.90 pmol/min/mg cell protein, respectively. The activity at all endosulfan concentrations was significantly higher (p b 0.05) than control (4.78 pmol/min/mg), confirming endosulfan-induced caspase-3 activation.

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

5

Table 2 Functional annotation of differentially expressed genes (cut-off of 2 fold change) identified by microarray analysis in endosulfan exposed cells. GO category Upregulated genes Biological process

Molecular function

Cellular component

Downregulated genes Biological process

Molecular function

Cellular component

GO term

Hits Gene name/transcript ID

Oxidation reduction Vesicle-mediated transport Proteolysis Protein catabolic process Inflammatory response Cytokine production Signal transduction Catecholamine metabolism Nervous system development Transcription

7 3 4 4 1 1 2 1 1 11

Nucleotide metabolic process Carbohydrate metabolism Phospholipid metabolic process Phosphorus metabolic process Phosphate metabolic process Protein amino acid phosphorylation Transition metal ion binding

1 1 1 4 4 2 22

Enzyme inhibitor activity Metallopeptidase activity DNA binding

5 4 11

Uridine phosphorylase activity Protein binding Nucleotide binding ATP binding Endomembrane system

1 2 5 3 7

Nuclear envelope–endoplasmic reticulum network Organelle membrane Endoplasmic reticulum Extracellular matrix Extracellular region Cell fraction Cytoplasma

4 6 5 4 7 3 2

KDSR, AOF1, ALOX5, HsapiAK021770, CYP26A1, ENOX2, HsapiAK026813 MON2, EXOC5, ENST00000320831 ADAM8, STAMBPL1, calpain 8, TLL2 MYSM1, STAMBPL1, NPLOC4, UBR2 PLAA NFAT5 NFAT5, PLAA MAOA PSPN AFF4, MYSM1, PHF21A, ARNT2, HOXC13, NFAT5, OVAL1, ZSCAN4, ZNF320, ZNF660, ZNF800 UPP1 PCK1 PLAA CDC42BPA, MON2, SNRK, CDC42BPA, MON2, SNRK, CDC42BPA, SNRK ADAM8, CDC42BPA, MYSM1, PHF21A, STAMBPL1, AOF1, ANKIB1, ALOX5, CYP20A1, CYP26A1, ENOX2, LOC151878, MEX3B, NPLOC4, OVOL1, RNF38, STEAP2, TLL2, UBR4, ZSCAN4, ZNF320, ENST00000382909 WFIKKN2, SERPINB8, SERPINB9, TFPI2, CDKN2B ADAM8, MYSM1, STAMBPL1, TLL2 NFAT5, ARNT2, ZNF320, ZSCAN4, SETBP1, OVOL1, LOC151878, HOXC13, PHF21A, AFF4, AK000177 UPP1 NFAT5, PLAA CDC42BPA, SNRK, CDC42BPA, SNRK, HsapiAK093874/KDSR, ALOX5, CYP26A1, HsapiAK026813, ENST00000320831, NPLOC4, HsapiAK025800 HsapiAK093874/KDSR, CYP26A1, ENST00000320831, NPLOC4 HsapiAK093874/KDSR, CYP26A1, ENST00000320831, MON2, ALOX5, HsapiAK026813 KDSR, MON2, ALOX5, NPLOC4, HsapiAK025437 LAMA3, OTOA, TFPI2, PSPN LAMA3, OTOA, TFPI2, WFIKKN2, TLL2, PRRG1, KDSR ALOX5, CYP26A1, SLC9A1 NFAT5, UPP1

Cell surface receptor linked signal transduction Sensory perception Sensory perception of chemical stimulus Neurological system process Positive regulation of biosynthetic process Regulation of apoptosis Phosphorus metabolic process Regulation of transcription Olfactory receptor activity Protein serine/threonine kinase activity ATP binding Nucleoside binding Nucleotide binding DNA binding Transition metal ion binding Mitochondria Integral to membrane Plasma membrane Intracellular non-membrane-bounded organelle Nucleolus Organelle lumen Cytoskeleton

7 4 3 4 3 3 3 5 3 3 3 3 3 5 4 1 6 3 7 3 4 5

CGB5, DOK5, OR5B12, OR51D1, OR8B2, PREX2, WNT7B OR51D1, OR8B2, PREX2, MYO3A OR8B2, PREX2, MYO3A OR51D1, OR8B2, PREX2, MYO3A SOX9, PAX1, TLR7 SOX9, PRDX3, PHLDA1 SOX9, PRDX3, PHLDA1 SAP30L, SOX9, PAX1, PRDX3, ZNF99, ZNF676 OR8B2, PREX2, MYO3A HsapiAK026851, CAMK2B, MYO3A HsapiAK026851, CAMK2B, MYO3A HsapiAK026851, CAMK2B, MYO3A HsapiAK026851, CAMK2B, MYO3A SOX9, PAX1, ZNF99, HIST2H4A, H2BFWT CYP8B1, RKHD1, TPH1, ZNF99 MAOA C12orf53, CYP8B1, OR8B2, PREX2, MYO3A, TLR7 OR8B2, PREX2, MYO3A SAP30L, SOX9, ALDOA, HIST2H4A, KRT72, MYO3A, PHLDA1 SAP30L, SOX9, PHLDA1 SAP30L, SOX9, HIST2H4A, PHLDA1 ALDOA, HIST2H4A, KRT72, NRAP, H2BFWT

4. Discussion Liver derived HepG2 cell line has been used as an ideal model for many toxicity studies [2,19]. Endosulfan is reported to cause liver damage, but only few studies have reported the molecular mechanism involved in endosulfan induced toxicity in liver cells [25,26]. Hence, this study was focussed to analyze the global gene and protein expression profiling in endosulfan exposed HepG2 cells. Gene expression (Fig. 2 and Table 2) and proteomic analyses (Fig. 4 and Table 4) showed differential expression of 135 genes (fold change cut off ≥2.0) and 19 proteins

(fold change cut off ≥1.2), respectively in HepG2 cells after 24 h exposure to sublethal concentration (15 μM) of endosulfan. Microarray data analysis using DAVID database revealed that majority of the differentially expressed genes were involved in metabolism, immune/inflammatory response, regulation of transcription and apoptosis pathways. Certain genes involved in metabolic pathways (ARNT2, CYP26A1, and UPP1) showed upregulation when exposed to endosulfan (Table 2). Upregulation of ARNT2 is involved in many physiological pathways in response to environmental pollutant mediated toxicity, hypoxia and neuronal development [27]. Upregulation of

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

6

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Fig. 3. Bar graph showing the correlation of microarray data with qPCR-based transcript levels for an arbitrarily selected panel of genes. A normalized ratio (Y-axis) of more than 1 indicates upregulation, whereas a ratio of less than 1 indicates downregulation. Error bars represent standard error (n = 6) and * indicates statistical significance (p b 0.05).

ARNT2 was suggested as the possible mechanism of cardiac malformation and developmental abnormalities in embryo of polychlorinated biphenyls (PCBs) exposed zebra fish [28]. Thus, being a polychlorinated compound, endosulfan can also exhibit similar effects as PCBs on the ARNT2 mediated signaling pathway. UPP1 is involved in phosphorylytic cleavage in uridine pathway. It mediates reversible phosphorylytic cleavage resulting in the formation of uracil and ribose- or deoxyribose-1phosphate from uridine and deoxyuridine [29]. Increased level of UPP1 transcript may exert inhibitory effects on several pathways downstream of uridine, such as RNA/DNA and membrane synthesis, protein glycosylation and neurodegeneration [29]. Exposure to xenobiotic compounds often leads to the overexpression of heat shock proteins (HSPs) as a stress defense mechanism [30]. However, this study did not show upregulation of HSPs in endosulfan exposed HepG2 cells. Similar findings were reported by Ait-Aissa et al. [31] in HeLa cells. Endosulfan exposure was found to upregulate key genes (NFAT5, PLAA and MYSM1) involved in immune and inflammatory responses.

These results are in agreement with earlier studies, which showed that exposure of endosulfan induces immune and inflammatory response [12]. NFAT5 gene is over-expressed in hypertonic condition which further stimulates the expression of various pro-inflammatory cytokines during ambient tonicity, and this leads to anisotonic and inflammatory disorders [32]. Results obtained in this study revealed that endosulfan may cause inflammatory disorders via upregulation of NFAT5. PLAA is considered to be an important molecule in the regulation of cyclooxygenase-2 and tumor necrosis factor mediated inflammation [33]. Similarly, Mysm1 is involved in the transcriptional regulation of many genes (such as ATM) engaged in inflammatory response through antioxidant and DNA damage/repair signaling pathways [34]. Endosulfan exposed cells showed altered expression of genes (upregulated: Zscan4 and SNRK; downregulated: SAP30L, SOX9, PAX1, PRDX3 and ZNF320) involved in the transcriptional regulation processes. Alterations in key genes involved in transcriptional regulatory pathways may lead to changes in the downstream targets. Zscan4 is reported to be involved in genomic stability and telomere maintenance

Table 3 Validation of selected genes from microarray data by qPCR. Gene IDa

Biological function

PRDX3 ALDOA SOX9 MAOA

Peroxidase activity, caspase inhibitor activity Fructose–bisphosphate aldolase activity Germ-line sex determination Monoamine oxidases (MAO) catalyze the oxidation of monoamine neurotransmitters such as dopamine, serotonin and adrenalin. Part of Sin3A-histone deacetylase (HDAC) co-repressor complex which regulates gene expression by deacetylating histones Regulation of apoptosis Bile acid biosynthesis Uridine phosphorylase activity Transcription regulation, response to hypoxia, central nervous system development, response to xenobiotic stimulus Regulation of cell adhesion and migration Monooxygenase activity, metal ion binding Catalyzes the reduction of 3-ketodihydrosphingosine (KDS) to dihydrosphingosine (DHS) Regulation of cyclin-dependent protein kinase activity, negative regulation of cell proliferation

SAP30L PHLDA1 CYP8B1 UPP1 ARNT2 LAMA3 CYP20A1 KDSR CDKN2B a

Fold change in qPCR

Fold change in microarray

Regulation

3.17 7.83 3.86 4.07

5.36 13.8 1.56 6.02

Down Down Down Down

3.24

2.37

Down

1.61 21.94 4.72 2.34

1.86 2.07 2.55 2.63

Down Down Up Up

1.52 2.1 1.38 5.86

5.16 1.19 3.06 3.63

Up Up Up Up

Gene names are given in Table 1.

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

7

Fig. 4. Effect of endosulfan on protein expression profile of HepG2 cells. (A) 2D gel image of the cellular protein profile of endosulfan exposed HepG2 cells. (B) Enlarged view of equivalent regions from 2D gel profiles of control cells (complete gel image not shown) and exposed cells, showing differentially expressed proteins which have been numbered 1 through 19.

[35]. Upregulation of Zscan4 may result in genomic instability in embryonic stem cells [35]. SNRK is reported to act as a tumor suppressor. Other genes observed in this study, i.e. PAX1, PRDX3 and ZNF320, have been reported to play important roles in the fetal development, anti-oxidation and transcriptional regulation processes, respectively [36,37]. CYP8B1 is a key enzyme involved in bile acid biosynthetic pathway which converts chenodeoxycholic acid (CDCA) to cholic acid (CA). Endosulfan has already been reported to affect primary bile acid biosysnthesis [38]. Downregulation of CYP8B1 in endosulfan exposed HepG2 cells suggests its possible effects on bile acid biosynthetic pathway.

2DE and MALDI–TOF–MS analysis (Fig. 4 and Table 4) of endosulfan exposed cells showed differential expression of 19 proteins. Biological functions and cellular pathways of the identified proteins were analyzed using UniProt database. Comparison of the microarray and proteomic data (Table 5) revealed the differential expression of common pathways involved in the cellular response to endosulfan. Although genomic data did not correspond to proteomic data at individual gene/ protein level, involvement of common pathways were suggested by both analyses. This may be due to multiple levels of regulation of genes/proteins, such as transcription, translation, post-translational, gene/protein stability and epigenetic controls. The interplay of genes

Table 4 Identification of differentially expressed protein spots in 2D electrophoresis. Spot Accession no. no.

Gene

Function

Fold Regulation change

PYGM HIST1H1C MYO5A

Carbohydrate metabolism Nucleosome assembly Protein transport, cellular response to insulin stimulus

5.67 1.70 3.49

Up Up Up

4 5 6 7

gi|5032009 Glycogen phosphorylase, muscle form (EC 2.4.1.1) gi|197692219 Histone H1.2 (Histone H1d) gi|119597855 Myosin VA (heavy polypeptide 12, myoxin), isoform CRA_c gi|19856971 Nebulin gi|90110065 Splicing factor, arginine/serine-rich 16 gi|119571241 hCG1812075 [Homo sapiens] gi|119631907 Nebulin, isoform CRA_d

NEB CLASRP

3.04 1.69 1.27 1.52

Up Up Up Up

8

gi|119583974 Adrenergic, alpha-1A-, receptor, isoform CRA_b

ADRA1A

1.23

Up

9 10

gi|122937416 Hypothetical protein LOC85452 gi|51173722 Peregrin (Bromodomain and PHD finger-containing protein 1) (BR140 protein) gi|4580707 Putative espin gi|62702272 Unknown gi|29792163 Histone-lysine N-methyltransferase, H4 lysine-20 specific (EC 2.1.1.43) gi|109082930 PREDICTED: Apoptotic chromatin condensation inducer 1 isoform 1 gi|5453726 Leucine-rich repeat flightless-interacting protein 2 isoform 1 gi|119586305 Bromodomain adjacent to zinc finger domain, 1A, isoform CRA_b gi|94466372 MORC2 protein gi|119612952 hCG40434, isoform CRA_b gi|49574543 Zinc finger protein 616

– BRPF1

1.95 2.30

Up Up

ESPN – SETD8

Regulation of actin filament length mRNA processing and splicing Unknown Regulation of actin filament length, muscle organ development Regulation of cell proliferation, intracellular signal transduction, apoptotic process, negative regulation of synaptic transmission, phospholipase C-activating G-protein coupled receptor signaling pathway Unknown Histone H3 acetylation and positive regulation of transcription Regulation of cytoskeleton organization – Transcription regulation and cell cycle

2.24 3.08 1.51

Up Up Up

ACIN1

Positive regulation of apoptosis and RNA splicing

2.12

Up

LRRFIP2

Wnt Signaling pathway

2.23

Up

BAZ1A

Regulation of transcription and chromatin remodeling

1.40

Up

MORC2 Not available ZF616

Transcription repressor Unknown Regulation of transcription

1.54 2.23 1.39

Up Up Down

1 2 3

11 12 13 14 15 16 17 18 19

Protein

NEB

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

8

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

Table 5 Identification of molecular signatures and associated cellular pathway in endosulfan exposed HepG2 cells. Proteomic data

Transcriptomic data

Cellular pathway

Glycogen phosphorylase (PYGL) Histone H1.2 (H1.2) Myosin VA (MYO5A) Nebulin (NEB) Zinc finger protein 616 (ZNF616) Apoptotic chromatin condensation inducer 1 isoform 1

Phosphoenolpyruvate carboxykinase 1 (PCK1) H2B histone family member W, testis-specific (H2BFWT); Histone cluster 2, H4a (HIST2H4A) Myosin 3A (MYO3A) Nebulin-related anchoring protein (NRAP) Zinc finger protein encoding genes (ZNF 320, ZNF676, ZNF660, ZNF800) Pleckstrin homology-like domain, family A, member 1 (PHLDA1)

Carbohydrate metabolism Nucleosome assembly Actin filament-based movement Actin cytoskeleton organization Regulation of transcription Regulation of apoptosis

and proteins identified in this study might together co-ordinate the response of HepG2 cells to endosulfan. Expression of phosphoenolpyruvate carboxykinase 1 (PCK1) gene was found to be upregulated in microarray analysis, whereas the proteomic analysis showed over-expression of glycogen phosphorylase protein. Both these signatures are involved in carbohydrate metabolism. Endosulfan has already been reported to induce deleterious effect on carbohydrate metabolism and cause metabolic disorders such as hyperglycemia [39]. Carbohydrate metabolism has a crucial role in maintaining the blood glucose levels via gluconeogenesis and glycogenolysis [40]. Glycogen phosphorylase catalyzes the rate limiting reaction in glycogenolysis by cleaving glucose-1-phosphate from the terminal alpha1,4-glycosidic bond [41]. Similarly, PCK1 is involved in catalyzing an initial step in gluconeogenesis [42]. Over expression of PCK1 and glycogen phosphorylase in exposed cells signifies the deleterious effects of endosulfan on carbohydrate metabolism in HepG2 cells. Differential expressions of genes (H2BFWT and HIST2H4A) and protein (Histone H1.2) involved in nucleosome assembly was observed in this study. H1 histones are specifically engaged in compacting the higher order chromatin structures and transmission of apoptotic signals from nucleus to cytosol [43]. H1, H2BFWT and HIST2H4A histones regulate gene expression via modulating the access of remodeling, regulatory and transcription factors to their target sites [44]. Thus, the result illustrates the ability of endosulfan to interfere with transcription and nucleosome assembly process. Comparison of gene expression and proteomic analysis also revealed the differential expression of key genes/proteins involved in the muscle contraction/eukaryotic motility processes (Myosin3A and MyosinVA) [45], cell structure and cytoskeleton organization (nebulin and NRAP) [46], and transcriptional regulation processes (ZNF616, ZNF 320, ZNF676, ZNF660 and ZNF800) [47]. Thus, it can be inferred that endosulfan can deregulate important cellular cascades involved in structural organization, muscle mobility and gene regulation processes. Comparative analysis revealed the upregulation of ACIN1 protein and downregulation of PHLDA1 gene (Table 5) in endosulfan exposed cells. Both are involved in the regulation of apoptosis [48]. The upregulation of ACIN1 observed in 2D PAGE was confirmed by Western blotting. ACIN1 induces apoptotic chromatin condensation after cleavage by caspase-3 [48]. Further, caspase-3 activity was found to increase in HepG2 cells upon endosulfan exposure (Fig. 6). This confirms that endosulfan can trigger apoptosis by activation of caspase-3 followed by ACIN1.

Fig. 5. Western blot analysis of ACIN1 expression in control and endosulfan exposed HepG2 cells. β-actin served as internal control. C: control sample and E: exposed sample.

The ability of endosulfan to alter expression of different transcriptional regulators, metal binding and DNA binding proteins could be one of the reasons for endosulfan's ability to alter many cellular pathways. Further investigations are needed to find out the role of each indicated gene/protein in endosulfan toxicity. Common signatures identified in this study could provide molecular insight in endosulfan toxicity.

5. Conclusion Persistence of endosulfan around the globe is a matter of great concern. Efforts are needed to identify molecular fingerprints specific to endosulfan exposure. Present study illustrates alterations in multiple cellular pathways in endosulfan exposed hepatocellular carcinoma cells through genomic and proteomic tools. This approach can also be used for identification and development of specific biomarkers for other xenobiotic chemicals.

Conflict of interest The authors declare no conflict of interest.

Acknowledgments The authors are thankful to the Department of Biotechnology (DBT) (G-1-1872) for providing research funding and to CSIR-NEERI for providing necessary facilities. Deepa Gandhi is grateful to the Department of Science and Technology (DST), India for the award of a senior research fellowship (number IF110408).

Fig. 6. Effect of endosulfan on caspase-3 activity in HepG2 cells. Error bars represent standard error (n = 3) and * indicates statistical significance (p b 0.05).

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008

D. Gandhi et al. / Pesticide Biochemistry and Physiology xxx (2015) xxx–xxx

References [1] E. Capkin, I. Altinok, S. Karahan, Water quality and fish size affect toxicity of endosulfan, an organochlorine pesticide, to rainbow trout, Chemosphere 64 (2006) 1793–1800. [2] A.C. Crupkin, P. Carriquiriborde, J. Mendieta, A.M. Panzeri, M.L. Ballesteros, K.S.B. Miglioranza, M.L. Menone, Oxidative stress and genotoxicity in the South American cichlid, Australoheros facetus, after short-term sublethal exposure to endosulfan, Pestic. Biochem. Physiol. 105 (2013) 102–110. [3] N. Kumar, P.A.J. Prabhu, A.K. Pal, S. Remya, Md. Aklakur, R.S. Rana, S. Gupta, R.P. Raman, S.B. Jadhao, Anti-oxidative and immuno-hematological status of tilapia (Oreochromis mossambicus) during acute toxicity test of endosulfan, Pestic. Biochem. Physiol. 99 (2011) 45–52. [4] A. Sharma, M. Mishra, K.R. Ram, R. Kumar, M.Z. Abdin, D.K. Chowdhuri, Transcriptome analysis provides insights for understanding the adverse effects of endosulfan in Drosophila melanogaster, Chemosphere 82 (2011) 370–376. [5] J. Weber, C.J. Halsall, D. Muir, C. Teixeira, J. Small, K. Solomon, M. Harmanson, H. Hung, T. Bidleman, Endosulfan, a global pesticide: a review of its fate in the environment and occurrence in the Arctic, Sci. Total Environ. 408 (2010) 2966–2984. [6] http://www.indiaforsafefood.in/farminginindia.html (Last accessed May 15, 2015). [7] http://www.ndtv.com/india-news/india-to-phase-out-use-of-endosulfan-by-2017government-647081 (Last accessed May 15, 2015). [8] G.N. Rallis, V.A. Sakkas, V.A. Boumba, T.V. Ougiouklakis, T.A. Albanis, Determination of organochlorine pesticides and polychlorinated biphenyls in post-mortem human lung by matrix solid-phase dispersion with the aid of response surface methodology and desirability function, J. Chromatogr. A 1227 (2012) 1–9. [9] Z. Han, S. Jiao, D. Kong, Z. Shan, X. Zhang, Effects of β-endosulfan on the growth and reproduction of zebrafish (Danio rerio), Environ. Toxicol. Chem. 30 (2011) 2525–2531. [10] F. Mora, O. Ozmen, Endosulfan-induced neurotoxicity and serum acetylcholinesterase inhibition in rabbits: the protective effect of Vit C, Pestic. Biochem. Physiol. 96 (2010) 108–112. [11] R. Coskun, K. Gundogan, F. Tanriverdi, M. Guven, M. Sungur, Effects of endosulfan intoxication on pituitary functions, Clin. Toxicol. 50 (2012) 441–443. [12] S. Ayub, J. Verma, N. Das, Effect of endosulfan and malathion on lipid peroxidation, nitrite and TNF-alpha release by rat peritoneal macrophages, Int. Immunopharmacol. 3 (2003) 1819–1828. [13] N. Pandey, F. Gundevia, A.S. Prem, P.K. Ray, Studies on the genotoxicity of endosulfan, an organochlorine insecticide, in mammalian germ cells, Mutat. Res. Toxicol. 242 (1990) 1–7. [14] K. Chaudhuri, S. Selvaraj, A.K. Pal, Studies on the genotoxicity of endosulfan in bacterial systems, Mutat. Res. 439 (1999) 63–67. [15] Y. Lu, K. Morimoto, T. Takeshita, T. Takeuchi, T. Saito, Genotoxic effects of αendosulfan and β-endosulfan on human HepG2 cells, Environ. Health Perspect. 108 (2000) 559–561. [16] P.K. Gupta, S.V. Chandra, D.K. Saxena, Teratogenic and embryotoxic effects of endosulfan in rats, Acta Pharmacol. Toxicol. 42 (1978) 150–152. [17] H.A.A. Aly, R.M. Khafagy, Taurine reverses endosulfan-induced oxidative stress and apoptosis in adult rat testis, Food Chem. Toxicol. 64 (2014) 1–9. [18] S.E. Lee, C. Young-Woong, H. Mo, J. Son, K. Park, K. Cho, Endosulfan-induced biomarkers in Japanese rice fish (Oryzias latipes) analyzed by SELDI–TOF–MS, Int. J. Biol. Sci. 9 (2013) 343–349. [19] F.L. Edwards, C.G. Yedjou, P.B. Tchounwou, Involvement of oxidative stress in methyl parathion and parathion-induced toxicity and genotoxicity to human liver carcinoma (HepG2) cells, Environ. Toxicol. 28 (2013) 342–348. [20] W. Tayeb, A. Nakbi, M. Trabelsi, N. Attia, A. Miled, M. Hammami, Hepatotoxicity induced by sub-acute exposure of rats to 2,4-Dichlorophenoxyacetic acid based herbicide “Désormone lourd”, J. Hazard. Mater. 180 (2010) 225–233. [21] A. Bafana, G. Kumar, S.M. Kashyap, G.S. Kanade, V.M. Shinde, Dynamics of effluent treatment plant during commissioning of activated sludge process unit, Environ. Sci. Pollut. Res. 22 (2015) 3538–3546. [22] K.J. Archer, V.R. Mas, T.R. O'Brien, R. Pfeiffer, N.L. Lum, R.A. Fisher, Quality assessment of microarray data in a multicenter study, Diagn. Mol. Pathol. 18 (2009) 34–43. [23] A.P. Daiwile, S. Sivanesan, A. Izzotti, A. Bafana, P.K. Naoghare, P. Arrigo, H.J. Purohit, D. Parmar, K. Kannan, Noncoding RNAs: possible players in the development of fluorosis, BioMed. Res. Int. (2015) (Article ID 274852, in press). [24] A. Dhondge, S. Surendran, M.V. Seralathan, P.K. Naoghare, K. Krishnamurthi, S.S. Devi, T. Chakrabarti, Cellular alterations and modulation of protein expression in

[25]

[26]

[27]

[28]

[29] [30] [31]

[32] [33]

[34]

[35] [36]

[37]

[38]

[39]

[40] [41]

[42]

[43] [44] [45] [46]

[47]

[48]

9

bitumen-challenged human osteoblast cells, Environ. Sci. Pollut. Res. Int. 19 (2012) 4030–4041. R.C.T. Casabara, P.C. Dasa, G.K. DeKreyb, C.S. Gardinerb, Y. Caoa, R.L. Rosea, A.D. Wallace, Endosulfan induces CYP2B6 and CYP3A4 by activating the pregnane X receptor, Toxicol. Appl. Pharmacol. 245 (2010) 335–343. M.O. Song, C.H. Lee, H.O. Yang, J.H. Freedman, Endosulfan upregulates AP-1 binding and ARE-mediated transcription via ERK1/2 and p38 activation in HepG2 cells, Toxicology 292 (2012) 23–32. X.Y. Qin, Y. Kojima, K. Mizuno, et al., Association of variants in genes involved in environmental chemical metabolism and risk of cryptorchidism and hypospadias, J. Hum. Genet. 57 (2012) 434–441. M. Li, X. Wang, J. Zhu, S. Zhu, X. Hu, C. Zhu, X. Guo, Z. Yu, S. Han, Toxic effects of polychlorinated biphenyls on cardiac development in zebrafish, Mol. Biol. Rep. 41 (2014) 7973–7983. A.I. Magold, M. Cacquevel, P.C. Fraering, Gene expression profiling in cells with enhanced gamma-secretase activity, PLoS One 4 (2009) e6952. O. Carnevali, F. Maradonna, Exposure to xenobiotic compounds: looking for new biomarkers, Gen. Comp. Endocrinol. 131 (2003) 203–208. S. Ait-Aissa, J. Porcher, A. Arrigo, C. Lambre, Activation of the hsp70 promoter by environmental inorganic and organic chemicals: relationships with cytotoxicity and lipophilicity, Toxicology 145 (2000) 147–157. W. Neuhofer, Role of NFAT5 in Inflammatory disorders associated with osmotic stress, Curr. Genomics 11 (2010) 584–590. D.A. Ribardo, J.W. Peterson, A.K. Chopra, Phospholipase A2-activating protein—an important regulatory molecule in modulating cyclooxygenase-2 and tumor necrosis factor production during inflammation, Indian J. Exp. Biol. 40 (2002) 129–138. A. Nijnik, S. Clare, C. Hale, et al., The critical role of histone H2A-deubiquitinase Mysm1 in hematopoiesis and lymphocyte differentiation, Blood 119 (2012) 1370–1379. M. Zalzman, G. Falco, L.V. Sharova, et al., Zscan4 regulates telomere elongation and genomic stability in ES cells, Nature 464 (2010) 858–863. J. Liu, X. Zhan, M. Li, G. Li, P. Zhang, Z. Xiao, M. Shao, F. Peng, R. Hu, Z. Chen, Mitochondrial proteomics of nasopharyngeal carcinoma metastasis, BMC Med. Genomics 5 (2012) 62. O.B. Chernova, A. Hunyadi, E. Malaj, H. Pan, C. Crooks, B. Roe, J.K. Cowell, A novel member of the WD-repeat gene family, WDR11, maps to the 10q26 region and is disrupted by a chromosome translocation in human glioblastoma cells, Oncogene 20 (2001) 5378–5392. L. Softeland, J.A. Kirwan, T.S.F. Hori, et al., Toxicological effect of single contaminants and contaminant mixtures associated with plant ingredients in novel salmon feeds, Food Chem. Toxicol. 73 (2014) 157–174. B. Jyothi, G. Narayan, Certain pesticide-induced carbohydrate metabolic disorders in the serum of freshwater fish Clarias batrachus (Linn.), Food Chem. Toxicol. 37 (1999) 417–421. T. Kubota, N. Kubota, T. Kadowaki, The role of endothelial insulin signaling in the regulation of glucose metabolism, Rev. Endocr. Metab. Disord. 14 (2013) 207–216. B. Burwinkel, H. Bakker, E. Herschkovitz, S. Moses, Y.S. Shin, M.W. Kilimann, Mutations in the liver glycogen phosphorylase gene (PYGL) underlying glycogenosis type VI (Hers disease), Am. J. Hum. Genet. 62 (1998) 785–791. M. Abdollahi, M. Donyavi, S. Pournourmohammadi, M. Saadat, Hyperglycemia associated with increased hepatic glycogen phosphorylase and phosphoenolpyruvate carboxykinase in rats following subchronic exposure to malathion, Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 137 (2004) 343–347. A. Konishi, S. Shimizu, J. Hirota, et al., Involvement of Histone H1.2 in apoptosis induced by {DNA} double-strand breaks, Cell 114 (2003) 673–688. N. Happel, D. Doenecke, Histone {H1} and its isoforms: contribution to chromatin structure and function, Gene 431 (2009) 1–12. V.B. Siththanandan, J.R. Sellers, Regulation of myosin 5a and myosin 7a, Biochem. Soc. Trans. 39 (2011) 1136–1141. C.A.C. Ottenheijm, D. Buck, J.M. de Winter, et al., Deleting exon 55 from the nebulin gene induces severe muscle weakness in a mouse model for nemaline myopathy, Brain 136 (2013) 1718–1731. C. Chiang, K. Ayyanathan, Snail/Gfi-1 (SNAG) family zinc finger proteins in transcription regulation, chromatin dynamics, cell signaling, development, and disease, Cytokine Growth Factor Rev. 24 (2013) 123–131. S. Sahara, M. Aoto, Y. Eguchi, N. Imamoto, Y. Yoneda, Y. Tsujimoto, Acinus is a caspase-3-activated protein required for apoptotic chromatin condensation, Nature 401 (1999) 168–173.

Please cite this article as: D. Gandhi, et al., An integrated genomic and proteomic approach to identify signatures of endosulfan exposure in hepatocellular carcinoma cells, Pesticide Biochemistry and Physiology (2015), http://dx.doi.org/10.1016/j.pestbp.2015.06.008