Analysis of CMP-sialic acid transporter-like proteins in plants

Phytochemistry 70 (2009) 1973–1981

Contents lists available at ScienceDirect

Phytochemistry journal homepage: www.elsevier.com/locate/phytochem

Analysis of CMP-sialic acid transporter-like proteins in plants Shou Takashima a,1,*, Junichi Seino a,1,2, Takeshi Nakano b,c, Kazuhito Fujiyama d, Masafumi Tsujimoto e, Nobuhiro Ishida f, Yasuhiro Hashimoto a,3 a

Glyco-chain Functions Laboratory, RIKEN-FRS, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan Plant Chemical Biology Research Unit, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan c Precursory Research for Embryonic Science and Technology (PRESTO), Japan Science and Technology Agency (JST), Sanbancho Building 5-Sanbancho, Chiyoda-ku, Tokyo 102-0075, Japan d International Center for Biotechnology, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871, Japan e Cellular Biochemistry Laboratory, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan f Department of Environmental Security System, Faculty of Risk and Crisis Management, Chiba Institute of Science, 3 Shiomi-cho, Choshi, Chiba 288-0025, Japan b

a r t i c l e

i n f o

Article history: Received 13 February 2009 Received in revised form 31 August 2009 Available online 12 October 2009 Keywords: Rice Oryza sativa Poaceae Japanese rice cDNA cloning Nucleotide sugar transporter CMP-sialic acid transporter OsCSTLP

a b s t r a c t It is commonly accepted that sialic acids do not exist in plants. However, putative gene homologs of animal sialyltransferases and CMP-sialic acid transporters have been detected in the genomes of some plants. To elucidate the physiological functions of these genes, we cloned 2 cDNAs from Oryza sativa (Japanese rice), each of which encodes a CMP-sialic acid transporter-like protein designated as OsCSTLP1 and OsCSTLP2. To examine the CMP-sialic acid transporter activity of OsCSTLP1 and OsCSTLP2, we introduced their expression vectors into CMP-sialic acid transporter activity-deficient Lec2 cells. Transfection with OsCSTLP1 resulted in recovery of the deficit phenotype of Lec2 cells, but transfection with OsCSTLP2 did not. We also performed an in vitro nucleotide sugar transport assay using a yeast expression system. Among the nucleotide sugars examined, the OsCSTLP1-containing yeast microsomal membrane vesicles specifically incorporated CMP-sialic acid, indicating that OsCSTLP1 has CMP-sialic acid transporter activity. On the other hand, OsCSTLP2 did not exhibit any nucleotide sugar transporter activity. T-DNA insertion lines of Arabidopsis thaliana targeting the homologs of the OsCSTLP1 and OsCSTLP2 genes exhibited a lethal phenotype, suggesting that these proteins play important roles in plant development and may transport important nucleotide sugars such as CMP-Kdo in physiological conditions. Ó 2009 Elsevier Ltd. All rights reserved.

1. Introduction Many glycosyltransferases are located in the membrane of the Golgi body and the endoplasmic reticulum (ER), with their catalytic sites facing the lumen of these organelles. Glycosyltransferases play a role in the synthesis of sugar chains, using nucleotide sugars as donor substrates. Although some nucleotide sugars, such as UDP-arabinose and UDP-galacturonic acid, are thought to be synthesized in the lumen of the Golgi body in plants (Burget et al., 2003; Mølhøj et al., 2004), most nucleotide sugars are synthesized in the cytoplasm or, in the case of CMP-sialic acid (CMPSia) in animals, in the nucleus (Münster et al., 1998). Therefore,

* Corresponding author. Present address: Laboratory of Glycobiology, The Noguchi Institute, 1-8-1 Kaga, Itabashi, Tokyo 173-0003, Japan. Tel.: +81 3 5944 3212; fax: +81 3 3964 5588. E-mail address: [email protected] (S. Takashima). 1 These authors contributed equally to this paper. 2 Present address: Glycometabolome Team, RIKEN, 2-1 Hirosawa, Wako, Saitama 351-0198, Japan. 3 Present address: Department of Biochemistry, School of Medicine, Fukushima Medical University, 1 Hikarigaoka, Fukushima-shi, Fukushima 960-1295, Japan. 0031-9422/$ - see front matter Ó 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.phytochem.2009.09.017

nucleotide sugars synthesized either outside the Golgi body or the ER have to be transported into the lumen of these organelles before they are utilized by glycosyltransferases as substrates for glycoconjugate biosynthesis; this transportation is brought about by nucleotide sugar transporters (NSTs). Like glycosyltransferases, NSTs are located in the membrane of the Golgi body and the ER, and carry nucleotide sugars into the lumen of these organelles as antiporters (Capasso and Hirschberg, 1984). They exchange the nucleotide sugar with the corresponding nucleotide monophosphate, which is a product of the glycosylation reaction. The mouse CMP-Sia transporter (CST) has 10 transmembrane domains with both the N- and C-termini facing the cytoplasm (Eckhardt et al., 1999). Hydropathy analysis of other NSTs also predicted that they share this topology. In the case of animals, mainly humans, the NST family is designated as the solute carrier family 35 (SLC 35) (Ishida and Kawakita, 2004). In plants, the chloroplast transporters for triose-phosphate, phosphoenolpyruvate, glucose-6-phosphate, and xylulose-5-phosphate show sequence similarity to NSTs, and both of them are classified into the same family, which is designated as the triose-phosphate/NST family (TP-NST) (Ward, 2001). At present, more than 40 members of the TP-NST gene family have been identified in the Arabidopsis thaliana genome (Knappe et al.,

1974

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981

2003; Bakker et al., 2005), and some of them have been cloned and characterized (Baldwin et al., 2001; Norambuena et al., 2002, 2005; Bakker et al., 2005, 2008; Rollwitz et al., 2006). Cellulose, hemicelluloses, and pectins are major plant cell wall polysaccharides. Some of these polysaccharides contain unique sugars that do not exist in animals. For example, the pectin component rhamnogalacturonan II (RG-II) contains unique sugars such as apiose, aceric acid, 3-deoxy-D-lyxo-2-heptulosonicacid (Dha), and 3-deoxy-D-manno-2-octulosonic acid (ketodeoxyoctonic acid, Kdo). On the other hand, it is commonly accepted that sialic acids, which are widely distributed among living things, from bacteria to animals, do not exist in plants (Séveno et al., 2004); however, it is possible that sialylated glycoconjugates exist in plant cells (Shah et al., 2003; Zeleny et al., 2006). Sialic acids are negatively charged acidic sugars and usually occur at the terminal end of the carbohydrate groups of glycoproteins and glycolipids. Due to their negative charge and wide occurrence in the exposed positions of cell-surface molecules, sialic acids function as key determinants of oligosaccharide structures that may mediate a variety of biological phenomena such as cell–cell communication, cell–substrate interaction, adhesion, and protein targeting. Despite the absence of sia-

lic acids in plants, putative gene homologs for mammalian sialyltransferases and CSTs have been detected in the genomes of some plants (Shah et al., 2003; Séveno et al., 2004), and some of them have been characterized (Takashima et al., 2006; Bakker et al., 2008; Daskalova et al., 2009). However, the physiological functions of these genes have not been elucidated. Here, we describe the cloning and characterization of Oryza sativa (Japanese rice) CST-like proteins OsCSTLP1 and OsCSTLP2 and discuss the possible physiological roles of these proteins. 2. Results and discussion 2.1. cDNA cloning of OsCSTLP1 and 2 Using the Basic Local Alignment Search Tool (BLAST) algorithm to search the O. sativa nucleotide sequence databases with the human CST (SLC35A1) sequence as a query, we found a number of sequences encoding CST-like proteins. From these, we cloned 2 cDNA clones that exhibited high similarity with the human CST sequence; the cloning was conducted by reverse transcription-polymerase chain reaction (RT-PCR). One cDNA (GenBank accession No.

Fig. 1. Sequence comparison of plant CSTLPs and human CST (hCST). The conserved amino acid residues are boxed.

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981

NM_001064288, gene name: Os06g0523400) encoded a 322-amino acid protein with a calculated molecular mass of 36,554 Da, which we tentatively designated as OsCSTLP1. The overall amino acid sequence of OsCSTLP1 had 33.2% sequence identity with human CST (Fig. 1). OsCSTLP1 is a homolog of the A. thaliana CST-like protein (At5g41760) previously characterized by Bakker et al. (2008), and it had 76.4% amino acid sequence identity with At5g41760. The other cDNA (GenBank accession No. NM_001066604, gene name: Os07g0573700) encoded a 356-amino acid protein with a calculated molecular mass of 39,466 Da, which we tentatively designated as OsCSTLP2. The overall amino acid sequence of OsCSTLP2 had 31.2% and 39.4% sequence identity with human CST and OsCSTLP1, respectively (Fig. 1). OsCSTLP2 was homologous with another A. thaliana gene (At4g35335), which had 79.0% amino acid se-

1975

quence identity with OsCSTLP2 (Fig. 1). It has been predicted that human and mouse CST have 10 transmembrane domains (Eckhardt et al., 1999; Aoki et al., 2001). Hydropathy plot analysis (Kyte and Doolittle, 1982) of OsCSTLP1 and OsCSTLP2 predicted that they also have multiple transmembrane domains (Fig. 2). The OsCSTLP1 and OsCSTLP2 genes are located on O. sativa chromosomes 6 and 7, respectively, and they span over 6.1 and 5.0 kb of genomic DNA consisting of 8 and 15 exons, respectively (Fig. 3). No other genes in the O. sativa genome showed high homology with these genes. The OsCSTLP1 and OsCSTLP2 genes are ubiquitously expressed in 3-week-old O. sativa seedlings, but the expression levels of the OsCSTLP1 gene in roots and the OsCSTLP2 gene in leaves are lower than those observed in other tissues (Fig. 4).

Fig. 2. Hydropathy plot analysis of OsCSTLP1 and OsCSTLP2. The hydropathy plot was calculated by the method of Kyte and Doolittle (1982). Putative transmembrane regions are indicated with thick horizontal bars.

Fig. 3. Structure of the OsCSTLP1 and OsCSTLP2 genes. The protein coding region, the untranslated region, and the introns are represented by filled rectangles, open rectangles, and straight lines, respectively. Numbers indicate the size of each region in base pairs.

1976

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981

A. thaliana CSTLP (At5g41760), which was shown to possess CST activity (Bakker et al., 2008). Lec2 cells transiently transfected with expression vectors for OsCSTLP1 and 2, i.e., pcDNA-OsCSTLP1 and pcDNA-OsCSTLP2, successfully expressed the corresponding proteins (Fig. 6). MAM lectin staining showed that a2,3-sialylglycoconjugates were expressed on the cell surface of OsCSTLP1expressing cells, whereas positive staining was not observed on the cell surface of OsCSTLP2-expressing cells (Fig. 5). These results indicate that the introduction of OsCSTLP1 can rescue the phenotype of the Lec2 cells, but introduction of OsCSTLP2 does not show this effect. 2.3. Production and measurement of the NST activity of OsCSTLP1 and 2 by using a yeast expression system Fig. 4. Expression analysis of the OsCSTLP1 and OsCSTLP2 genes. Relative expression levels of the OsCSTLP1 and OsCSTLP2 genes in 3-week-old O. sativa seedlings were measured by RT-PCR.

2.2. Assessment of the CST activity of OsCSTLP1 and 2 in Lec2 cells Since OsCSTLP1 and 2 had significant sequence similarity with human CST, we examined their CST activity using Lec2 cells, which are CST activity-deficient mutants of Chinese hamster ovary (CHO) cells (Deutscher et al., 1984). In Lec2 cells, CMP-Sia is not incorporated into the lumen of the Golgi body because they lack CST activity and, therefore, the endogenous Golgi body-resident sialyltransferases cannot utilize CMP-Sia as a donor substrate. Therefore, Lec2 cells do not express sialylglycoconjugates on their cell surface, and they are not stained with fluorescein isothiocyanate (FITC)-conjugated Maackia amurensis (MAM) lectin, which binds Siaa2,3Gal residues (Fig. 5). On the other hand, Lec2 cells producing the active form of human CST were able to complement their CST activity and expressed a2,3-sialylglycoconjugates on their cell surface (Figs. 5 and 6). Similar results were obtained with

To further examine the NST activity of OsCSTLP1 and 2, we expressed these proteins in the yeast Saccharomyces cerevisiae. Yeast microsomal membranes have very low intrinsic NST activity, except for the GDP-mannose (GDP-Man) transporting activity, which is potent. Therefore, yeast microsomal membrane fractions can be used for in vitro NST assay, which measures the incorporation of radiolabeled nucleotide sugars into yeast membrane vesicles. For the production of OsCSTLP1 and 2, the yeast expression vectors pYEX-OsCSTLP1 and pYEX-OsCSTLP2, which contain the cDNA encoding the corresponding protein tagged with an HA-epitope at the C-terminus, were used for yeast transformation. The membrane fractions containing HA-tagged OsCSTLP1 and 2 were prepared from transformed cells grown in YNBD medium after induction with 0.5 mM CuSO4 (Fig. 6) and used for the in vitro NST assay. As a background control and a positive control, the membrane fractions prepared from cells transformed with an empty vector (pYEX-BESN) and an expression vector for human CST (pYEX-BESN-hCST) were used, respectively. For comparison, the membrane fraction prepared from cells transformed with an expression vector for A. thaliana CSTLP (pYEX-At5g41760) was

Fig. 5. Transient expression analysis to assess the CST activity of OsCSTLP1 and OsCSTLP2. Lec2 cells were transfected with the control empty vector (pcDNA) or expression vectors for human CST (pcDNA-hCST), A. thaliana CSTLP (pcDNA-At5g4160), OsCSTLP1 (pcDNA-OsCSTLP1), and OsCSTLP2 (psDNA-OsCSTLP2). Two days after transfection, the cells were stained with FITC-conjugated MAM lectin. Bar, 50 lm. Pro5 is the parent strain of Lec2 and has CST activity.

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981

Fig. 6. Detection of recombinant NSTs in mammalian and yeast microsomal membranes. Microsomes were prepared from transfected Lec2 cells or transformed yeast cells. Samples containing 10 lg of protein were subjected to Western blot analysis. Upper panel: proteins from Lec2 cells transfected with each mammalian expression vector. Control, proteins from Lec2 cells transfected with the empty pcDNA vector. Lower panel: proteins from yeast cells transformed with each yeast expression vector. Control, proteins from yeast cells transformed with the empty pYEX-BESN vector.

used. It should be noted that the apparent molecular masses of recombinant NSTs produced in both Lec2 and yeast cells were somewhat different from the expected molecular masses predicted from the primary sequence of the protein plus the HA-epitope tag (Fig. 6). In addition, several bands or smeared bands were observed

1977

for some NSTs. However, a difference was found between the predicted molecular mass and the apparent one upon the heterologous expression of NSTs (Berninsone et al., 1997; Norambuena et al., 2002). Since these NSTs have multiple transmembrane domains and are very hydrophobic, strong hydrophobic interactions that overcome the dissociation effect of sodium dodecyl sulfate (SDS) may occur, and these proteins may take a shrunken conformation that can migrate faster than the completely extended conformation of the SDS-protein on SDS–polyacrylamide gel electrophoresis. As shown in Fig. 7, we observed apparently higher incorporation of CMP-Sia into human CST-, A. thaliana CSTLP-, and OsCSTLP1-containing membrane vesicles than into the background control membrane vesicles. However, the incorporation of CMP-Sia into OsCSTLP2-containing membrane vesicles was nearly equal to the CMP-Sia incorporation into the background control membrane vesicles. The incorporation of other nucleotide sugars into these NST-containing membrane vesicles was nearly equal or lower than their incorporation into the background control membrane vesicles. Taken together with the results of the complementation experiment in the Lec2 cells, these results indicate that OsCSTLP1 possesses CMP-Sia transporter activity and incorporates CMP-Sia into the lumen of the Golgi body. Since the A. thaliana CSTLP (At5g41760) also possesses CMP-Sia transporter activity (Bakker et al., 2008), it seems that many plants have potential CMP-Sia transporter activity. On the other hand, OsCSTLP2 also shows a significant sequence similarity with human CST, but it did not exhibit CMP-Sia transporter activity. The physiological substrates of OsCSTLP2 are probably nucleotide sugars other than those examined in this study. 2.4. Possible physiological functions of OsCSTLP1 and 2 To investigate the physiological functions of plant CSTLPs, we analyzed the T-DNA insertion lines of A. thaliana targeting the homologs of the OsCSTLP1 and OsCSTLP2 genes, namely the At5g41760 and At4g35335 genes, respectively. Three T-DNA insertion lines SALK_022145, which is a disruptant of the At5g41760 gene, and SALK_015385 and SALK_001362, which are both disruptants of the At4g35335 gene were obtained from the Arabidopsis Biological Resource Center. These were supplied as heterozygous

Fig. 7. NST activity of OsCSTLP1 and OsCSTLP2. Microsomes were prepared from yeast transformants and used for the NST assay with [14C]-labeled CMP-Sia and various [14C]labeled nucleotide sugars as indicated below the columns. The uptake of substrate into the microsomal vesicles was determined as described (see Section 4.10) and presented as incorporated nucleotide sugars (pmol)/min/mg protein used in assays. To determine the nucleotide sugar incorporation due to the activity of the introduced NST, the incorporation of introduced NST-containing microsomal vesicles was compared with that of vector-control microsomal vesicles.

1978

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981

thesized radiolabeled CMP-Kdo as a substrate. Detailed analysis of T-DNA insertion-mutants of A. thaliana targeting plant CSTLP genes is also in progress. Identification of the actual substrates of plant CSTLPs would help elucidate the physiological functions of these proteins. 3. Concluding remarks In this study, we have shown that OsCSTLP1 has CMP-Sia transporter activity. In general, plant cells cannot synthesize mammalian-type glycoconjugates that contain sialic acids. This is a major problem when producing recombinant mammalian glycoproteins in plant cells. To solve this problem, some mammalian genes involved in the biosynthesis of sialylglycoconjugates have to be introduced into plant cells. However, if the CST activity of plant CSTLPs is observed in plant cells, the introduction of a mammalian CST gene would no longer be necessary. 4. Experimental 4.1. General experimental procedures

Fig. 8. Structure of RG-II and CMP-Kdo. (A) Structure of RG-II. The order of the side chains has not been clearly determined. AceA, aceric acid; Api, apiose; Ara, arabinose; Dha, 3-deoxy-D-lyxo-2-heptulosonicacid; Fuc, fucose; Gal, galactose; GalA, galacturonic acid; GlcA, glucuronic acid; Kdo, 3-deoxy-D-manno-2-octulosonic acid; Rha, rhamnose; Xyl, xylose; OAC, O-acetylated; O-Me, O-methylated. (B) Structure of CMP-Kdo and CMP-Sia (N-acetylneuraminic acid, NeuAc).

mutants; we were unable to generate homozygous mutants. We assume that there was a problem with fertilization and/or the development of the homozygous mutants, and as a result, they exhibited a lethal phenotype. The above results suggest that plant CSTLPs play very important roles in development. At present, the existence of sialic acids in plants is controversial (Shah et al., 2003; Séveno et al., 2004). Even if they exist in plants, they are present in very small quantities (Zeleny et al., 2006). Therefore, it is uncertain as to whether CMP-Sia is an actual physiological substrate of OsCSTLP1. It is possible that OsCSTLP1 has broad substrate specificity and can utilize nonphysiological substrates. We searched for more probable candidates for the physiological substrates of OsCSTLP1, which exist in plants and bear a structural resemblance to sialic acids. One such candidate is Kdo, an acidic sugar found in the pectic polysaccharide RG-II (Fig. 8). Like sialic acids, Kdo has a 2-keto acid structure and its activated form is CMP-Kdo. Recently, A. thaliana-knockout mutants targeting the 2 genes encoding Kdo-8-phosphate synthase (AtKDSA1 and AtKDSA2), which synthesizes the phosphorylated precursor of Kdo, were characterized (Delmas et al., 2008). Single-knockout mutations had no phenotypic consequences, but a double-knockout mutant that completely lacks Kdo residues in RG-II could not be identified. This was due to the inability of haploid pollen grains of the AtkdsA1- and AtkdsA2-genotype to properly form an elongated pollen tube and perform fertilization. Considering these observations, it is tempting to speculate that plant CSTLPs may transport important nucleotide sugars such as CMP-Kdo, since homozygous T-DNA insertion mutants of A. thaliana targeting the plant CSTLP genes could also not be identified. To date, plant NSTs with CMP-Kdo transporter activity have not been identified. This is because it is difficult to measure CMP-Kdo transporter activity since CMP-Kdo is very unstable and not currently available as a commercial product. To overcome this problem, we are developing an assay system to measure the CMP-Kdo transporter activity of OsCSTLP1 and 2 by using enzymatically syn-

Radioactive nucleotide sugars were purchased from Perkin–Elmer; the exceptions were UDP-[14C]-N-acetylgalactosamine (UDP-[14C]-GalNAc) and CMP-[14C]-Sia, which were purchased from NEN Life Science Products and GE Healthcare, respectively. 4.2. Plant materials O. sativa L. japonica cv. Nipponbare was cultivated for 3 weeks in potting soil irrigated with H2O in a naturally lit greenhouse, and then harvested for RNA extraction. For germination of A. thaliana ecotype Columbia (Col-0), seeds were surface sterilized for 30 min in 70% (v/v) EtOH–H2O and 0.5% (v/v) Triton X-100, rinsed with EtOH for 1 min and dried, and then placed in plastic plates containing MS growth medium (Murashige and Skoog, 1962). After cold treatment at 4 °C for 2 days in the dark, plates were incubated in a culture room at 22 °C in a 16 h light/8 h dark cycle. After 10 days of growth, plantlets were transferred to potting soil under the same conditions. For RNA extraction, they were harvested after 3 weeks of growth. The T-DNA insertion lines of A. thaliana targeting the At5g41760 gene (SALK_022145) and the At4g35335 gene (SALK_015385 and SALK_001362) were obtained from the Arabidopsis Biological Resource Center. These lines were cultivated as described above, except that the MS growth medium contained 20 lg/ml of kanamycin. 4.3. Isolation of OsCSTLP cDNAs O. sativa sequences exhibiting similarity with human CST (SLC35A1) were identified through tBLASTn algorithm searches against the translated nucleotide sequence databases at the National Center for Biotechnology Information. Total RNA was extracted from 3-week-old O. sativa seedlings (total plant, leaves, stems, and roots) by using ISOGEN (Wako, Japan), and first-strand cDNA was synthesized using SuperScript II reverse transcriptase (Invitrogen). To obtain the entire coding region of the 2 clones exhibiting high similarity to human CST, which we tentatively designated OsCSTLP1 and OsCSTLP2, RT-PCR was performed as follows. For the amplification of OsCSTLP1 cDNA, the following primers were used: 50 -CGATGCAGTGGTACCTGGTGGCCGCGCTCC30 (GF187+, nucleotides 389–418 in GenBank accession No. NM_001064288; gene name, Os06g0523400) and 50 -TACCTACTTTGAAGTAACTGGCAATGCTTG-30 (GF188, complementary

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981

to nucleotides 1333–1362 in GenBank accession No. NM_001064288). For the amplification of OsCSTLP2 cDNA, the following primers were used: 50 -AGATGGAGTACAGGAGAGTGAAGGACCAGG-30 (GF189+, nucleotides 194–223 in GenBank accession No. NM_001066604; gene name, Os07g0573700) and 50 -AGCTCATTTCTGCGGTTGTGGTTTCCCAAC-30 (GF190, complementary to nucleotides 1240–1269 in GenBank accession No. NM_001066604). RT-PCR was performed as follows using Pyrobest DNA polymerase (Takara, Japan) with the first-strand cDNA of 3week-old O. sativa seedlings (total plant) as a template: 94 °C for 60 s; 35 cycles of 94 °C for 30 s, 50 °C for 60 s, and 72 °C for 90 s; and 72 °C for 7 min. The PCR products were cloned into the EcoRV site of the pBluescript II SK(+) vector. The nucleotide sequences were confirmed by the dideoxy termination method by using an ABI 3100 DNA sequencer (Applied Biosystems, Foster City, CA, USA). For comparison, we also cloned the cDNA encoding an A. thaliana CSTLP (At5g41760) (Bakker et al., 2008). Total RNA was extracted from 3-week-old A. thaliana (total plant, leaves, stems, and roots), and first-strand cDNA was synthesized as described above. For the amplification of A. thaliana CSTLP (At5g41760) cDNA, RT-PCR was performed as described above using the primers 50 -TTAATGGCGGCTACTCCGTGGTACTTTGTC-30 (GF191+, nucleotides 96–125 in GenBank accession No. NM_001036915) and 50 -AATTCAAGAATCTGTCTTTTCTTCTACGAC-30 (GF192, complementary to nucleotides 1095–1124 in GenBank accession No. NM_001036915) and the first-strand cDNA of 3-week-old A. thaliana (total plant) as a template. Cloning and sequencing were also performed as described above. 4.4. Expression analysis of the OsCSTLP genes The relative expression levels of OsCSTLP1 and OsCSTLP2 mRNAs were estimated by RT-PCR, using the first-strand cDNA of 3-week-old O. sativa seedlings as a template. For the analysis of OsCSTLP1 gene expression, OsCSTLP1-specific primers GF187+ and GF188 were used. For the analysis of OsCSTLP2 gene expression, OsCSTLP2-specific primers GF189+ and GF190 were used. Expression of the O. sativa glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene, which was used as the control, was also measured using O. sativa GAPDH-specific primers 50 -AAAGGAGGCTTCTCTTACAGTGGCCAGAAG-30 (CB400+, nucleotides 871– 900 in GenBank accession No. AF357884) and 50 -TCAGCC CATGGTGTAGGATGGAGATGGTAG-30 (CB401, complementary to nucleotides 1495–1524 in GenBank accession No. AF357884) (Takashima et al., 2006). PCR was performed as follows using ExTaq Hot Start Version DNA polymerase (Takara, Japan): 98 °C for 10 s; 35 cycles of 98 °C for 10 s, 60 °C for 30 s, and 72 °C for 120 s (25 cycles were performed for GAPDH); and 72 °C for 7 min. The PCR products were electrophoresed on a 2% agarose gel, stained with ethidium bromide, and then visualized under UV light. 4.5. Construction of epitope-tagged expression vectors The DNA fragment containing BglII and XbaI sites and the HA-epitope (YPYDVPDYA) tag-encoding sequence with the stop codon was synthesized by annealing the following primers: 50 CTAGTAGATCTTCTAGATACCCCTACGATGTGCCCGATTACGCCTAAG C-30 (GF283+) and 50 -GGCCGCTTAGGCGTAATCGGGCACATCGTAGGGGTATCTAGAAGATCTA-30 (GF284). The fragment was cloned into the SpeI–NotI sites of the pBluescript II SK(+) vector. The DNA fragment encoding the entire coding region of OsCSTLP1, but without the stop codon, was prepared by PCR amplification using the primers 50 -AGATCTATGCAGTGGTAC CTGGTGGCCGCG-30 (GF287+, the synthetic BglII site is underlined) and 50 -TCTAGACTTTGAAGTAACTGGCAATGCTTG-30 (GF288,

1979

the synthetic XbaI site is underlined) with the cloned OsCSTLP1 cDNA fragment as a template, using the PCR conditions described above (see Section 4.3). The amplified fragment was digested with BglII and XbaI, and it was cloned into the BglII– XbaI sites of the HA-tag containing pBluescript II SK(+) vector. From this plasmid, the BglII–NotI fragment, which contains the HA-tagged entire coding region of OsCSTLP1, was prepared. This fragment was subcloned into the BamHI–NotI sites of the mammalian expression vector pcDNA 3.1/Myc-His A (Invitrogen), yielding pcDNA-OsCSTLP1. For the construction of the yeast expression vector, the above fragment was subcloned into the BamHI–NotI sites of the yeast expression vector pYEX-BESN (Segawa et al., 2002), yielding pYEX-OsCSTLP1. The DNA fragment encoding the entire coding region of OsCSTLP2 but without the stop codon was prepared by PCR amplification using primers 50 -GGATCCATGGAGTACAGGAGAGTGAAGGAC-30 (GF289+, the synthetic BamHI site is underlined) and 50 -TCTAGATTTCTGCGGTTGTGGTTTCCCAAC-30 (GF290, the synthetic XbaI site is underlined) with the cloned OsCSTLP2 cDNA fragment as a template and using the PCR conditions described above (see Section 4.3). The amplified fragment was digested with BamHI and XbaI, and it was cloned into the BamHI–XbaI sites of the HA-tag containing pBluescript II SK(+) vector, constructed as described above. From this plasmid, the BamHI–NotI fragment, which contains the HA-tagged entire coding region of OsCSTLP2, was prepared. This fragment was subcloned into the BamHI–NotI sites of pcDNA 3.1/Myc-His A, yielding the mammalian expression vector pcDNA-OsCSTLP2. For the construction of the yeast expression vector, the above fragment was subcloned into the BamHI–NotI sites of pYEX-BESN, yielding pYEX-OsCSTLP2. For the construction of the mammalian expression vector of human CST, the EcoRI–NotI fragment containing the HA-tagged entire coding region of human CST was prepared from pMKIT-neo-hCST (Aoki et al., 1999), and this fragment was subcloned into the EcoRI–NotI sites of pcDNA 3.1/Myc-His A, yielding pcDNA-hCST. The yeast expression vector of human CST, pYEX-BESN-hCST, was constructed as previously described (Aoki et al., 1999). The DNA fragment encoding the entire coding region of A. thaliana CSTLP (At5g41760), but without the stop codon, was prepared by PCR amplification using primers 50 -GAATTCA TGGCGGCTACTCCGTGGTACTTT-30 (GF291+, the synthetic EcoRI site is underlined) and 50 -TCTAGAAGAATCTGTCTTTTCTTCTACG AC-30 (GF292, the synthetic XbaI site is underlined) with the cloned A. thaliana CSTLP (At5g41760) cDNA fragment as a template and with the PCR conditions described above (see Section 4.3). The amplified fragment was digested with EcoRI and XbaI, and it was cloned into the EcoRI–XbaI sites of the HA-tag containing pBluescript II SK(+) vector constructed as described above. From this plasmid, the EcoRI–NotI fragment, which contains the HA-tagged entire coding region of A. thaliana CSTLP (At5g41760), was prepared. This fragment was subcloned into the EcoRI–NotI sites of pcDNA 3.1/Myc-His A, yielding the mammalian expression vector pcDNA-At5g41760. For the construction of the yeast expression vector, the above fragment was subcloned into the EcoRI–NotI sites of pYEX-BESN, yielding pYEX-At5g41760. 4.6. Assessment of CST activity using Lec2 cells The CHO cell line CST activity-deficient mutant, Lec2 (Deutscher et al., 1984), was cultured in minimum essential medium a supplemented with 10% fetal calf serum. Lec2 cells were transiently transfected with the above mentioned pcDNA vectors by using the FuGENE 6 reagent (Roche Diagnostics) and cultured for 2 days in a chamber slide. Cells were fixed with 3% paraformaldehyde for 20 min and washed twice with phosphate-buffered saline. The fixed cells were incubated with 20 lg/ml of FITC-conjugated

1980

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981

MAM lectin (EY Laboratories) for 1 h and washed 4 times with phosphate-buffered saline. Fluorescence labeling was visualized under an IX71 fluorescent microscope (OLYMPUS).

4.7. Yeast strain, transformation, and culture S. cerevisiae strain YPH500 (MATa, ura3-52, lys2-801, ade2-101, trp1-D63, his3-D200, leu2-D1) was used in the expression study. Yeast transformation was performed using the lithium acetate method as previously described (Ito et al., 1983), and the yeast expression vector was constructed as above. Transformants were selected with a selective medium containing 0.67% Bacto-yeast nitrogen base without amino acids, 2% glucose (YNBD), and auxotrophic supplements, except uracil. For preparation of the membrane vesicles, the transformants were grown in liquid selective medium until they reached a density of A600 = 0.4. Cupric sulfate was then added to the culture media at a final concentration of 0.5 mM to induce expression of the introduced NST gene, which was under the control of the CUP1 promoter. The cells were further cultured for 2 h and then harvested.

4.8. Preparation of yeast membrane vesicles Preparation of membrane vesicles was carried out as previously described (Ishida et al., 2005). Cells were washed with ice-cold 10 mM NaN3 and converted into spheroplasts with a spheroplast preparation solution containing 1.4 M sorbitol, 50 mM potassium phosphate (pH 7.5), 10 mM NaN3, 0.25% (v/v) 2-mercaptoethanol, and 2 mg of Zymolyase-100T (SEIKAGAKU Corp., Tokyo, Japan) per gram of cells by incubation at 37 °C for 20 min. The spheroplasts were collected as a pellet, and resuspended in 5 volumes of lysis buffer containing 0.8 M sorbitol, 10 mM HEPES–Tris (pH 7.4), 1 mM EDTA, and a protease-inhibitor cocktail (Complete, EDTA-free; Roche Diagnostics). The spheroplasts were homogenized by passing them several times through a 200-ll micropipette tip attached to a serological pipette. The lysate was centrifuged at 1500g for 10 min to remove the intact cells and debris. The supernatant was centrifuged at 100,000g for 60 min to yield a pellet of membrane vesicles, P100 (precisely, P10 + P100). The P100 fractions were resuspended in the lysis buffer.

4.9. Western blot analysis Western blotting was carried out as previously described (Ishida et al., 1998). The HA-tagged proteins were detected with the rat anti-HA monoclonal antibody (mAb) 3F10 (Roche Diagnostics).

4.10. Assessment of NST activity by using yeast membrane vesicles The transport assay using yeast membrane vesicles was performed essentially as previously described (Sun-Wada et al., 1998). Briefly, 100 ll of the transport reaction mixture contained yeast membrane vesicles equivalent to 50 lg total protein, 5– 10 lM radiolabeled substrate, 0.8 M sorbitol, 10 mM Tris–HCl (pH 7.0), and 0.5 mM dimercaptopropanol. The reaction mixture was incubated at 30 °C. The reaction was initiated by the addition of membrane vesicles and terminated after 1 min by an 11-fold dilution with an ice-cold stop buffer containing 0.8 M sorbitol, 10 mM Tris–HCl (pH 7.0), and 1 lM nonradiolabeled substrate. The entire reaction mixture was filtered through a nitrocellulose filter, washed 3 times with 1 ml of the ice-cold stop buffer, and dried. The radioactivity trapped on the filter was measured with a toluene-based scintillator.

Acknowledgment This study was supported in part by a research grant from the Sumitomo Foundation (S.T.) and the Program for Promotion of Basic Research Activities for Innovation Bioscience (PROBRAIN) (T.N.).

References Aoki, K., Sun-Wada, G.H., Segawa, H., Yoshioka, S., Ishida, N., Kawakita, M., 1999. Expression and activity of chimeric molecules between human UDP-galactose transporter and CMP-sialic acid transporter. J. Biochem. 126, 940–950. Aoki, K., Ishida, N., Kawakita, M., 2001. Substrate recognition by UDP-galactose and CMP-sialic acid transporters. J. Biol. Chem. 276, 21555–21561. Bakker, H., Routier, F., Oelmann, S., Jordi, W., Lommen, A., Gerardy-Schahn, R., Bosch, D., 2005. Molecular cloning of two Arabidopsis UDP-galactose transporters by complementation of a deficient Chinese hamster ovary cell line. Glycobiology 15, 193–201. Bakker, H., Routier, F., Ashikov, A., Neumann, D., Bosch, D., Gerardy-Schahn, R., 2008. A CMP-sialic acid transporter cloned from Arabidopsis thaliana. Carbohydr. Res. 343, 2148–2152. Baldwin, T.C., Handford, M.G., Yuseff, M.I., Orellana, A., Dupree, P., 2001. Identification and characterization of GONST1, a golgi-localized GDP-mannose transporter in Arabidopsis. Plant Cell 13, 2283–2295. Berninsone, P., Eckardt, M., Gerardy-Schahn, R., Hirschberg, C., 1997. Functional expression of the murine Golgi CMP-sialic acid transporter in Saccharomyces cerevisiae. J. Biol. Chem. 272, 12616–12619. Burget, E.G., Verma, R., Mølhøj, M., Reiter, W.-D., 2003. The biosynthesis of Larabinose in plants. Molecular cloning and characterization of a golgi-localized UDP-D-xylose 4-epimerase encoded by the MUR4 gene of Arabidopsis. Plant Cell 15, 523–531. Capasso, J.M., Hirschberg, C.B., 1984. Mechanisms of glycosylation and sulfation in the Golgi apparatus: evidence for nucleotide sugar/nucleoside monophosphate and nucleotide sulfate/nucleoside monophosphate antiports in the Golgi apparatus membrane. Proc. Natl. Acad. Sci. USA 81, 7051–7055. Daskalova, S.M., Pah, A.R., Baluch, D.P., Lopez, L.C., 2009. The Arabidopsis thaliana putative sialyltransferase resides in the Golgi apparatus but lacks the ability to transfer sialic acid. Plant Biol. 11, 284–299. Delmas, F., Séveno, M., Northey, J.G.B., Hernould, M., Lerouge, P., McCourt, P., Chevalier, C., 2008. The synthesis of the rhamnogalacturonan II component 3deoxy-D-manno-2-octulosonic acid (Kdo) is required for pollen tube growth and elongation. J. Exp. Bot. 59, 2639–2647. Deutscher, S.L., Nuwayhid, N., Stanley, P., Briles, E.I., Hirschberg, C.B., 1984. Translocation across Golgi vesicle membranes: a CHO glycosylation mutant deficient in CMP-sialic acid transport. Cell 39, 295–299. Eckhardt, M., Gotza, B., Gerardy-Schahn, R., 1999. Membrane topology of the mammalian CMP-sialic acid transporter. J. Biol. Chem. 274, 8779–8787. Ishida, N., Kawakita, M., 2004. Molecular physiology and pathology of the nucleotide sugar transporter family (SLC35). Pflugers Arch. Eur. J. Physiol. 447, 768–775. Ishida, N., Ito, M., Yoshioka, S., Sun-Wada, G.-H., Kawakita, M., 1998. Functional expression of human Golgi CMP-sialic acid transporter in the Golgi complex of a transporter-deficient Chinese hamster ovary cell mutant. J. Biochem. 124, 171– 178. Ishida, N., Kuba, T., Aoki, K., Miyatake, S., Kawakita, M., Sanai, Y., 2005. Identification and characterization of human Golgi nucleotide sugar transporter SLC35D2, a novel member of the SLC35 nucleotide sugar transporter family. Genomics 85, 106–116. Ito, H., Fukuda, Y., Murata, K., Kimura, A., 1983. Transformation of intact yeast cells treated with alkali cations. J. Bacteriol. 153, 163–168. Knappe, S., Flügge, U.I., Fischer, K., 2003. Analysis of the plastidic phosphate translocator gene family in Arabidopsis and identification of new phosphate translocator-homologous transporters, classified by their putative substratebinding site. Plant Physiol. 131, 1178–1190. Kyte, J., Doolittle, R.F., 1982. A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157, 105–132. Mølhøj, M., Verma, R., Reiter, W.-D., 2004. The biosynthesis of D-galacturonate in plants. Functional cloning and characterization of a membrane-anchored UDPD-glucuronate 4-epimerase from Arabidopsis. Plant Physiol. 135, 1221–1230. Münster, A.K., Eckhardt, M., Potvin, B., Mühlenhoff, M., Stanley, P., Gerardy-Schahn, R., 1998. Mammalian cytidine 50 -monophosphate N-acetylneuraminic acid synthetase: a nuclear protein with evolutionarily conserved structural motifs. Proc. Natl. Acad. Sci. USA 95, 9140–9145. Murashige, T., Skoog, F., 1962. A revised medium for rapid growth and bio-assays with tobacco tissue culture. Physiol. Plantarum 15, 473–497. Norambuena, L., Marchant, L., Berninsone, P., Hirschberg, C.B., Silva, H., Orellana, A., 2002. Transport of UDP-galactose in plants. J. Biol. Chem. 277, 32923–32929. Norambuena, L., Nilo, R., Handford, M., Reyes, F., Marchant, L., Meisel, L., Orellana, A., 2005. AtUTr2 is an Arabidopsis thaliana nucleotide sugar transporter located in the Golgi apparatus capable of transporting UDP-galactose. Planta 222, 521– 529. Rollwitz, I., Santaella, M., Hille, D., Flügge, U.I., Fischer, K., 2006. Characterization of AtNST-KT1, a novel UDP-galactose transporter from Arabidopsis thaliana. FEBS Lett. 580, 4246–4251.

S. Takashima et al. / Phytochemistry 70 (2009) 1973–1981 Segawa, H., Kawakita, M., Ishida, N., 2002. Human and Drosophila UDP-galactose transporters transport UDP-N-acetylgalactosamine in addition to UDPgalactose. Eur. J. Biochem. 269, 128–138. Séveno, S., Bardor, M., Paccalet, T., Gomord, V., Lerouge, P., Faye, L., 2004. Glycoprotein sialylation in plants? Nat. Biotechnol. 22, 1351–1352. Shah, M.M., Fujiyama, K., Flynn, C.R., Joshi, L., 2003. Sialylated endogenous glycoconjugates in plant cells. Nat. Biotechnol. 21, 1470–1471. Sun-Wada, G.-H., Yoshioka, S., Ishida, N., Kawakita, M., 1998. Functional expression of the human UDP-galactose transporters in the yeast Saccharomyces cerevisiae. J. Biochem. 123, 912–917.

1981

Takashima, S., Abe, T., Yoshida, S., Kawahigashi, H., Saito, T., Tsuji, S., Tsujimoto, M., 2006. Analysis of sialyltransferase-like proteins from Oryza sativa. J. Biochem. 139, 279–287. Ward, J.M., 2001. Identification of novel families of membrane proteins from the model plant Arabidopsis thaliana. Bioinformatics 17, 560–563. Zeleny, R., Kolarich, D., Strasser, R., Altmann, F., 2006. Sialic acid concentrations in plants are in the range of inadvertent contamination. Planta 224, 222–227.