- Email: [email protected]
Analysis and overexpression in Escherichia coli of a staphylococcal gene encoding seryl-tRNA synthetase
Biochimica et Biophysica Acta 1397 Ž1998. 169–174
Short sequence-paper
Analysis and overexpression in Escherichia coli of a staphylococcal gene encoding seryl-tRNA synthetase Niko Bausch, Laurence Seignovert, Melanie Beaulande, Reuben Leberman, Michael Hartlein ¨
)
European Molecular Biology Laboratory, Grenoble Outstation, B.P. 156, 38042 Grenoble Cedex, France Received 22 December 1997; revised 23 January 1998; accepted 4 February 1998
Abstract We have sequenced and expressed in Escherichia coli the gene encoding the seryl-tRNA synthetase from the pathogenic bacterium Staphylococcus aureus. The overexpressed and purified recombinant enzyme was able to aminoacylate unfractionated tRNA from E. coli. Its activity was not affected by antibodies raised against and inhibiting the E. coli seryl-tRNA synthetase. q 1998 Elsevier Science B.V. Keywords: Aminoacyl-tRNA synthetase; Calmodulin-binding peptide expression system; Design of antibiotics; Ž Staphylococcus aureus .
Staphylococcus aureus is a common Gram-positive pathogen whose topical manifestations including nasal carriage of methicillin resistant strains can be treated by the antibiotic mupirocin. Mupirocin Ž pseudomonic acid A. is an inhibitor of isoleucyl-tRNA synthetase and thereby blocks protein synthesis. The observation that in a pseudomonic acid-resistant Escherichia coli mutant an amino acid substitution of leucine for phenylalanine has taken place in close proximity to the class I synthetase characteristic sequence which is an ATP binding subsite, led to the proposition that pseudomonic acid is a bifunctional inhibitor for the binding of both isoleucine and ATP w1x. By 1987 highly resistant forms had been described which were later shown to possess a second, plasmid encoded, isoleucyl-tRNA synthetase which
)
Corresponding author. Fax: q33-4-7620-7199; E-mail: [email protected]
was not susceptible to the antibiotic w2x. In general it is becoming increasingly obvious that resistance to antibiotics among infectious bacteria such as staphylococci is an ever increasing problem. Structural analysis of other possible targets of these bacteria might help in the design of specific antibiotics. These targets could be other aminoacyl-tRNA synthetases and the aim of the present work was to clone and overexpress the S. aureus gene for seryl-tRNA synthetase ŽSRSSA. a class II synthetase, whose structure and function has been extensively studied for the homologous E. coli and Thermus thermophilus enzymes w3,4x. Using S. aureus genomic DNA Ž Promega. with degenerated oligonucleotides Ž GG Ž ArT . ACŽ ArT . GG Ž ArT . CAATTACC Ž ArT . AAATT and GAACAACYATYAAAAGGTA, Genosys. derived from strongly conserved sequences from the Cterminus of E. coli and Bacillus subtilis seryltRNA-synthetase a 621 bp digoxigenin-UTP marked
0167-4781r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 7 8 1 Ž 9 8 . 0 0 0 2 7 - X
170
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
ŽBoehringer Mannheim. fragment was amplified by PCR. The 50-m l PCR sample contained 100 ng S. aureus DNA, a final concentration of 300 nM primers, and 350 nM dNTP. After an initial denaturation step at 948C for 5 min, the following temperature program was repeated for 30 cycles: denaturation 1 min at 948C, annealing 1 min at 408C and extension at 688C for 1 min. The extension step of the last cycle was carried out for 7 min. The PCR fragment was used as a probe to screen a S. aureus Lambda Zap II genomic library ŽStratagene. and hybrids were detected with anti-digoxigenin Fab fragments Ž Boehringer Mannheim.. The Lambda ZAP II vector allowed in vivo excision after coinfection with a helper phage leading to a ds-pBluescript w5x containing a S. aureus serS carrying fragment. The sequenced insert corresponds to the complete SRSSA gene containing a coding region of 1287 bp. A T-box element typical for genes of aminoacyl-tRNA synthetase and amino acid biosynthesis enzymes from Gram-positive bacteria was identified 107 bases upstream of the translational initiation codon w6x ŽFig. 1.. The N of the T-box consensus sequence 5X-AGGGUGGNACCGCG ŽC in the S. aureus serS . is base pairing with the tRNA discriminator base ŽG for tRNASer . w7x. A palindromic sequence in the 3X noncoding region could be implicated in transcription termination. The predicted translational product Ž Fig. 2. has a length of 428 amino acid residues and a calculated molecular mass of 48.6 kDa. The sequence shows 73% sequence similarity with the homologous B. subtilis, 67% with E. coli and 35.1% with human cytosolic enzyme. The comparison of SRSSA with other bacterial seryl-tRNA synthetases shows the typically strongly conserved C-terminal catalytic domain and the less conserved tRNA binding N-terminal domain. Despite the high degree of overall sequence identity between E. coli and S. aureus SerRSs two differences exist. A deletion of seven amino acids in part of the dimer interface corresponding to loop 1 of
171
the E. coli enzyme. Dimerisation is essential for the bacterial seryl-tRNA-synthetase activity because of the cross dimer tRNA binding mode w8x. The aromatic amino acid in the motif II loop of SRSEC ŽTyr274. and SRSTT Ž Phe262. which has been reported to participate in tRNA acceptor stem recognition w9,10x is in this instance Ala268 like the corresponding residue for the enzyme from another Gram-positive bacterium B. subtilis. For expression the coding region of the serS gene in the vector pCal-n Ž Stratagene. a BamHI site was created at the 5X end by site directed mutagenesis Ž primer 5X GGAAAGGATGAGGATCCATGT TAGACATT., while at the 3X end a HindIII site 18 bp after the stop codon was used. The pCal-n construct Ž pCal-SRSSA. codes for a fusion protein containing a 4-kDa N-terminal calmodulin-binding peptide enabling a one-step purification; binding to a calmodulin matrix in the presence of CaCl 2 and elution with a buffer containing 2 mM EGTA w11x. Transformed BL21 ŽDE3. cells were cultured in Luria Broth Ž50 m grml ampicillin. to an A 600 value of 0.6. Overnight induction at 228C with 0.1 mM isopropyl1-thio-b-D-galactoside led to a mainly soluble and active enzyme as measured by aminoacylation w8x of E. coli tRNA. The unfractionated bacterial extract of an induced culture shows a 22 times increased aminoacylation activity compared to the non-induced culture. The cells were harvested by centrifugation Ž20 min at 3500 rpm.. The pellet was resuspended in 12 ml buffer containing 50 mM Tris–HCl pH 8.0, 150 mM NaCl, 10 mM b-mercaptoethanol, 1 mM magnesium acetate, 1 mM imidazol and 2 mM CaCl 2 . After lysis by sonification using the Sonicator XL ŽMinosonix. the cell debris was removed by centrifugation Ž25 000 = g, 30 min.. The bacterial extract was fractionated on a Calmodulin Affinity Resign column ŽStratagene. following the methods described by the supplier, except that the elution buffer contained additionally 150 mM NaCl. Toxic overexpression of heterologues aminoacyl-
Fig. 1. Sequence of the S. aureus serS upstream and coding regions. Sequences similar to the T-box consensus sequence ŽAGGGTGGNACCGCG. and translational initiation site ŽAAGGAGG. are indicated below the DNA sequence. Dashed arrows below the sequence indicate the inverted repeat sequence of the putative terminator signal. The putative tRNA binding domain of SRSSA is underlined and the Class II specific motifs are indicated. The coding sequence for SRSSA has been deposited in the EMBL nucleotide sequence data bank under accession no. Y09924.
172
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
Fig. 2. Multiple alignment between prokaryotic SRS amino acid sequences. The sources are Žaccession numbers in the SWISSPROT or the EMBL Data Bank are indicated in brackets.: SRSTT for T. thermophilus SRS ŽP34945., SRSHI for Haemophilus influenzae SRS Žg1003124., SRSBS for B. subtilis SRS ŽD26185., SRSEC for E. coli SRS ŽX05017.. Class II specific sequence motifs and secondary structure elements including loop 1 are indicated; a, a-helices and b, b-strands. The position which has been shown to be involved in tRNA acceptor stem recognition w9x is in bold.
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
173
Fig. 3. Effect of polyclonal IgGs raised against the E. coli seryl-tRNA synthetase on SRSSA and SRSEC aminoacylation activity. A constant amount of IgGs was used to neutralise different amounts of SRS; Žy. activity without IgGs normalised to 100%; Žq. activity in the presence of IgGs. The individual concentrations of the enzymes in the aminoacylation reaction are indicated. The ratios antibodyrantigen are as followes: ŽA. 5, ŽB. 250, ŽC. 500, ŽD. 105, ŽE. 140, ŽF. 700.
tRNA synthetase in E. coli was observed for isoleucyl-tRNA synthetase from S. aureus and tyrosyl-tRNA synthetase from Bacillus stearotherophilus w12,13x. The non-toxic overexpression of the SRSSA in E. coli indicates a similar mode of tRNASer discrimination in Gram-positive and Gram-negative bacteria. Polyclonal antibodies raised against E. coli SerRS were purified as previously described w14x. Aminoacylation tests were carried out using 10 m g purified polyclonal antibody and different amounts of purified seryl-tRNA synthetase from S. aureus or from E. coli w8x. These antibodies neutralized the aminoacylation activity of the E. coli, but not that of the S.
aureus enzyme ŽFig. 3.. This might indicate that the most antigenic sites of the E. coli enzyme are not conserved between both bacterial enzymes. It has been shown that the N-terminal tRNA binding domain is the most antigenic and the less conserved part of bacterial seryl-tRNA-synthetases w15x. This observation is in agreement with the lack of inhibition seen for the S. aureus enzyme. Furthermore differences in this domain compared to the recently determined human SerRS w14x sequence could be of interest for the development of novel antibiotics against S. aureus. Such an approach has been proposed for the tyrosyl-tRNA-synthetase w16x. EMBL accession number: Y09924
174
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
References w1x T. Yanagisawa, J.T. Lee, H.C. Wu, M. Kawakami, Relationship of protein structure of isoleucyl-tRNA synthetase with pseudomonic acid resistance of Escherichia coli. A proposed mode of action of pseudomonic acid as an inhibitor of isoleucyl-tRNA synthetase, J. Biol. Chem. 269 Ž1994. 24304–24309. w2x J. Gilbart, C.R. Perry, B. Slocombe, High-level mupirocin resistance in Staphylococcus aureus: evidence for two distinct isoleucyl-tRNA synthetases, Antimicrob. Agents Chemother. 37 Ž1993. 32–38. w3x S. Cusack, C. Berthet-Colominas, M. Hartlein, N. Nassar, ¨ R. Leberman, A second class of synthetase structure revealed by X-ray analysis of Escherichia coli seryl-tRNA ˚ Nature 347 Ž1990. 249–255. synthetase at 2.5 A, ˚ w4x V. Biou, A. Yaremchuk, M. Tukalo, S. Cusack, The 2.9 A crystal structure of Thermus thermophilus seryl-tRNA synthetase complexed with tRNAŽSer., Science 263 Ž1994. 1404–1410. w5x J.M. Short, J.M. Fernandez, J.A. Sorge, W.D. Huse, Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties, Nucleic Acids Res. 16 Ž1988. 7583– 7600. w6x F.J. Grundy, M.T. Haldeman, G.M. Hornblow, J.M. Ward, A.F. Chalker, T.M. Henkin, The Staphylococcus aureus ileS gene, encoding isoleucyl-tRNA synthetase, is a member of the T-box family, J. Bacteriol. 179 Ž1997. 3767–3772. w7x M. Sprinzl, C. Steegborn, F. Hubel, S. Steinberg, Compilation of tRNA sequences and sequences of tRNA genes, Nucleic Acids Res. 24 Ž1996. 68–72. w8x C. Vincent, F. Borel, J.C. Willison, R. Leberman, M. Hartlein, Seryl-tRNA synthetase from Escherichia coli: ¨ functional evidence for cross-dimer tRNA binding during aminoacylation, Nucleic Acids Res. 23 Ž1995. 1113–1118.
w9x S. Cusack, A. Yaremchuk, M. Tukalo, The crystal structure of the ternary complex of T. thermophilus seryl-tRNA synthetase with tRNAŽSer.and a seryl-adenylate analogue reveals a conformational switch in the active site, EMBO J. 15 Ž1996. 2834–2842. w10x M.E. Saks, J.R. Sampson, Variant minihelix RNAs reveal sequence-specific recognition of the helical tRNAŽSer. acceptor stem by E. coli seryl-tRNA synthetase, EMBO J. 15 Ž1996. 2843–2849. w11x C.F. Zheng, T. Simcox, L. Xu, P. Vaillancourt, A new expression vector for high level protein production, one step purification and direct isotopic labeling of calmodulin-binding peptide fusion proteins, Gene 186 Ž1997. 55–60. w12x A.F. Chalker, J.M. Ward, A.P. Fosberry, J.E. Hodgson, Analysis and toxic overexpression in Escherichia coli of a staphylococcal gene encoding isoleucyl-tRNA synthetase, Gene 141 Ž1994. 103–108. w13x H. Bedouelle, V. Guez, A. Vidal-Cros, M. Hermann, Overproduction of tyrosyl-tRNA synthetase is toxic to Escherichia coli: a genetic analysis, J. Bacteriol. 172 Ž1990. 3940–3945. w14x C. Vincent, N. Tarbouriech, M. Hartlein, Human seryl-tRNA ¨ synthetase: genomic organization, cDNA sequence, bacterial expression and purification, Eur. J. Biochem. 250 Ž1997. 77–84. w15x F. Borel, C. Vincent, R. Leberman, M. Hartlein, Seryl-tRNA ¨ synthetase from Escherichia coli: implication of its Nterminal domain in aminoacylation activity and specificity, Nucleic Acids Res. 22 Ž1994. 963–2969. w16x S. Nair, L. Ribas de Pouplana, F. Houman, A. Avruch, X. Shen, P. Schimmel, Species-specific tRNA recognition in relation to tRNA synthetase contact residues, J. Mol. Biol. 269 Ž1997. 1–9.
Short sequence-paper
Analysis and overexpression in Escherichia coli of a staphylococcal gene encoding seryl-tRNA synthetase Niko Bausch, Laurence Seignovert, Melanie Beaulande, Reuben Leberman, Michael Hartlein ¨
)
European Molecular Biology Laboratory, Grenoble Outstation, B.P. 156, 38042 Grenoble Cedex, France Received 22 December 1997; revised 23 January 1998; accepted 4 February 1998
Abstract We have sequenced and expressed in Escherichia coli the gene encoding the seryl-tRNA synthetase from the pathogenic bacterium Staphylococcus aureus. The overexpressed and purified recombinant enzyme was able to aminoacylate unfractionated tRNA from E. coli. Its activity was not affected by antibodies raised against and inhibiting the E. coli seryl-tRNA synthetase. q 1998 Elsevier Science B.V. Keywords: Aminoacyl-tRNA synthetase; Calmodulin-binding peptide expression system; Design of antibiotics; Ž Staphylococcus aureus .
Staphylococcus aureus is a common Gram-positive pathogen whose topical manifestations including nasal carriage of methicillin resistant strains can be treated by the antibiotic mupirocin. Mupirocin Ž pseudomonic acid A. is an inhibitor of isoleucyl-tRNA synthetase and thereby blocks protein synthesis. The observation that in a pseudomonic acid-resistant Escherichia coli mutant an amino acid substitution of leucine for phenylalanine has taken place in close proximity to the class I synthetase characteristic sequence which is an ATP binding subsite, led to the proposition that pseudomonic acid is a bifunctional inhibitor for the binding of both isoleucine and ATP w1x. By 1987 highly resistant forms had been described which were later shown to possess a second, plasmid encoded, isoleucyl-tRNA synthetase which
)
Corresponding author. Fax: q33-4-7620-7199; E-mail: [email protected]
was not susceptible to the antibiotic w2x. In general it is becoming increasingly obvious that resistance to antibiotics among infectious bacteria such as staphylococci is an ever increasing problem. Structural analysis of other possible targets of these bacteria might help in the design of specific antibiotics. These targets could be other aminoacyl-tRNA synthetases and the aim of the present work was to clone and overexpress the S. aureus gene for seryl-tRNA synthetase ŽSRSSA. a class II synthetase, whose structure and function has been extensively studied for the homologous E. coli and Thermus thermophilus enzymes w3,4x. Using S. aureus genomic DNA Ž Promega. with degenerated oligonucleotides Ž GG Ž ArT . ACŽ ArT . GG Ž ArT . CAATTACC Ž ArT . AAATT and GAACAACYATYAAAAGGTA, Genosys. derived from strongly conserved sequences from the Cterminus of E. coli and Bacillus subtilis seryltRNA-synthetase a 621 bp digoxigenin-UTP marked
0167-4781r98r$19.00 q 1998 Elsevier Science B.V. All rights reserved. PII S 0 1 6 7 - 4 7 8 1 Ž 9 8 . 0 0 0 2 7 - X
170
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
ŽBoehringer Mannheim. fragment was amplified by PCR. The 50-m l PCR sample contained 100 ng S. aureus DNA, a final concentration of 300 nM primers, and 350 nM dNTP. After an initial denaturation step at 948C for 5 min, the following temperature program was repeated for 30 cycles: denaturation 1 min at 948C, annealing 1 min at 408C and extension at 688C for 1 min. The extension step of the last cycle was carried out for 7 min. The PCR fragment was used as a probe to screen a S. aureus Lambda Zap II genomic library ŽStratagene. and hybrids were detected with anti-digoxigenin Fab fragments Ž Boehringer Mannheim.. The Lambda ZAP II vector allowed in vivo excision after coinfection with a helper phage leading to a ds-pBluescript w5x containing a S. aureus serS carrying fragment. The sequenced insert corresponds to the complete SRSSA gene containing a coding region of 1287 bp. A T-box element typical for genes of aminoacyl-tRNA synthetase and amino acid biosynthesis enzymes from Gram-positive bacteria was identified 107 bases upstream of the translational initiation codon w6x ŽFig. 1.. The N of the T-box consensus sequence 5X-AGGGUGGNACCGCG ŽC in the S. aureus serS . is base pairing with the tRNA discriminator base ŽG for tRNASer . w7x. A palindromic sequence in the 3X noncoding region could be implicated in transcription termination. The predicted translational product Ž Fig. 2. has a length of 428 amino acid residues and a calculated molecular mass of 48.6 kDa. The sequence shows 73% sequence similarity with the homologous B. subtilis, 67% with E. coli and 35.1% with human cytosolic enzyme. The comparison of SRSSA with other bacterial seryl-tRNA synthetases shows the typically strongly conserved C-terminal catalytic domain and the less conserved tRNA binding N-terminal domain. Despite the high degree of overall sequence identity between E. coli and S. aureus SerRSs two differences exist. A deletion of seven amino acids in part of the dimer interface corresponding to loop 1 of
171
the E. coli enzyme. Dimerisation is essential for the bacterial seryl-tRNA-synthetase activity because of the cross dimer tRNA binding mode w8x. The aromatic amino acid in the motif II loop of SRSEC ŽTyr274. and SRSTT Ž Phe262. which has been reported to participate in tRNA acceptor stem recognition w9,10x is in this instance Ala268 like the corresponding residue for the enzyme from another Gram-positive bacterium B. subtilis. For expression the coding region of the serS gene in the vector pCal-n Ž Stratagene. a BamHI site was created at the 5X end by site directed mutagenesis Ž primer 5X GGAAAGGATGAGGATCCATGT TAGACATT., while at the 3X end a HindIII site 18 bp after the stop codon was used. The pCal-n construct Ž pCal-SRSSA. codes for a fusion protein containing a 4-kDa N-terminal calmodulin-binding peptide enabling a one-step purification; binding to a calmodulin matrix in the presence of CaCl 2 and elution with a buffer containing 2 mM EGTA w11x. Transformed BL21 ŽDE3. cells were cultured in Luria Broth Ž50 m grml ampicillin. to an A 600 value of 0.6. Overnight induction at 228C with 0.1 mM isopropyl1-thio-b-D-galactoside led to a mainly soluble and active enzyme as measured by aminoacylation w8x of E. coli tRNA. The unfractionated bacterial extract of an induced culture shows a 22 times increased aminoacylation activity compared to the non-induced culture. The cells were harvested by centrifugation Ž20 min at 3500 rpm.. The pellet was resuspended in 12 ml buffer containing 50 mM Tris–HCl pH 8.0, 150 mM NaCl, 10 mM b-mercaptoethanol, 1 mM magnesium acetate, 1 mM imidazol and 2 mM CaCl 2 . After lysis by sonification using the Sonicator XL ŽMinosonix. the cell debris was removed by centrifugation Ž25 000 = g, 30 min.. The bacterial extract was fractionated on a Calmodulin Affinity Resign column ŽStratagene. following the methods described by the supplier, except that the elution buffer contained additionally 150 mM NaCl. Toxic overexpression of heterologues aminoacyl-
Fig. 1. Sequence of the S. aureus serS upstream and coding regions. Sequences similar to the T-box consensus sequence ŽAGGGTGGNACCGCG. and translational initiation site ŽAAGGAGG. are indicated below the DNA sequence. Dashed arrows below the sequence indicate the inverted repeat sequence of the putative terminator signal. The putative tRNA binding domain of SRSSA is underlined and the Class II specific motifs are indicated. The coding sequence for SRSSA has been deposited in the EMBL nucleotide sequence data bank under accession no. Y09924.
172
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
Fig. 2. Multiple alignment between prokaryotic SRS amino acid sequences. The sources are Žaccession numbers in the SWISSPROT or the EMBL Data Bank are indicated in brackets.: SRSTT for T. thermophilus SRS ŽP34945., SRSHI for Haemophilus influenzae SRS Žg1003124., SRSBS for B. subtilis SRS ŽD26185., SRSEC for E. coli SRS ŽX05017.. Class II specific sequence motifs and secondary structure elements including loop 1 are indicated; a, a-helices and b, b-strands. The position which has been shown to be involved in tRNA acceptor stem recognition w9x is in bold.
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
173
Fig. 3. Effect of polyclonal IgGs raised against the E. coli seryl-tRNA synthetase on SRSSA and SRSEC aminoacylation activity. A constant amount of IgGs was used to neutralise different amounts of SRS; Žy. activity without IgGs normalised to 100%; Žq. activity in the presence of IgGs. The individual concentrations of the enzymes in the aminoacylation reaction are indicated. The ratios antibodyrantigen are as followes: ŽA. 5, ŽB. 250, ŽC. 500, ŽD. 105, ŽE. 140, ŽF. 700.
tRNA synthetase in E. coli was observed for isoleucyl-tRNA synthetase from S. aureus and tyrosyl-tRNA synthetase from Bacillus stearotherophilus w12,13x. The non-toxic overexpression of the SRSSA in E. coli indicates a similar mode of tRNASer discrimination in Gram-positive and Gram-negative bacteria. Polyclonal antibodies raised against E. coli SerRS were purified as previously described w14x. Aminoacylation tests were carried out using 10 m g purified polyclonal antibody and different amounts of purified seryl-tRNA synthetase from S. aureus or from E. coli w8x. These antibodies neutralized the aminoacylation activity of the E. coli, but not that of the S.
aureus enzyme ŽFig. 3.. This might indicate that the most antigenic sites of the E. coli enzyme are not conserved between both bacterial enzymes. It has been shown that the N-terminal tRNA binding domain is the most antigenic and the less conserved part of bacterial seryl-tRNA-synthetases w15x. This observation is in agreement with the lack of inhibition seen for the S. aureus enzyme. Furthermore differences in this domain compared to the recently determined human SerRS w14x sequence could be of interest for the development of novel antibiotics against S. aureus. Such an approach has been proposed for the tyrosyl-tRNA-synthetase w16x. EMBL accession number: Y09924
174
N. Bausch et al.r Biochimica et Biophysica Acta 1397 (1998) 169–174
References w1x T. Yanagisawa, J.T. Lee, H.C. Wu, M. Kawakami, Relationship of protein structure of isoleucyl-tRNA synthetase with pseudomonic acid resistance of Escherichia coli. A proposed mode of action of pseudomonic acid as an inhibitor of isoleucyl-tRNA synthetase, J. Biol. Chem. 269 Ž1994. 24304–24309. w2x J. Gilbart, C.R. Perry, B. Slocombe, High-level mupirocin resistance in Staphylococcus aureus: evidence for two distinct isoleucyl-tRNA synthetases, Antimicrob. Agents Chemother. 37 Ž1993. 32–38. w3x S. Cusack, C. Berthet-Colominas, M. Hartlein, N. Nassar, ¨ R. Leberman, A second class of synthetase structure revealed by X-ray analysis of Escherichia coli seryl-tRNA ˚ Nature 347 Ž1990. 249–255. synthetase at 2.5 A, ˚ w4x V. Biou, A. Yaremchuk, M. Tukalo, S. Cusack, The 2.9 A crystal structure of Thermus thermophilus seryl-tRNA synthetase complexed with tRNAŽSer., Science 263 Ž1994. 1404–1410. w5x J.M. Short, J.M. Fernandez, J.A. Sorge, W.D. Huse, Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties, Nucleic Acids Res. 16 Ž1988. 7583– 7600. w6x F.J. Grundy, M.T. Haldeman, G.M. Hornblow, J.M. Ward, A.F. Chalker, T.M. Henkin, The Staphylococcus aureus ileS gene, encoding isoleucyl-tRNA synthetase, is a member of the T-box family, J. Bacteriol. 179 Ž1997. 3767–3772. w7x M. Sprinzl, C. Steegborn, F. Hubel, S. Steinberg, Compilation of tRNA sequences and sequences of tRNA genes, Nucleic Acids Res. 24 Ž1996. 68–72. w8x C. Vincent, F. Borel, J.C. Willison, R. Leberman, M. Hartlein, Seryl-tRNA synthetase from Escherichia coli: ¨ functional evidence for cross-dimer tRNA binding during aminoacylation, Nucleic Acids Res. 23 Ž1995. 1113–1118.
w9x S. Cusack, A. Yaremchuk, M. Tukalo, The crystal structure of the ternary complex of T. thermophilus seryl-tRNA synthetase with tRNAŽSer.and a seryl-adenylate analogue reveals a conformational switch in the active site, EMBO J. 15 Ž1996. 2834–2842. w10x M.E. Saks, J.R. Sampson, Variant minihelix RNAs reveal sequence-specific recognition of the helical tRNAŽSer. acceptor stem by E. coli seryl-tRNA synthetase, EMBO J. 15 Ž1996. 2843–2849. w11x C.F. Zheng, T. Simcox, L. Xu, P. Vaillancourt, A new expression vector for high level protein production, one step purification and direct isotopic labeling of calmodulin-binding peptide fusion proteins, Gene 186 Ž1997. 55–60. w12x A.F. Chalker, J.M. Ward, A.P. Fosberry, J.E. Hodgson, Analysis and toxic overexpression in Escherichia coli of a staphylococcal gene encoding isoleucyl-tRNA synthetase, Gene 141 Ž1994. 103–108. w13x H. Bedouelle, V. Guez, A. Vidal-Cros, M. Hermann, Overproduction of tyrosyl-tRNA synthetase is toxic to Escherichia coli: a genetic analysis, J. Bacteriol. 172 Ž1990. 3940–3945. w14x C. Vincent, N. Tarbouriech, M. Hartlein, Human seryl-tRNA ¨ synthetase: genomic organization, cDNA sequence, bacterial expression and purification, Eur. J. Biochem. 250 Ž1997. 77–84. w15x F. Borel, C. Vincent, R. Leberman, M. Hartlein, Seryl-tRNA ¨ synthetase from Escherichia coli: implication of its Nterminal domain in aminoacylation activity and specificity, Nucleic Acids Res. 22 Ž1994. 963–2969. w16x S. Nair, L. Ribas de Pouplana, F. Houman, A. Avruch, X. Shen, P. Schimmel, Species-specific tRNA recognition in relation to tRNA synthetase contact residues, J. Mol. Biol. 269 Ž1997. 1–9.