- Email: [email protected]
Analyses of cytochrome b mutations in Plasmodium falciparum isolates in Thai-Myanmar border
ARTICLE IN PRESS Travel Medicine and Infectious Disease (2007) 5, 132–134
Available at www.sciencedirect.com
journal homepage: www.elsevierhealth.com/journals/tmid
Analyses of cytochrome b mutations in Plasmodium falciparum isolates in Thai-Myanmar border Yasuko Naoshima-Ishibashia,b, Moritoshi Iwagamia, Shin-ichiro Kawazua, Sornchai Looareesuwanc, Shigeyuki Kanoa,b, a
Research Institute, International Medical Center of Japan, 1-21-1 Toyama, Shinjuku, Tokyo 162-8665, Japan Graduate School of Comprehensive Human Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8577, Japan c Faculty of Tropical Medicine, Mahidol University, 420/6 Ratchawithi Rd, Bangkok 10400, Thailand b
Received 8 December 2005; received in revised form 13 July 2006; accepted 19 July 2006 Available online 20 September 2006
KEYWORDS Malaria; MalaroneTM; Prophylaxis; Traveler; Drug resistance
Summary Background: The combination of atovaquone and proguanil (MalaroneTM) has been established as a drug of choice to prevent and treat multi-drug resistant Plasmodium (P.) falciparum malaria in travelers. However, several cases of resistance against MalaroneTM have been reported in some parts of Africa, and many of the cases are believed to be associated with mutations at the codon 268 of cytochrome b gene in mitochondria of P. falciparum. The aim of the study was to estimate the effectiveness of MalaroneTM in treatment and prophylaxis for the travelers to Thai-Myanmar border where multi-drug resistant malaria is highly endemic. Methods: Seventy P. falciparum samples obtained from patients from Thai-Myanmar border were sequenced to detect mutations around the codon 268. The same samples were also sequenced to detect P. falciparum chloroquine resistance transporter mutation (PfCRT K76T). Results: All the 70 samples showed no mutations at the codon 268 of cytochrome b gene. Whereas, 50 samples, whose pfcrt genes were sequenced successfully, had an identical genotype for K76T mutation. Conclusion: In Asian countries, even in the multi-drug resistant areas in the great Mekong region, no case of MalaroneTM resistance has been reported clinically or genetically thus far. In this study, all the P. falciparum parasites tested successfully were shown to be chloroquine resistant but atovaquone susceptible genetically. The more the usefulness of MalaroneTM increases for both treatment and prophylaxis, the wider the drug-resistance against MalaroneTM may spread in the region. Although the total number of samples
Corresponding author. Research Institute, International Medical Center of Japan, 1-21-1 Toyama, Shinjuku, Tokyo 162-8665, Japan.
Tel.: +81 3 3202 7181; fax: +81 3 3202 7364. E-mail address: [email protected] (S. Kano). 1477-8939/$ - see front matter & 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.tmaid.2006.07.002
ARTICLE IN PRESS Analyses of cytochrome b mutations in Plasmodium falciparum
133
examined is not large, it is concluded from these findings that MalaroneTM should be recommended for prophylaxis of malaria for travelers to the Mekong region. & 2006 Elsevier Ltd. All rights reserved.
Introduction The 2-hydroxynaphthoquinone derivative, atovaquone, which functions as a structural analog of coenzyme Q in the mitochondrial electron-transport chain and destroys the organellar membrane potential, has been used as a clinical antimalarial drug particularly in combination with the biguanide proguanil (as MalaroneTM).1–3 And it has been established as a drug of choice to prevent and treat multidrug resistant P. falciparum malaria in travelers.4 However, several cases of resistance against MalaroneTM have been reported in some parts of Africa,5 and many are believed to be associated with mutations at the codon 268 of cytochrome b gene in mitochondria of P. falciparum.6 Although MalaroneTM is used frequently for prophylaxis in drugresistant areas of Africa, clinical evaluation on its effectiveness in Asian multi-drug-resistant areas is limited.7 The objective of the study was to estimate genetically the effectiveness of MalaroneTM for treatment and prophylaxis for the travelers to Thai-Myanmar border where multi-drugresistant malaria is highly endemic.
Materials and methods Samples Seventy P. falciparum samples were taken from patients who contracted malaria in multi-drug resistant areas in Thai-Myanmar border. The patients were transferred to and admitted to the Hospital for Tropical Diseases, Mahidol University, Bangkok in 1999. Collection of patient specimens was approved by the Ethics Committee of the Faculty of Tropical Medicine, Mahidol University, Thailand. This survey also followed the ethical guidelines for epidemiological studies by the Ministry of Education, Culture, Sports, Science and Technology, and Ministry of Health, Labour and Welfare of Japan.
Polymerase chain reaction and genotyping cytb codon 268 Parasite DNA was extracted by established methods.8 Cytochrome b is 1131 bp length in P. falciparum (Genbank accession no. AY588280). Genotyping was focused on the latter part of the allele of ubiquinol binding pocket. In polymerase chain reaction, about 450-base pair fragment was amplified. The primer pairs were forward primer: 50 AGCAGTAATTTGGATATGTGGAGG-30 (450–473) (Genbank accession no. AY588280); reverse primer: 50 -ACAGAATAATCTCTAGCACC-30 (931–950) (Genbank accession no. AY588280).6 The reaction mixture consisted of DNA template 2 mL, Taq DNA polymerase 0.1 mL (0.5U), Buffer ( 10) 2.5 mL, 50 mM MgCl2 0.75 mL, each deoxynucleotide triphosphate 2 mL, 100 mM forward and reverse primer 0.25 mL. PCR was carried
out initially at 93 1C, 10 min, denaturing: 93 1C, 50 s, annealing: 45 1C, 50 s, extension: 70 1C, 60 s over 40 cycles. Amplified PCR products were confirmed by electrophoresis. Purification was performed with QIAquick PCR purification Kit (QIAGEN, Hilden, Germany). PCR for sequencing was carried out by using 0.8 mM reverse primer. pfcrt codon 76 PCR was performed (protocol was sited from the website of Maryland school of medicine center for vaccine development. URL: http://medschool.umaryland.edu/cvd/2002_ pcr_asra.htm). For the primary PCR, forward primer (TCRPA): 50 -ATGGCTCACGTTTAGGTGGAG-30 (Genbank accession no. AF030694); reverse primer (TCRT2): 50 -CGGATGTTACAAAACTATAGTTAC-30 (Genbank accession no. AF030694). The reaction mixture was the same as described above. PCR was carried out initially at 95 1C, 5 min, denaturing: 92 1C, 30 s, annealing: 45 1C, 30 s, extension: 65 1C, 45 s over 45 cycles, final extension: 72 1C, 15 min. Secondary PCR is 2 mL of primary reaction for DNA template, other materials are the same with primary PCR. Secondary primers are forward primer (TCRD1): 50 -TGTGCTCATGTGTTTAAACTT-30 (Genbank accession no. AF030694); reverse primer (TDRD2): 50 CAAAACTATAGTTACCAATTTTG-30 (Genbank accession no. AF030694). PCR was carried out initially at 95 1C, 5 min, denaturing: 92 1C, 30 s, annealing: 45 1C, 30 s, extension: 65 1C, 30 s, for over 30 cycles, final extension: 72 1C, 15 min. PCR for sequencing was done using 0.8 mM sense primer for secondary PCR. Sequencing The PCR products sequencing was done on Applied Biosystem 310 Genetic Analyzer (Perkin-Elmer, Les Ulis, France), using ABI PRISM Big Dye Terminator v.3.1 (Perkin-Elmer).
Results All the 70 samples had no mutations at the cytb codon 268. In fact, 61 out of the 70 samples, whose cytb genes could be sequenced successfully, showed identical sequence at the nucleotide level (from cytb codons 267–284) of which allele is TTTTATGCAATGTTAAAAACTGTTCCAAGTAAACCAGCTGGTTTAGTAATTGTA. On the other hand, 50 out of 70 samples, whose pfcrt genes could be sequenced successfully, had an identical genotype for the K76T mutation.
Discussion Atovaquone has been approved by the Food and Drug Administration (FDA) USA and introduced into practice in 1995. Only during the last decade, the use of this drug may have developed atovaquone-resistant parasites by mutating their amino acid residues located in or near the atovaquonebinding site on cytochrome b. A single nucleotide mutation
ARTICLE IN PRESS 134 at the codon 268 (Y268S) was suggested to be the index of atovaquone resistance,6 but other mutations, Y279S and L282V, were also predicted to be responsible for the resistance.9 Therefore, the alleles of the codons 267–284 of the 70 samples from P. falciparum patients in ThaiMyanmar border were examined and it was found that all the samples had no mutations at the cytb codon 268, and that 61 out of the 70 had identical alleles without any mutations at codons 267–284. In this study, 50 out of the 70 samples, whose pfcrt genes could be sequenced successfully, showed identical PfCRT K76T mutation, which has been found consistently in chloroquine-resistant parasites.10 In the Thai-Myanmar border, the clinical cure rate of chloroquine was reported to be less than 10% already in 1970s, and that of sulfadoxinepyrimethamine less than 10% in 1980s. In 2000, the cure rates of quinine and mefloquine fell to less than 60%.11 Some studies indicated a decrease of chloroquine-resistant genotype prevalence associated with cessation of chloroquine, suggesting the parasites’ reversion to wild type,12,13 but it was not the case with the isolates from the Thai-Myanmar border. Atovaquone is considered to be effective against both chloroquine-susceptible and chloroquine-resistant parasites, and atovaquone is not likely to have crossresistance to other anti-malarial drugs.5 Therefore, although multi-drug resistant P. falciparum parasites are prevalent in the Asian Mekong region, particularly in the Thai-Myanmar border areas, atovaquone will still be effective against those parasites in the region. Now, clinical studies on MalaroneTM have been conducted for hundreds of P. falciparum patients in Thailand,7,14 so that careful monitoring on atovaquone resistance is to be needed. Examination of molecular markers provides only a likely outcome of a treatment of prophylactic regimen, because the outcome is dependent on host factors such as the level of immunity, patient compliance or nutritional status,10 suggesting that not all of the atovaquone-resistance are associated with a mutated cytochrome b gene. Nevertheless, availability of the gene marker to monitor atovaquone-reisistant parasite populations provides a powerful tool to rationalize the deployment of MalaroneTM for travelers to the Southeast Asian region where multi-drug resistant malaria is highly endemic.
Conclusion From our results, MalaroneTM seemed to be effective for prophylaxis and treatment for travelers to the Mekong region at the moment. Further monitoring of atovaquoneresistant P. falciparum is needed for the rational use of this new antimalarial drug.
Acknowledgements This study was supported in part by a Grant-in-Aid for Scientific Research (B)(16406012) from the Ministry of
Y. Naoshima-Ishibashi et al. Education, Science, Sports, Culture of Japan, and a Mahidol University Grant.
References 1. Looareesuwan S, Viravan C, Webster HK, Kyle DE, Hutchinson DB, Canfield CJ. Clinical studies of atovaquone, alone or in combination with other antimalarial drugs, for treatment of acute uncomplicated malaria in Thailand. Am J Trop Med Hyg 1996;54:62–6. 2. Hogh B, Clarke PD, Camus D, Nothdurft HD, Overbosch D, Gunther M, et al. Atovaquone-proguanil versus chloroquineproguanil for malaria prophylaxis in non-immune travellers: a randomised, double-blind study. Malarone International Study Team. Lancet 2000;356:1888–94. 3. Overbosch D, Schilthuis H, Bienzle U, Behrens RH, Kain KC, Clarke PD, et al. Atovaquone-proguanil versus mefloquine for malaria prophylaxis in nonimmune travelers: results from a randomized, double-blind study. Clin Infect Dis 2001;33: 1015–21. 4. Shanks GD. Atovaquone/Proguanil. In: Schlagenhauf P, editor. Travelers’ malaria. London: BC Decker Inc; 2001. p. 227–46. 5. Basco LK, Ramiliarisoa O, Le Bras J. In vitro activity of atovaquone against the African isolates and clones of Plasmodium falciparum. Am J Trop Med Hyg 1995;53:388–91. 6. Korsinczky M, Chen N, Kotecka B, Saul A, Rieckmann K, Cheng Q. Mutations in Plasmodium falciparum cytochrome b that are associated with atovaquone resistance are located at a putative drug-binding site. Antimicrob Agents Chemother 2000;44: 2100–8. 7. Looareesuwan S, Chulay JD, Canfield CJ, Hutchinson DB. Malarone (atovaquone and proguanil hydrochloride): a review of its clinical development for treatment of malaria. Malarone Clinical Trials Study Group. Am J Trop Med Hyg 1999;60:533–41. 8. Sambrook J, Russell DW. Molecular cloning: a laboratory manual, 3rd ed. New York: Cold Spring Harbor Laboratory Press; 2001. 9. Kessl JJ, Ha KH, Merritt AK, Lange BB, Hill P, Meuniers B, et al. Cytochrome b mutations that modify the ubiquinol-binding pocket of the cytochrome bc1 complex and confer anti-malarial drug resistance in Saccharomyces cerevisiae. J Biol Chem 2005;280:17142–8. 10. Hyde JE. Drug-resistant malaria. Trends Parasitol 2005;21: 494–8. 11. Singhasivanon P. Antimalarial drug efficacy and resistance, Mekong Malaria II. Southeast Asian J Trop Med Pub Health 2003;34:71–87. 12. Kublin JG, Cortese JF, Njunju EM, Mukadam RA, Wirima JJ, Kazembe PN, et al. Reemergence of chloroquine-sensitive Plasmodium falciparum malaria after cessation of chloroquine use in Malawi. J Infect Dis 2003;187:1870–5. 13. Wang X, Mu J, Li G, Chen P, Guo X, Fu L, et al. Decreased prevalence of the Plasmodium falciparum chloroquine resistance transporter 76T marker associated with cessation of chloroquine use against P. falciparum malaria in Hainan, People’s Republic of China. Am J Trop Med Hyg 2005;72:410–4. 14. Looareesuwan S, Viravan C, Webster HK, Kyle DE, Hutchinson DB, Canfield CJ. Clinical studies of atovaquone, alone or in combination with other antimalarial drugs, for treatment of acute uncomplicated malaria in Thailand. Am J Trop Med Hyg 1996;54:62–6.
Available at www.sciencedirect.com
journal homepage: www.elsevierhealth.com/journals/tmid
Analyses of cytochrome b mutations in Plasmodium falciparum isolates in Thai-Myanmar border Yasuko Naoshima-Ishibashia,b, Moritoshi Iwagamia, Shin-ichiro Kawazua, Sornchai Looareesuwanc, Shigeyuki Kanoa,b, a
Research Institute, International Medical Center of Japan, 1-21-1 Toyama, Shinjuku, Tokyo 162-8665, Japan Graduate School of Comprehensive Human Sciences, University of Tsukuba, 1-1-1 Tennodai, Tsukuba, Ibaraki 305-8577, Japan c Faculty of Tropical Medicine, Mahidol University, 420/6 Ratchawithi Rd, Bangkok 10400, Thailand b
Received 8 December 2005; received in revised form 13 July 2006; accepted 19 July 2006 Available online 20 September 2006
KEYWORDS Malaria; MalaroneTM; Prophylaxis; Traveler; Drug resistance
Summary Background: The combination of atovaquone and proguanil (MalaroneTM) has been established as a drug of choice to prevent and treat multi-drug resistant Plasmodium (P.) falciparum malaria in travelers. However, several cases of resistance against MalaroneTM have been reported in some parts of Africa, and many of the cases are believed to be associated with mutations at the codon 268 of cytochrome b gene in mitochondria of P. falciparum. The aim of the study was to estimate the effectiveness of MalaroneTM in treatment and prophylaxis for the travelers to Thai-Myanmar border where multi-drug resistant malaria is highly endemic. Methods: Seventy P. falciparum samples obtained from patients from Thai-Myanmar border were sequenced to detect mutations around the codon 268. The same samples were also sequenced to detect P. falciparum chloroquine resistance transporter mutation (PfCRT K76T). Results: All the 70 samples showed no mutations at the codon 268 of cytochrome b gene. Whereas, 50 samples, whose pfcrt genes were sequenced successfully, had an identical genotype for K76T mutation. Conclusion: In Asian countries, even in the multi-drug resistant areas in the great Mekong region, no case of MalaroneTM resistance has been reported clinically or genetically thus far. In this study, all the P. falciparum parasites tested successfully were shown to be chloroquine resistant but atovaquone susceptible genetically. The more the usefulness of MalaroneTM increases for both treatment and prophylaxis, the wider the drug-resistance against MalaroneTM may spread in the region. Although the total number of samples
Corresponding author. Research Institute, International Medical Center of Japan, 1-21-1 Toyama, Shinjuku, Tokyo 162-8665, Japan.
Tel.: +81 3 3202 7181; fax: +81 3 3202 7364. E-mail address: [email protected] (S. Kano). 1477-8939/$ - see front matter & 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.tmaid.2006.07.002
ARTICLE IN PRESS Analyses of cytochrome b mutations in Plasmodium falciparum
133
examined is not large, it is concluded from these findings that MalaroneTM should be recommended for prophylaxis of malaria for travelers to the Mekong region. & 2006 Elsevier Ltd. All rights reserved.
Introduction The 2-hydroxynaphthoquinone derivative, atovaquone, which functions as a structural analog of coenzyme Q in the mitochondrial electron-transport chain and destroys the organellar membrane potential, has been used as a clinical antimalarial drug particularly in combination with the biguanide proguanil (as MalaroneTM).1–3 And it has been established as a drug of choice to prevent and treat multidrug resistant P. falciparum malaria in travelers.4 However, several cases of resistance against MalaroneTM have been reported in some parts of Africa,5 and many are believed to be associated with mutations at the codon 268 of cytochrome b gene in mitochondria of P. falciparum.6 Although MalaroneTM is used frequently for prophylaxis in drugresistant areas of Africa, clinical evaluation on its effectiveness in Asian multi-drug-resistant areas is limited.7 The objective of the study was to estimate genetically the effectiveness of MalaroneTM for treatment and prophylaxis for the travelers to Thai-Myanmar border where multi-drugresistant malaria is highly endemic.
Materials and methods Samples Seventy P. falciparum samples were taken from patients who contracted malaria in multi-drug resistant areas in Thai-Myanmar border. The patients were transferred to and admitted to the Hospital for Tropical Diseases, Mahidol University, Bangkok in 1999. Collection of patient specimens was approved by the Ethics Committee of the Faculty of Tropical Medicine, Mahidol University, Thailand. This survey also followed the ethical guidelines for epidemiological studies by the Ministry of Education, Culture, Sports, Science and Technology, and Ministry of Health, Labour and Welfare of Japan.
Polymerase chain reaction and genotyping cytb codon 268 Parasite DNA was extracted by established methods.8 Cytochrome b is 1131 bp length in P. falciparum (Genbank accession no. AY588280). Genotyping was focused on the latter part of the allele of ubiquinol binding pocket. In polymerase chain reaction, about 450-base pair fragment was amplified. The primer pairs were forward primer: 50 AGCAGTAATTTGGATATGTGGAGG-30 (450–473) (Genbank accession no. AY588280); reverse primer: 50 -ACAGAATAATCTCTAGCACC-30 (931–950) (Genbank accession no. AY588280).6 The reaction mixture consisted of DNA template 2 mL, Taq DNA polymerase 0.1 mL (0.5U), Buffer ( 10) 2.5 mL, 50 mM MgCl2 0.75 mL, each deoxynucleotide triphosphate 2 mL, 100 mM forward and reverse primer 0.25 mL. PCR was carried
out initially at 93 1C, 10 min, denaturing: 93 1C, 50 s, annealing: 45 1C, 50 s, extension: 70 1C, 60 s over 40 cycles. Amplified PCR products were confirmed by electrophoresis. Purification was performed with QIAquick PCR purification Kit (QIAGEN, Hilden, Germany). PCR for sequencing was carried out by using 0.8 mM reverse primer. pfcrt codon 76 PCR was performed (protocol was sited from the website of Maryland school of medicine center for vaccine development. URL: http://medschool.umaryland.edu/cvd/2002_ pcr_asra.htm). For the primary PCR, forward primer (TCRPA): 50 -ATGGCTCACGTTTAGGTGGAG-30 (Genbank accession no. AF030694); reverse primer (TCRT2): 50 -CGGATGTTACAAAACTATAGTTAC-30 (Genbank accession no. AF030694). The reaction mixture was the same as described above. PCR was carried out initially at 95 1C, 5 min, denaturing: 92 1C, 30 s, annealing: 45 1C, 30 s, extension: 65 1C, 45 s over 45 cycles, final extension: 72 1C, 15 min. Secondary PCR is 2 mL of primary reaction for DNA template, other materials are the same with primary PCR. Secondary primers are forward primer (TCRD1): 50 -TGTGCTCATGTGTTTAAACTT-30 (Genbank accession no. AF030694); reverse primer (TDRD2): 50 CAAAACTATAGTTACCAATTTTG-30 (Genbank accession no. AF030694). PCR was carried out initially at 95 1C, 5 min, denaturing: 92 1C, 30 s, annealing: 45 1C, 30 s, extension: 65 1C, 30 s, for over 30 cycles, final extension: 72 1C, 15 min. PCR for sequencing was done using 0.8 mM sense primer for secondary PCR. Sequencing The PCR products sequencing was done on Applied Biosystem 310 Genetic Analyzer (Perkin-Elmer, Les Ulis, France), using ABI PRISM Big Dye Terminator v.3.1 (Perkin-Elmer).
Results All the 70 samples had no mutations at the cytb codon 268. In fact, 61 out of the 70 samples, whose cytb genes could be sequenced successfully, showed identical sequence at the nucleotide level (from cytb codons 267–284) of which allele is TTTTATGCAATGTTAAAAACTGTTCCAAGTAAACCAGCTGGTTTAGTAATTGTA. On the other hand, 50 out of 70 samples, whose pfcrt genes could be sequenced successfully, had an identical genotype for the K76T mutation.
Discussion Atovaquone has been approved by the Food and Drug Administration (FDA) USA and introduced into practice in 1995. Only during the last decade, the use of this drug may have developed atovaquone-resistant parasites by mutating their amino acid residues located in or near the atovaquonebinding site on cytochrome b. A single nucleotide mutation
ARTICLE IN PRESS 134 at the codon 268 (Y268S) was suggested to be the index of atovaquone resistance,6 but other mutations, Y279S and L282V, were also predicted to be responsible for the resistance.9 Therefore, the alleles of the codons 267–284 of the 70 samples from P. falciparum patients in ThaiMyanmar border were examined and it was found that all the samples had no mutations at the cytb codon 268, and that 61 out of the 70 had identical alleles without any mutations at codons 267–284. In this study, 50 out of the 70 samples, whose pfcrt genes could be sequenced successfully, showed identical PfCRT K76T mutation, which has been found consistently in chloroquine-resistant parasites.10 In the Thai-Myanmar border, the clinical cure rate of chloroquine was reported to be less than 10% already in 1970s, and that of sulfadoxinepyrimethamine less than 10% in 1980s. In 2000, the cure rates of quinine and mefloquine fell to less than 60%.11 Some studies indicated a decrease of chloroquine-resistant genotype prevalence associated with cessation of chloroquine, suggesting the parasites’ reversion to wild type,12,13 but it was not the case with the isolates from the Thai-Myanmar border. Atovaquone is considered to be effective against both chloroquine-susceptible and chloroquine-resistant parasites, and atovaquone is not likely to have crossresistance to other anti-malarial drugs.5 Therefore, although multi-drug resistant P. falciparum parasites are prevalent in the Asian Mekong region, particularly in the Thai-Myanmar border areas, atovaquone will still be effective against those parasites in the region. Now, clinical studies on MalaroneTM have been conducted for hundreds of P. falciparum patients in Thailand,7,14 so that careful monitoring on atovaquone resistance is to be needed. Examination of molecular markers provides only a likely outcome of a treatment of prophylactic regimen, because the outcome is dependent on host factors such as the level of immunity, patient compliance or nutritional status,10 suggesting that not all of the atovaquone-resistance are associated with a mutated cytochrome b gene. Nevertheless, availability of the gene marker to monitor atovaquone-reisistant parasite populations provides a powerful tool to rationalize the deployment of MalaroneTM for travelers to the Southeast Asian region where multi-drug resistant malaria is highly endemic.
Conclusion From our results, MalaroneTM seemed to be effective for prophylaxis and treatment for travelers to the Mekong region at the moment. Further monitoring of atovaquoneresistant P. falciparum is needed for the rational use of this new antimalarial drug.
Acknowledgements This study was supported in part by a Grant-in-Aid for Scientific Research (B)(16406012) from the Ministry of
Y. Naoshima-Ishibashi et al. Education, Science, Sports, Culture of Japan, and a Mahidol University Grant.
References 1. Looareesuwan S, Viravan C, Webster HK, Kyle DE, Hutchinson DB, Canfield CJ. Clinical studies of atovaquone, alone or in combination with other antimalarial drugs, for treatment of acute uncomplicated malaria in Thailand. Am J Trop Med Hyg 1996;54:62–6. 2. Hogh B, Clarke PD, Camus D, Nothdurft HD, Overbosch D, Gunther M, et al. Atovaquone-proguanil versus chloroquineproguanil for malaria prophylaxis in non-immune travellers: a randomised, double-blind study. Malarone International Study Team. Lancet 2000;356:1888–94. 3. Overbosch D, Schilthuis H, Bienzle U, Behrens RH, Kain KC, Clarke PD, et al. Atovaquone-proguanil versus mefloquine for malaria prophylaxis in nonimmune travelers: results from a randomized, double-blind study. Clin Infect Dis 2001;33: 1015–21. 4. Shanks GD. Atovaquone/Proguanil. In: Schlagenhauf P, editor. Travelers’ malaria. London: BC Decker Inc; 2001. p. 227–46. 5. Basco LK, Ramiliarisoa O, Le Bras J. In vitro activity of atovaquone against the African isolates and clones of Plasmodium falciparum. Am J Trop Med Hyg 1995;53:388–91. 6. Korsinczky M, Chen N, Kotecka B, Saul A, Rieckmann K, Cheng Q. Mutations in Plasmodium falciparum cytochrome b that are associated with atovaquone resistance are located at a putative drug-binding site. Antimicrob Agents Chemother 2000;44: 2100–8. 7. Looareesuwan S, Chulay JD, Canfield CJ, Hutchinson DB. Malarone (atovaquone and proguanil hydrochloride): a review of its clinical development for treatment of malaria. Malarone Clinical Trials Study Group. Am J Trop Med Hyg 1999;60:533–41. 8. Sambrook J, Russell DW. Molecular cloning: a laboratory manual, 3rd ed. New York: Cold Spring Harbor Laboratory Press; 2001. 9. Kessl JJ, Ha KH, Merritt AK, Lange BB, Hill P, Meuniers B, et al. Cytochrome b mutations that modify the ubiquinol-binding pocket of the cytochrome bc1 complex and confer anti-malarial drug resistance in Saccharomyces cerevisiae. J Biol Chem 2005;280:17142–8. 10. Hyde JE. Drug-resistant malaria. Trends Parasitol 2005;21: 494–8. 11. Singhasivanon P. Antimalarial drug efficacy and resistance, Mekong Malaria II. Southeast Asian J Trop Med Pub Health 2003;34:71–87. 12. Kublin JG, Cortese JF, Njunju EM, Mukadam RA, Wirima JJ, Kazembe PN, et al. Reemergence of chloroquine-sensitive Plasmodium falciparum malaria after cessation of chloroquine use in Malawi. J Infect Dis 2003;187:1870–5. 13. Wang X, Mu J, Li G, Chen P, Guo X, Fu L, et al. Decreased prevalence of the Plasmodium falciparum chloroquine resistance transporter 76T marker associated with cessation of chloroquine use against P. falciparum malaria in Hainan, People’s Republic of China. Am J Trop Med Hyg 2005;72:410–4. 14. Looareesuwan S, Viravan C, Webster HK, Kyle DE, Hutchinson DB, Canfield CJ. Clinical studies of atovaquone, alone or in combination with other antimalarial drugs, for treatment of acute uncomplicated malaria in Thailand. Am J Trop Med Hyg 1996;54:62–6.