- Email: [email protected]
Analysis of expression of growth factor receptors in replicatively and oxidatively senescent human fibroblasts
FEBS Letters 579 (2005) 6388–6394
FEBS 30112
Analysis of expression of growth factor receptors in replicatively and oxidatively senescent human fibroblasts Jian-Hua Chen*, Susan E. Ozanne, C. Nicholas Hales Department of Clinical Biochemistry, University of Cambridge, AddenbrookeÕs Hospital, Level 4, Hills Road, Cambridge CB2 2QR, United Kingdom Received 18 August 2005; accepted 23 September 2005 Available online 25 October 2005 Edited by Vladimir Skulachev
Abstract Replicatively and oxidatively senescent human fibroblasts demonstrate an impaired response to mitogens. To investigate whether this is due to downregulation of growth factor receptors we examined their expression in these two types of senescence. mRNA and protein levels of the insulin receptor and platelet-derived growth factor (PDGF) a-receptor decreased in replicatively senescent cells. The PDGF b-receptor and insulin-like growth factor 1 receptor at the protein level also decreased but remained readily detectable. However, these major growth factor receptors remained unchanged in oxidatively premature senescent cells. This suggests that mechanisms underlying diminished responsiveness to mitogens might be different in replicative senescence and oxidatively premature senescence. 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Senescence; Oxidative stress; Insulin receptor; Growth factor receptor; Mitogen
1. Introduction Cellular senescence is an irreversible growth arrest state in which cells have lost proliferative capacity but stay viable for extended periods of time. Replicative senescence results from serial passage in culture and is generally believed to be triggered by critically shortened telomeres [1–3]. Cellular senescence can be induced prematurely in early passage cells by agents that cause DNA damage [4–7] or disrupt heterochromatin [8], or by strong mitogenic signals [9–11]. Premature senescence can also be induced by exposure of the telomere 3 0 overhang sequence [12]. The phenotype of premature senescence often shares many features of replicative senescence, including distinct morphology, senescence associated b-galactosidase (SA-b-gal) activity and upregulation of p53 pathway. Telomere shortening, however, is not associated with such acutely induced premature senescent cells [13]. This is possibly because cell replication is rapidly halted in the premature senescent cells and cell replication is believed to be required for the telomere shortening [14]. Nevertheless, premature senescence can also be achieved in a telomere* Corresponding author. Fax: +44 1223 330598. E-mail address: [email protected] (J.-H. Chen).
Abbreviations: PDGF, platelet-derived growth factor; FGF, fibroblast growth factor; IGF, insulin-like growth factor; EGF, epidermal growth factor; SA-b-gal, senescence associated b-galactosidase; Rb, retinoblastoma; BrdU, 5-bromo-2 0 -deoxyuridine; PBS, phosphatebuffered saline
dependent manner by exposure to mild oxidative stress [14,15]. This is because oxidative stress causes single strand breaks in telomeric regions which consequently cause accelerated telomere shortening [16,17]. One of the prominent hallmarks of both replicative senescence and premature senescence is their diminished response to serum or growth factors. The mechanisms underlying the hyporesponsiveness to mitogenic stimuli are not fully elucidated. Cellular responses to external signals are mediated via activation of complex signalling cascades that ultimately lead to changes in gene expression. The first event in response to mitogenic signals is the activation of respective cognate receptors, followed by formation of multi-protein complexes, phospholipid turnover, calcium mobilization and activation of protein kinases, phosphatases and transcription factors. This leads to coordinated regulation of proteins that ensure successful cell proliferation. The impaired response of senescent fibroblasts to mitogens suggests inappropriate transmission of signals. Decrease in expression of cell surface receptors in senescent cells may be partly accountable for the diminished response to mitogens. This has been supported by evidence obtained from replicative senescence [18,19]. For example, age-related downregulation of the epidermal growth factor (EGF) receptor has been reported in human microvascular endothelial cells [20], human fibroblasts [21–23] and rat articular chondrocytes [24]. Similarly, age-related reductions in the platelet-derived growth factor (PDGF) binding sites or PDGF receptor have also been demonstrated in several cell systems including human smooth muscle cells [25] and human fibroblasts [26]. Decreased expression of the PDGF b-receptor has been suggested to be a causative factor for the decreased mitogenic response of fibroblasts in WernerÕs syndrome, a premature ageing condition [27]. However, little is known as to whether premature senescent cells also share the same alteration in terms of receptor expression and downstream pathways. The aim of this study was to systematically compare expression of the insulin receptor and other growth factor receptors at mRNA and protein levels in replicatively and oxidatively premature senescent human fibroblasts. This may provide insight into the potential different mechanisms by which replicative and oxidative damage induced senescence occurs.
2. Materials and methods 2.1. Cell culture and H2O2 treatment IMR-90 cells at population doubling (PD) 24.5 were obtained from the America Type Culture Collection (ATCC). The cells were grown in ATCC modified EagleÕs minimal essential medium supplemented with
0014-5793/$30.00 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2005.09.102
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
6389
10% fetal bovine serum (FBS, ATCC), 100 U/ml penicillin and 0.1 mg/ ml streptomycin (penicillin-streptomycin solution from Invitrogen). Cells for H2O2 treatment were prepared from the exponential phase around PD 30. H2O2 treatment was carried out 24 h after seeding by incubating 2 · 106 cells in 100-mm dishes in 13 ml of the culture medium containing 600 lM H2O2 for 2 h. For a second H2O2 treatment the cells were 1:2 split after being cultured for 4 days following the first treatment and treated again for 2 h with 600 lM H2O2 24 h after seeding. Trypan blue exclusion assay was carried out to demonstrate that the treatment did not cause any cell death. IMR-90 cells reached replicative senescence at PD 59.
Santa Cruz), anti-PDGF a-receptor antibody (sc-338, Santa Cruz), anti-PDGF b-receptor antibody (06-498, Upstate), anti-fibroblast growth factor (FGF) receptor 1 antibody (05-149, Upstate), anti-insulin-like growth factor (IGF)-1 receptor antibody (sc-713, Santa Cruz), anti-EGF receptor antibody (05-104, Upstate) and anti-b actin antibody (ab6276, abcam). The bound primary antibodies were detected by horseradish peroxidase-conjugated secondary antibodies (Amersham), followed by enhanced chemiluminesence (Amersham). The densities of the bands were quantified using an Alpha Imager (Alpha Innotech Corporation).
2.2. BrdU labeling and SA-b-gal assay Cells were seeded and treated as described above in dishes containing autoclaved coverslips. For 5-bromo-2 0 -deoxyuridine (BrdU) labeling, coverslips were transferred into a 6-well plate and incubated in 2 ml of the culture medium containing 10 lM BrdU for 48 h. Cells on coverslips were then washed with phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde in PBS, washed twice in PBS, permeabilized in 0.2% Triton X-100 and washed in PBS. DNA was denatured by incubation in 2 M HCl for 1 h followed by three washes with PBS. Coverslips were incubated for 1 h with fluorescein-conjugated mouse anti-BrdU monoclonal antibody (1:20 dilution; Alexis Biochemicals) and with DNA stain TOTO-3 0 -iodide (0.5 lM; Molecular Probes), washed three times with PBS, and mounted in Antifade mounting solution (Molecular Probes). For SA-b-gal assay, cells on coverslips were washed twice in PBS, fixed for 5 min in 4% paraformaldehyde in PBS, washed three times in PBS and incubated at 37 C overnight in fresh SA-b-gal staining solution (1 mg of 5-bromo-4chloro-3-indolyl b-D -galactopyranoside [stock = 100 mg/ml of dimethylformamide]/ml of 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, 2 mM MgCl in 40 mM citric acid/sodium phosphate, pH 6.0) [26]. At least 500 cells from each time point were scored under the microscope for BrdU- or SA-b-gal assay.
3. Results
2.3. Semi-quantitative RT-PCR Total RNA was extracted from cell pellets using TRI reagent (Sigma) and quantified spectrophotometrically in capillary cuvettes on GeneQuant (Amersham Pharmacia Biotech). First strand cDNA was reverse transcribed from 0.8 lg of total RNA using a 1st Strand cDNA Synthesis Kit from Roche with random primers p(dN)6 supplied with the kit. PCRs were carried out as follows: 1 cycle of 94 C for 4 min and receptor specifically defined number (see Table 1) of cycles of 94 C for 30 s, 56 C for 45 s, 72 C for 1 min. Primers used for receptor PCR amplifications and sizes of PCR products are shown in Table 1. PCR products were analyzed by electrophoresis on a 1% agarose gel followed by densitometry quantitation using an Alpha Imager (Alpha Innotech Corporation, CA, USA). 2.4. Western blotting Whole cell lysate was prepared by scraping cells in Laemmli buffer [0.12 M Tris, pH 6.8, 4% (w/v) SDS, 20% (v/v) glycerol with protease inhibitors (cocktail from Sigma)]. Protein concentration was determined by the bicinchoninic acid (BCA) method (Sigma) with BSA as a standard. 15 lg of proteins were separated by SDS–PAGE and electrophoretically transferred to nitrocellulose membrane. Blots were probed with the following antibodies: anti-p53 antibody (ab7757, abcam), anti-p21 antibody (H-164, Santa Cruz), anti-p16 antibody (H-156, Santa Cruz), anti-retinoblastoma (Rb) antibody (G3-245, BD PharMingen), anti-insulin receptor b-subunit antibody (sc-711,
3.1. Characterization of replicatively and oxidatively senescent human fibroblasts Replicative senescent cells were obtained when IMR-90 cells showed no more population doubling for 10 days after a serial passage. As shown in Fig. 1(b) replicatively senescent cells displayed typical enlarged morphology that was strikingly different to that of young cells as shown in Fig. 1(a). The senescence biomarker, SA-b-gal was also fully detectable in 98% of the cells at this stage for the senescent cells (Fig. 1(d)) whereas only 14% of young control cells showed SA-b-gal activity (Fig. 1(c)). Furthermore, p53, p21 and p16 were found to be upregulated with Rb being hypophosphorylated in the replicatively senescing cells (Fig. 1(i), lanes 2 and 3). It is interesting to note that in the deep senescent cells (4 weeks into senescence) while p53 and p21 decreased as compared to the newly senescent cells p16 showed a further increase (compare lane 4 to lane 3 in Fig. 1(i)). This is in keeping with cells undergoing replicative senescence in that p53 senses stresses (e.g., telomere shortening), which then activates expression of p21 resulting in cell cycle arrest, whereas p16 is responsible for the maintenance of the senescent state [28,29]. Premature senescence was induced by treating IMR-90 cells with H2O2 as reported previously [7]. As determined by 48 h BrdU labeling, permanent cell cycle arrest increased from 16% in young control cells to over 98% in the treated cells (Fig. 1(e) and (f)). SA-b-gal activity was detectable in 96% treated cells (Fig. 1(h)). In addition, hypophosphorylation of Rb and upregulation of p53, p21 and p16 were also detected in the H2O2-induced premature senescent cells (Fig. 1(i), lane 5). 3.2. Analysis by semi-quantitative RT-PCR In order to investigate whether permanent cell cycle arrest in replicatively senescence and oxidative stress-induced premature senescence is due to alterations in expression of growth factor receptors we carried out semi-quantitative RT-PCR to determine relative mRNA levels in young and senescing IMR-90 cells. As shown in Fig. 2, the insulin
Table 1 Primers used for RT-PCR Forward primers (5 0 –3 0 ) IR PDGFR-a PDGFR-b IGF-1R FGFR1 EGFR Actin
GCGGAAGACAGTGAGCTGTT CCCAGATGTAGCCTTTGTAC ACACTGCACGAGAAGAAAGG CATTGAGGAGGTCACAGAG CTCTATGCTTGCGTAACCAG ACGCAGTTGGGCACTTTTGA CAACTGGGACGACATGGAGA
Reverse primers (5 0 –3 0 ) GATGCGATAGCCCGTGAAGT GACCGTCAAAGTGTACACCA CGGTTGTCTTTGAACCACAG CAAAGACGAAGTTGGAGGC TTGCTCCCATTCACCTCGAT TGGTCAGTTTCTGGCAGTTC ATACCCCTCGTAGATGGGCA
PCR product size (bp) +
(11 ) 474/(11 ) 438 463 590 431 599 520 277
Cycle 34 28 29 29 32 29 28
6390
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
did not affect the expression of the receptors analyzed (Fig. 2, lane 2). In H2O2 induced premature senescent cells, although the insulin receptor showed a border-line significant decrease (P = 0.057 by StudentÕs t test) as compared to the young control cells the decrease was not as pronounced as in the replicatively senescent cells (compare lane 5 to lanes 1 and 4 in Fig. 2). PDGF a-receptor showed no significant decrease as compared to the control cells, which was in contrast to the marked decrease seen in the replicatively senescent cells (Fig. 2). Receptors for IGF-1, FGF and EGF as well as PDGF b-receptor did not show any significant change in the premature senescent cells as compared to that in replicatively senescent cells (Fig. 2). As measurement of the mRNA level cannot directly account for actual functional changes in the receptors we next examined the expression at protein level by Western blotting.
Fig. 1. Replicatively senescent and oxidative stress-induced premature senescent cells. (a) Morphology of young dividing IMR-90 cells; (b) morphology of replicative senescent cells; (c) SA-b-gal assay on young cells; (d) SA-b-gal assay on replicative senescent cells; (e) BrdU incorporation assay on young control cells; (f) BrdU incorporation assay on H2O2 induced premature senescent cells; (g) SA-b-gal assay on young control cells; (h) SA-b-gal assay on H2O2 induced premature senescent cells; (i) Western blotting of p53, p21, p16 and Rb in young control cells (lane 1), near senescent cells (PD58, lane 2), replicative senescent cells (lane 3), deep replicative senescent cells (4 weeks into senescence, lane 4) and H2O2 induced premature senescent cells (lane 5). Actin was used as loading control.
receptor (both isoforms of exon 11+ and 11) and PDGF areceptor showed progressive decreases when IMR-90 cells underwent replicative senescence (compare lane 4 to lanes 1 and 3). However, the PDGF b-receptor, IGF-1 receptor, FGF receptor 1 and EGF receptor did not show any difference in relation to senescence status (Fig. 2). The decrease in mRNA levels of the insulin receptor and PDGF a-receptor seen in replicatively senescent cells was not observed in quiescent cells induced by contact inhibition (Fig. 2). Apart from the IGF-1 receptor which showed an increase in confluence induced quiescent cells, contact inhibition essentially
3.3. Analysis by Western blotting In order to see whether the differential expression of the growth factor receptors observed at the mRNA level were also reflected at the protein level, we further carried out Western blot analysis using whole cell lystaes prepared at various stages during cell senescing. As shown in Fig. 3, insulin receptor b-subunit decreased progressively as cells underwent replicative senescence (Fig. 3, lanes 1–4). Further decrease was not observed in deep senescent cells (4 weeks into senescence, Fig. 3, lane 5). PDGF a-receptor decreased markedly in replicatively senescent cells (Fig. 3, lanes 1–4). A further decrease of the receptor was detected in the deep senescent cells (Fig. 3, lane 5). Similarly, IGF-1 receptor also decreased progressively as cells underwent replicative senescence with a further decrease being detected in the deep senescent cells (Fig. 3). The PDGF b-receptor only showed a significant decrease in the deep replicative senescent cells (Fig. 3). In contrast to the marked decrease of PDGF areceptor, however, a substantial level of IGF-1 receptor and PDGF b-receptor still could be detected in senescent and deep senescent cells (Fig. 3, lanes 4 and 5). No decrease was observed in PDGF a-receptor and IGF-1 receptor in contact inhibited cells (data not shown). This suggests that the decrease in the growth factor receptors observed in the replicatively senescent cells was not related to reversible cell cycle arrest. FGF receptor 1 level increased as cells underwent senescence with the increase in the near senescent cells being statistically significant (Fig. 3). EGF receptor showed no significant change in replicatively senescing cells (Fig. 3). The protein expression of receptors in H2O2 induced premature senescent cells did not follow the same pattern as seen in replicatively senescent cells. Insulin receptor b-subunit showed a decrease in premature senescent cells but the decrease was not as significant as in the replicatively senescent cells (Fig. 3, lane 6; P = 0.06). Receptors for PDGF, IGF-1, FGF and EGF did not show any significant changes in premature senescent cells (Fig. 3). No significant changes in the levels of these receptors could be detected in the premature senescent cells that had been cultured for three weeks (data not shown). This suggests that the difference in protein expression levels observed in replicative and H2O2 induced premature senescence did not relate to the period of culture.
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
6391
Fig. 2. mRNA levels of insulin receptor and other growth factor receptors in replicative senescent cells and oxidative stress-induced premature senescent cells. Semi-quantitative RT-PCR was used to analyze the relative expression levels of mRNAs of insulin receptor and growth factor receptors in young control IMR-90 cells (lane 1), contact inhibition induced quiescent cells (lane 2), near senescent cells (PD 58, lane 3), replicative senescent cells (lane 4) and H2O2 induced premature senescent cells (lane 5). Actin mRNA was used as reference. Results of densitometry analysis are expressed as arbitrary unit and summarized in the histograms (shown for IR were the combined densitometry values of the two isoforms). The data represent the mean ± S.E. of three independent experiments. Statistical analysis was performed by StudentÕs t test as compared with young control cells: *P < 0.05, **P < 0.01.
Fig. 3. Protein levels of insulin receptor and other growth factor receptors in replicative senescent cells and oxidative stress-induced premature senescent cells. Western blotting using respective antibodies was used to analyze protein levels of insulin receptor and growth factor receptors in young control IMR-90 cells (lane 1), cells at PD56 (lane 2), cells at PD58 (lane 3), replicative senescent cells (lane 4), deep senescent cells (4 weeks into senescence, lane 5) and H2O2 induced premature senescent cells (lane 6). Actin was used as loading control. Results of densitometry analysis are expressed as arbitrary unit and summarized in the histograms. The data represent the mean ± S.E. of three independent experiments. Statistical analysis was performed by StudentÕs t test as compared with young control cells: *P < 0.05, **P < 0.01.
6392
4. Discussion Many studies have attempted to identify genes/proteins that show age-related changes in their expression in various senescing cells in order to understand molecular mechanisms underlying cellular senescence. DNA microarray and proteomic approaches have been employed in this regard and have generated much useful information in terms of understanding the changes in metabolism, cell cycle regulation, signal transduction and morphology in senescent cells [30–34]. Toussaint and co-workers [31] found that some growth factor receptors such as IGF-1 receptor and EGF receptor showed age- as well as stress-related differential expression in human foreskin fibroblasts. However, candidate analyses of the expression of growth factor receptors both at mRNA and protein levels in a defined cell system under different types of senescence are still lacking. In this study we specifically compared the expression of the insulin receptor, and other major growth factor receptors in proliferating, replicative senescent and H2O2 induced premature senescent human fibroblast IMR-90 cells. In cells which had undergone replicative senescence there was a reduction in protein expression of the insulin receptor, PDGF a-receptor, PDGF b-receptor and IGF-1 receptor compared to young cells. The magnitude of reduction varied greatly among these receptors; the PDGF a-receptor showed the most marked decrease (to almost non-detectable levels in deep senescence) whereas other receptors, such as PDGF b-receptor, only decreased by approximately 10% in deep senescence. These decreases in protein expression of growth receptors may contribute, at least in part, to the loss of proliferative capacity in senescent cells. Age-related downregulation in cell surface growth factor receptors have been observed in various cell systems [19]. Consistent with previous reports that the PDGF receptor was downregulated in ageing cells this study demonstrated a marked decrease of PDGF a-receptor in replicatively senescent human fibroblasts. PDGF is a major potent mitogen for fibroblasts and other cells [35]. PDGF isoforms are homo- and heterodimers of disulfide-bonded A- and B-polypeptide chain. The a-receptor binds both the A- and B-chains of PDGF with high affinity, whereas the b-receptor binds only the B-chain with high affinity [35]. It is conceivable therefore that a decrease in PDGF receptors, particularly such a marked decrease in PDGF a-receptor may have a major deleterious effect in cell signalling in senescence. It should be noted, however, that a decrease in any one particular receptor might not be responsible for the diminished serum responsiveness in senescent cells since such a diminished mitogenic responsiveness generally occurs in complete culture medium. It is also worth noting that molecules other than membrane receptors may also interfere with signalling response to growth factors. For example, Park and co-workers [36,37] demonstrated that some membrane proteins that are involved in receptor endocytosis such as caveolin and amphiphysin-1 were respectively up and downregulated in senescent human fibroblasts and may be involved in functional inhibition of growth factor signalling. Similarly, overexpression of osteonectin has been found in senescent human fibroblasts [38,39] which may be involved in the inhibition of PDGF signalling [40]. It is well known that both insulin receptor isoforms (IR-A [exon 11] and IR-B [exon 11+]) can heterodimerise with IGF-1 receptor to form hybrid receptors [41,42]. These hybrid
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
receptors generally have a higher affinity for IGF-1 than insulin and are therefore believed to provide additional binding sites to IGF-1 and to increase cell sensitivity to this growth receptor [42,43]. As the hybrid receptors are predicted to form randomly it is conceivable that if expression of the insulin receptor becomes less than that of IGF-1 receptor the insulin receptor will be more likely to be involved in IR-IGF-1R hybrid formation thereby render the cells insulin resistant. This may be the case in oxidative stress-induced senescent cells as the insulin receptor showed a decrease (although not statistically significant) whereas IGF-1 receptor remained unchanged (see lane 6 in Fig. 3). Also, decreases in both insulin receptor and IGF-1 receptor in replicative senescent cells will inevitably reduce cell sensitivity to IGF-1. Among the growth factor receptors that decreased at the protein level most of them remained readily detectable in replicatively senescent cells, suggesting that loss of response to mitogenic stimulation in senescent cells can not be solely accounted for at the cell surface receptor level. Alteration of downstream signalling pathways may also contribute to the diminished responsiveness in senescent cells. Indeed downregulation of some components in the two major signalling cascades, the PI-3 kinase/PKB(Akt) and the Raf/MEK/ERK pathways, which are involved in proliferative response to mitogenic signals have been reported in many cell system (reviewed in [18,19]). It is conceivable therefore that loss of proliferative response to mitogenic stimulation is due to the combined consequences of decreases in expression of growth factor receptors and downregulation of downstream signalling components as well as alterations in other molecules that interact with the receptors. It is interesting to note the elevated levels of FGF receptor 1 in near senescent cells as recent studies indicated the negative effects of FGFs and FGF receptors on proliferation of some cell types [44]. Premature senescence induced by oxidative stress shares morphological as well as many molecular features with replicative senescence [7,45]. The premature senescent cells used in this study were induced by acute subcytotoxic H2O2 treatment and displayed a range of markers as in replicative senescent cells (see Fig. 1). Surprisingly, however, the expression profile of the insulin receptor and other growth factor receptors did not reflect what was observed in replicative senescent cells. The insulin receptor showed a decrease in premature senescent cells but the extent of the decrease was not as significant as that in replicative senescent cells. In contrast to decreased levels in replicative senescent cells IGF-1 receptor, PDGF a- and breceptors in premature senescent cells remained essentially unchanged as compared with the control young cells. We have noticed that upon a single treatment with H2O2 a fraction of cells arrested only temporarily and were able to resume cell cycle whereas the majority of cells underwent senescence [7]. We demonstrated that the heterogeneity in premature senescence by oxidative stress correlates with differential DNA damage during the cell cycle [46]. The small fraction of cells that could recover from a single H2O2 treatment can be largely suppressed by a second H2O2 treatment [7]. The premature senescent cells used in this study were induced by two H2O2 treatments thus the absence of significant decrease in growth factor receptors in the H2O2 induced premature senescent cells is unlikely to be due to heterogeneity in the cell population. Rather it suggests that there may be distinct differences between replicative senescence and acute oxidative
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
stress-induced premature senescence. Using proteomic analysis, Toussaint and co-workers [32,33] compared protein profiles between replicative senescence and stress-induced premature senescence and found that only a part of the protein expression changes observed in replicative senescence were also observed in premature senescence. From this proteomic evidence they concluded that replicative senescence and stressinduced premature senescence have different phenotypes [32]. Our observation of the difference in growth factor receptor expression between replicative senescence and H2O2 induced premature senescence is in agreement with this conclusion. It remains to be investigated whether the loss of response to mitogenic stimuli in H2O2 induced premature senescence is due to defects caused in post-receptor signalling components or oxidative damage of the receptors and/or some membrane components that are essential for proper ligand-receptor binding and internalization even though the levels of receptor proteins were not affected. The clear correlations between mRNA and protein levels for insulin receptor and PDGF a-receptor both in replicative and premature senescent cells suggest that these two receptors are largely regulated at transcriptional level. Such correlations were not observed for the PDGF b-receptor and IGF-1 receptor suggesting that post-transcriptional regulation may also be involved in the expression of growth receptors. In conclusion, this study examined for the first time the expression of insulin receptors and other major growth factor receptors at both mRNA and protein levels in human fibroblasts that underwent replicative senescence and oxidatively premature senescence. Apart from FGF receptor and EGF receptor all other major growth factor receptors studied, including the insulin receptor decreased to various extents at the protein level when cells entered replicatively senescent state, thus, may account at least in part for loss of response of senescent cells to mitogenic stimuli. Major growth factor receptors in oxidative stress-induced premature senescent cells, however, remained essentially unchanged, suggesting that replicative senescence and oxidative stress-induced premature senescence may be indeed different phenotypes and that defects in post-receptor signalling components may be more important for the diminished responsiveness to mitogens in stress-induced senescent cells. Acknowledgements: This work was supported in part by the European Union, the Parthenon Trust, the National Institutes of Health and British Heart Foundation.
6393
[7]
[8]
[9]
[10] [11]
[12] [13]
[14]
[15] [16] [17] [18] [19]
[20]
[21]
[22]
References [1] Harley, C.B., Futcher, A.B. and Greider, C.W. (1990) Telomeres shorten during ageing of human fibroblasts. Nature 345, 458–460. [2] Baird, D.M., Rowson, J., Wynford-Thomas, D. and Kipling, D. (2003) Extensive allelic variation and ultrashort telomeres in senescent human cells. Nat. Genet. 33, 203–207. [3] Baird, D.M. and Kipling, D. (2004) The extent and significance of telomere loss with age. Ann. NY Acad. Sci. 1019, 265–268. [4] Di Leonardo, A., Linke, S.P., Clarkin, K. and Wahl, G.M. (1994) DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev. 8, 2540–2551. [5] Chen, Q., Fischer, A., Reagan, J.D., Yan, L.J. and Ames, B.N. (1995) Oxidative DNA damage and senescence of human diploid fibroblast cells. Proc. Natl. Acad. Sci. USA 92, 4337–4341. [6] Robles, S.J. and Adami, G.R. (1998) Agents that cause DNA double strand breaks lead to p16INK4a enrichment and the
[23]
[24]
[25]
[26]
premature senescence of normal fibroblasts. Oncogene 16, 1113– 1123. Chen, J.H., Stoeber, K., Kingsbury, S., Ozanne, S.E., Williams, G.H. and Hales, C.N. (2004) Loss of proliferative capacity and induction of senescence in oxidatively stressed human fibroblasts. J. Biol. Chem. 279, 49439–49446. Ogryzko, V.V., Hirai, T.H., Russanova, V.R., Barbie, D.A. and Howard, B.H. (1996) Human fibroblast commitment to a senescence-like state in response to histone deacetylase inhibitors is cell cycle dependent. Mol. Cell. Biol. 16, 5210–5218. Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D. and Lowe, S.W. (1997) Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88, 593– 602. Zhu, J., Woods, D., McMahon, M. and Bishop, J.M. (1998) Senescence of human fibroblasts induced by oncogenic Raf. Genes Dev. 12, 2997–3007. Dimri, G.P., Itahana, K., Acosta, M. and Campisi, J. (2000) Regulation of a senescence checkpoint response by the E2F1 transcription factor and p14ARF tumor suppressor. Mol. Cell. Biol. 20, 273–285. Li, G.Z., Eller, M.S., Firoozabadi, R. and Gilchrest, B.A. (2003) Evidence that exposure of the telomere 3 0 overhang sequence induces senescence. Proc. Natl. Acad. Sci. USA 100, 527–531. Chen, Q.M., Prowse, K.R., Tu, V.C., Purdom, S. and Linskens, M.H. (2001) Uncoupling the senescent phenotype from telomere shortening in hydrogen peroxide-treated fibroblasts. Exp. Cell Res. 265, 294–303. Duan, J., Duan, J., Zhang, Z. and Tong, T. (2005) Irreversible cellular senescence induced by prolonged exposure to H2O2 involves DNA-damage-and-repair genes and telomere shortening. Int. J. Biochem. Cell Biol. 37, 1407–1420. von Zglinicki, T., Saretzki, G., Docke, W. and Lotze, C. (1995) Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: a model for senescence. Exp. Cell Res. 220, 186–193. von Zglinicki, T., Pilger, R. and Sitte, N. (2000) Accumulation of single-strand breaks is the major cause of telomere shortening in human fibroblasts. Free Radic. Biol. Med. 28, 64–74. von Zglinicki, T. (2002) Oxidative stress shortens telomeres. Trends Biochem. Sci. 27, 339–344. Cristofalo, V.J., Lorenzini, A., Allen, R.G., Torres, C. and Tresini, M. (2004) Replicative senescence: a critical review. Mech. Ageing Dev. 125, 827–848. Yeo, E.J. and Park, S.C. (2002) Age-dependent agonist-specific dysregulation of membrane-mediated signal transduction: emergence of the gate theory of aging. Mech. Ageing Dev. 123, 1563– 1578. Matsuda, T., Okamura, K., Sato, Y., Morimoto, A., Ono, M., Kohno, K. and Kuwano, M. (1992) Decreased response to epidermal growth factor during cellular senescence in cultured human microvascular endothelial cells. J. Cell. Physiol. 150, 510– 516. Tang, Z., Zhang, Z., Zheng, Y., Corbley, M.J. and Tong, T. (1994) Cell aging of human diploid fibroblasts is associated with changes in responsiveness to epidermal growth factor and changes in HER-2 expression. Mech. Ageing Dev. 73, 57–67. Reenstra, W.R., Yaar, M. and Gilchrest, B.A. (1996) Aging affects epidermal growth factor receptor phosphorylation and traffic kinetics. Exp. Cell Res. 227, 252–255. Shiraha, H., Gupta, K., Drabik, K. and Wells, A. (2000) Aging fibroblasts present reduced epidermal growth factor (EGF) responsiveness due to preferential loss of EGF receptors. J. Biol. Chem. 275, 19343–19351. Ribault, D., Habib, M., Abdel-Majid, K., Barbara, A. and Mitrovic, D. (1998) Age-related decrease in the responsiveness of rat articular chondrocytes to EGF is associated with diminished number and affinity for the ligand of cell surface binding sites. Mech. Ageing Dev. 100, 25–40. Aoyagi, M., Fukai, N., Ogami, K., Yamamoto, M. and Yamamoto, K. (1995) Kinetics of 125I-PDGF binding and down-regulation of PDGF receptor in human arterial smooth muscle cell strains during cellular senescence in vitro. J. Cell. Physiol. 164, 376–384. Yeo, E.J., Jang, I.S., Lim, H.K., Ha, K.S. and Park, S.C. (2002) Agonist-specific differential changes of cellular signal transduction
6394
[27]
[28] [29]
[30] [31]
[32]
[33]
[34]
[35] [36]
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394 pathways in senescent human diploid fibroblasts. Exp. Gerontol. 37, 871–883. Mori, S., Kawano, M., Kanzaki, T., Morisaki, N., Saito, Y. and Yoshida, S. (1993) Decreased expression of the platelet-derived growth factor beta-receptor in fibroblasts from a patient with WernerÕs syndrome. Eur. J. Clin. Invest. 23, 161–165. Itahana, K., Dimri, G. and Campisi, J. (2001) Regulation of cellular senescence by p53. Eur. J. Biochem. 268, 2784–2791. Stein, G.H., Drullinger, L.F., Soulard, A. and Dulic, V. (1999) Differential roles for cyclin-dependent kinase inhibitors p21 and p16 in the mechanisms of senescence and differentiation in human fibroblasts. Mol. Cell. Biol. 19, 2109–2117. Shelton, D.N., Chang, E., Whittier, P.S., Choi, D. and Funk, W.D. (1999) Microarray analysis of replicative senescence. Curr. Biol. 9, 939–945. de Magalhaes, J.P., Chainiaux, F., de Longueville, F., Mainfroid, V., Migeot, V., Marcq, L., Remacle, J., Salmon, M. and Toussaint, O. (2004) Gene expression and regulation in H2O2induced premature senescence of human foreskin fibroblasts expressing or not telomerase. Exp. Gerontol. 39, 1379–1389. Dierick, J.F., Eliaers, F., Remacle, J., Raes, M., Fey, S.J., Larsen, P.M. and Toussaint, O. (2002) Stress-induced premature senescence and replicative senescence are different phenotypes, proteomic evidence. Biochem. Pharmacol. 64, 1011–1017. Dierick, J.F., Kalume, D.E., Wenders, F., Salmon, M., Dieu, M., Raes, M., Roepstorff, P. and Toussaint, O. (2002) Identification of 30 protein species involved in replicative senescence and stressinduced premature senescence. FEBS Lett. 531, 499–504. Yoon, I.K., Kim, H.K., Kim, Y.K., Song, I.H., Kim, W., Kim, S., Baek, S.H., Kim, J.H. and Kim, J.R. (2004) Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology. Exp. Gerontol. 39, 1369–1378. Heldin, C.H. and Westermark, B. (1999) Mechanism of action and in vivo role of platelet-derived growth factor. Physiol. Rev. 79, 1283–1316. Park, W.Y., Park, J.S., Cho, K.A., Kim, D.I., Ko, Y.G., Seo, J.S. and Park, S.C. (2000) Up-regulation of caveolin attenuates epidermal growth factor signaling in senescent cells. J. Biol. Chem. 275, 20847–20852.
[37] Park, S.C., Park, J.S., Park, W.Y., Cho, K.A., Ahn, J.S. and Jang, I.S. (2002) Down-regulation of receptor-mediated endocytosis is responsible for senescence-associated hyporesponsiveness. Ann. NY Acad. Sci. 959, 45–49. [38] Lecka-Czernik, B., Moerman, E.J., Jones, R.A. and Goldstein, S. (1996) Identification of gene sequences overexpressed in senescent and Werner syndrome human fibroblasts. Exp. Gerontol. 31, 159– 174. [39] Dumont, P., Burton, M., Chen, Q.M., Gonos, E.S., Frippiat, C., Mazarati, J.B., Eliaers, F., Remacle, J. and Toussaint, O. (2000) Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic. Biol. Med. 28, 361–373. [40] Raines, E.W., Lane, T.F., Iruela-Arispe, M.L., Ross, R. and Sage, E.H. (1992) The extracellular glycoprotein SPARC interacts with platelet-derived growth factor (PDGF)-AB and -BB and inhibits the binding of PDGF to its receptors. Proc. Natl. Acad. Sci. USA 89, 1281–1285. [41] Moxham, C.P. and Jacobs, S. (1992) Insulin/IGF-I receptor hybrids: a mechanism for increasing receptor diversity. J. Cell. Biochem. 48, 136–140. [42] Pandini, G., Frasca, F., Mineo, R., Sciacca, L., Vigneri, R. and Belfiore, A. (2002) Insulin/insulin-like growth factor I hybrid receptors have different biological characteristics depending on the insulin receptor isoform involved. J. Biol. Chem. 277, 39684– 39695. [43] Soos, M.A., Field, C.E. and Siddle, K. (1993) Purified hybrid insulin/insulin-like growth factor-I receptors bind insulin-like growth factor-I, but not insulin, with high affinity. Biochem. J. 290 (Pt 2), 419–426. [44] Ornitz, D.M. and Itoh, N. (2001) Fibroblast growth factors. Genome Biol. 2, REVIEWS3005. [45] Chen, Q. and Ames, B.N. (1994) Senescence-like growth arrest induced by hydrogen peroxide in human diploid fibroblast F65 cells. Proc. Natl. Acad. Sci. USA 91, 4130–4134. [46] Chen, J.H., Ozanne, S.E. and Hales, C.N. (2005) Heterogeneity in premature senescence by oxidative stress correlates with differential DNA damage during the cell cycle. DNA Repair (Amst) 4, 1140–1148.
FEBS 30112
Analysis of expression of growth factor receptors in replicatively and oxidatively senescent human fibroblasts Jian-Hua Chen*, Susan E. Ozanne, C. Nicholas Hales Department of Clinical Biochemistry, University of Cambridge, AddenbrookeÕs Hospital, Level 4, Hills Road, Cambridge CB2 2QR, United Kingdom Received 18 August 2005; accepted 23 September 2005 Available online 25 October 2005 Edited by Vladimir Skulachev
Abstract Replicatively and oxidatively senescent human fibroblasts demonstrate an impaired response to mitogens. To investigate whether this is due to downregulation of growth factor receptors we examined their expression in these two types of senescence. mRNA and protein levels of the insulin receptor and platelet-derived growth factor (PDGF) a-receptor decreased in replicatively senescent cells. The PDGF b-receptor and insulin-like growth factor 1 receptor at the protein level also decreased but remained readily detectable. However, these major growth factor receptors remained unchanged in oxidatively premature senescent cells. This suggests that mechanisms underlying diminished responsiveness to mitogens might be different in replicative senescence and oxidatively premature senescence. 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. Keywords: Senescence; Oxidative stress; Insulin receptor; Growth factor receptor; Mitogen
1. Introduction Cellular senescence is an irreversible growth arrest state in which cells have lost proliferative capacity but stay viable for extended periods of time. Replicative senescence results from serial passage in culture and is generally believed to be triggered by critically shortened telomeres [1–3]. Cellular senescence can be induced prematurely in early passage cells by agents that cause DNA damage [4–7] or disrupt heterochromatin [8], or by strong mitogenic signals [9–11]. Premature senescence can also be induced by exposure of the telomere 3 0 overhang sequence [12]. The phenotype of premature senescence often shares many features of replicative senescence, including distinct morphology, senescence associated b-galactosidase (SA-b-gal) activity and upregulation of p53 pathway. Telomere shortening, however, is not associated with such acutely induced premature senescent cells [13]. This is possibly because cell replication is rapidly halted in the premature senescent cells and cell replication is believed to be required for the telomere shortening [14]. Nevertheless, premature senescence can also be achieved in a telomere* Corresponding author. Fax: +44 1223 330598. E-mail address: [email protected] (J.-H. Chen).
Abbreviations: PDGF, platelet-derived growth factor; FGF, fibroblast growth factor; IGF, insulin-like growth factor; EGF, epidermal growth factor; SA-b-gal, senescence associated b-galactosidase; Rb, retinoblastoma; BrdU, 5-bromo-2 0 -deoxyuridine; PBS, phosphatebuffered saline
dependent manner by exposure to mild oxidative stress [14,15]. This is because oxidative stress causes single strand breaks in telomeric regions which consequently cause accelerated telomere shortening [16,17]. One of the prominent hallmarks of both replicative senescence and premature senescence is their diminished response to serum or growth factors. The mechanisms underlying the hyporesponsiveness to mitogenic stimuli are not fully elucidated. Cellular responses to external signals are mediated via activation of complex signalling cascades that ultimately lead to changes in gene expression. The first event in response to mitogenic signals is the activation of respective cognate receptors, followed by formation of multi-protein complexes, phospholipid turnover, calcium mobilization and activation of protein kinases, phosphatases and transcription factors. This leads to coordinated regulation of proteins that ensure successful cell proliferation. The impaired response of senescent fibroblasts to mitogens suggests inappropriate transmission of signals. Decrease in expression of cell surface receptors in senescent cells may be partly accountable for the diminished response to mitogens. This has been supported by evidence obtained from replicative senescence [18,19]. For example, age-related downregulation of the epidermal growth factor (EGF) receptor has been reported in human microvascular endothelial cells [20], human fibroblasts [21–23] and rat articular chondrocytes [24]. Similarly, age-related reductions in the platelet-derived growth factor (PDGF) binding sites or PDGF receptor have also been demonstrated in several cell systems including human smooth muscle cells [25] and human fibroblasts [26]. Decreased expression of the PDGF b-receptor has been suggested to be a causative factor for the decreased mitogenic response of fibroblasts in WernerÕs syndrome, a premature ageing condition [27]. However, little is known as to whether premature senescent cells also share the same alteration in terms of receptor expression and downstream pathways. The aim of this study was to systematically compare expression of the insulin receptor and other growth factor receptors at mRNA and protein levels in replicatively and oxidatively premature senescent human fibroblasts. This may provide insight into the potential different mechanisms by which replicative and oxidative damage induced senescence occurs.
2. Materials and methods 2.1. Cell culture and H2O2 treatment IMR-90 cells at population doubling (PD) 24.5 were obtained from the America Type Culture Collection (ATCC). The cells were grown in ATCC modified EagleÕs minimal essential medium supplemented with
0014-5793/$30.00 2005 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.febslet.2005.09.102
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
6389
10% fetal bovine serum (FBS, ATCC), 100 U/ml penicillin and 0.1 mg/ ml streptomycin (penicillin-streptomycin solution from Invitrogen). Cells for H2O2 treatment were prepared from the exponential phase around PD 30. H2O2 treatment was carried out 24 h after seeding by incubating 2 · 106 cells in 100-mm dishes in 13 ml of the culture medium containing 600 lM H2O2 for 2 h. For a second H2O2 treatment the cells were 1:2 split after being cultured for 4 days following the first treatment and treated again for 2 h with 600 lM H2O2 24 h after seeding. Trypan blue exclusion assay was carried out to demonstrate that the treatment did not cause any cell death. IMR-90 cells reached replicative senescence at PD 59.
Santa Cruz), anti-PDGF a-receptor antibody (sc-338, Santa Cruz), anti-PDGF b-receptor antibody (06-498, Upstate), anti-fibroblast growth factor (FGF) receptor 1 antibody (05-149, Upstate), anti-insulin-like growth factor (IGF)-1 receptor antibody (sc-713, Santa Cruz), anti-EGF receptor antibody (05-104, Upstate) and anti-b actin antibody (ab6276, abcam). The bound primary antibodies were detected by horseradish peroxidase-conjugated secondary antibodies (Amersham), followed by enhanced chemiluminesence (Amersham). The densities of the bands were quantified using an Alpha Imager (Alpha Innotech Corporation).
2.2. BrdU labeling and SA-b-gal assay Cells were seeded and treated as described above in dishes containing autoclaved coverslips. For 5-bromo-2 0 -deoxyuridine (BrdU) labeling, coverslips were transferred into a 6-well plate and incubated in 2 ml of the culture medium containing 10 lM BrdU for 48 h. Cells on coverslips were then washed with phosphate-buffered saline (PBS), fixed in 4% paraformaldehyde in PBS, washed twice in PBS, permeabilized in 0.2% Triton X-100 and washed in PBS. DNA was denatured by incubation in 2 M HCl for 1 h followed by three washes with PBS. Coverslips were incubated for 1 h with fluorescein-conjugated mouse anti-BrdU monoclonal antibody (1:20 dilution; Alexis Biochemicals) and with DNA stain TOTO-3 0 -iodide (0.5 lM; Molecular Probes), washed three times with PBS, and mounted in Antifade mounting solution (Molecular Probes). For SA-b-gal assay, cells on coverslips were washed twice in PBS, fixed for 5 min in 4% paraformaldehyde in PBS, washed three times in PBS and incubated at 37 C overnight in fresh SA-b-gal staining solution (1 mg of 5-bromo-4chloro-3-indolyl b-D -galactopyranoside [stock = 100 mg/ml of dimethylformamide]/ml of 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 150 mM NaCl, 2 mM MgCl in 40 mM citric acid/sodium phosphate, pH 6.0) [26]. At least 500 cells from each time point were scored under the microscope for BrdU- or SA-b-gal assay.
3. Results
2.3. Semi-quantitative RT-PCR Total RNA was extracted from cell pellets using TRI reagent (Sigma) and quantified spectrophotometrically in capillary cuvettes on GeneQuant (Amersham Pharmacia Biotech). First strand cDNA was reverse transcribed from 0.8 lg of total RNA using a 1st Strand cDNA Synthesis Kit from Roche with random primers p(dN)6 supplied with the kit. PCRs were carried out as follows: 1 cycle of 94 C for 4 min and receptor specifically defined number (see Table 1) of cycles of 94 C for 30 s, 56 C for 45 s, 72 C for 1 min. Primers used for receptor PCR amplifications and sizes of PCR products are shown in Table 1. PCR products were analyzed by electrophoresis on a 1% agarose gel followed by densitometry quantitation using an Alpha Imager (Alpha Innotech Corporation, CA, USA). 2.4. Western blotting Whole cell lysate was prepared by scraping cells in Laemmli buffer [0.12 M Tris, pH 6.8, 4% (w/v) SDS, 20% (v/v) glycerol with protease inhibitors (cocktail from Sigma)]. Protein concentration was determined by the bicinchoninic acid (BCA) method (Sigma) with BSA as a standard. 15 lg of proteins were separated by SDS–PAGE and electrophoretically transferred to nitrocellulose membrane. Blots were probed with the following antibodies: anti-p53 antibody (ab7757, abcam), anti-p21 antibody (H-164, Santa Cruz), anti-p16 antibody (H-156, Santa Cruz), anti-retinoblastoma (Rb) antibody (G3-245, BD PharMingen), anti-insulin receptor b-subunit antibody (sc-711,
3.1. Characterization of replicatively and oxidatively senescent human fibroblasts Replicative senescent cells were obtained when IMR-90 cells showed no more population doubling for 10 days after a serial passage. As shown in Fig. 1(b) replicatively senescent cells displayed typical enlarged morphology that was strikingly different to that of young cells as shown in Fig. 1(a). The senescence biomarker, SA-b-gal was also fully detectable in 98% of the cells at this stage for the senescent cells (Fig. 1(d)) whereas only 14% of young control cells showed SA-b-gal activity (Fig. 1(c)). Furthermore, p53, p21 and p16 were found to be upregulated with Rb being hypophosphorylated in the replicatively senescing cells (Fig. 1(i), lanes 2 and 3). It is interesting to note that in the deep senescent cells (4 weeks into senescence) while p53 and p21 decreased as compared to the newly senescent cells p16 showed a further increase (compare lane 4 to lane 3 in Fig. 1(i)). This is in keeping with cells undergoing replicative senescence in that p53 senses stresses (e.g., telomere shortening), which then activates expression of p21 resulting in cell cycle arrest, whereas p16 is responsible for the maintenance of the senescent state [28,29]. Premature senescence was induced by treating IMR-90 cells with H2O2 as reported previously [7]. As determined by 48 h BrdU labeling, permanent cell cycle arrest increased from 16% in young control cells to over 98% in the treated cells (Fig. 1(e) and (f)). SA-b-gal activity was detectable in 96% treated cells (Fig. 1(h)). In addition, hypophosphorylation of Rb and upregulation of p53, p21 and p16 were also detected in the H2O2-induced premature senescent cells (Fig. 1(i), lane 5). 3.2. Analysis by semi-quantitative RT-PCR In order to investigate whether permanent cell cycle arrest in replicatively senescence and oxidative stress-induced premature senescence is due to alterations in expression of growth factor receptors we carried out semi-quantitative RT-PCR to determine relative mRNA levels in young and senescing IMR-90 cells. As shown in Fig. 2, the insulin
Table 1 Primers used for RT-PCR Forward primers (5 0 –3 0 ) IR PDGFR-a PDGFR-b IGF-1R FGFR1 EGFR Actin
GCGGAAGACAGTGAGCTGTT CCCAGATGTAGCCTTTGTAC ACACTGCACGAGAAGAAAGG CATTGAGGAGGTCACAGAG CTCTATGCTTGCGTAACCAG ACGCAGTTGGGCACTTTTGA CAACTGGGACGACATGGAGA
Reverse primers (5 0 –3 0 ) GATGCGATAGCCCGTGAAGT GACCGTCAAAGTGTACACCA CGGTTGTCTTTGAACCACAG CAAAGACGAAGTTGGAGGC TTGCTCCCATTCACCTCGAT TGGTCAGTTTCTGGCAGTTC ATACCCCTCGTAGATGGGCA
PCR product size (bp) +
(11 ) 474/(11 ) 438 463 590 431 599 520 277
Cycle 34 28 29 29 32 29 28
6390
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
did not affect the expression of the receptors analyzed (Fig. 2, lane 2). In H2O2 induced premature senescent cells, although the insulin receptor showed a border-line significant decrease (P = 0.057 by StudentÕs t test) as compared to the young control cells the decrease was not as pronounced as in the replicatively senescent cells (compare lane 5 to lanes 1 and 4 in Fig. 2). PDGF a-receptor showed no significant decrease as compared to the control cells, which was in contrast to the marked decrease seen in the replicatively senescent cells (Fig. 2). Receptors for IGF-1, FGF and EGF as well as PDGF b-receptor did not show any significant change in the premature senescent cells as compared to that in replicatively senescent cells (Fig. 2). As measurement of the mRNA level cannot directly account for actual functional changes in the receptors we next examined the expression at protein level by Western blotting.
Fig. 1. Replicatively senescent and oxidative stress-induced premature senescent cells. (a) Morphology of young dividing IMR-90 cells; (b) morphology of replicative senescent cells; (c) SA-b-gal assay on young cells; (d) SA-b-gal assay on replicative senescent cells; (e) BrdU incorporation assay on young control cells; (f) BrdU incorporation assay on H2O2 induced premature senescent cells; (g) SA-b-gal assay on young control cells; (h) SA-b-gal assay on H2O2 induced premature senescent cells; (i) Western blotting of p53, p21, p16 and Rb in young control cells (lane 1), near senescent cells (PD58, lane 2), replicative senescent cells (lane 3), deep replicative senescent cells (4 weeks into senescence, lane 4) and H2O2 induced premature senescent cells (lane 5). Actin was used as loading control.
receptor (both isoforms of exon 11+ and 11) and PDGF areceptor showed progressive decreases when IMR-90 cells underwent replicative senescence (compare lane 4 to lanes 1 and 3). However, the PDGF b-receptor, IGF-1 receptor, FGF receptor 1 and EGF receptor did not show any difference in relation to senescence status (Fig. 2). The decrease in mRNA levels of the insulin receptor and PDGF a-receptor seen in replicatively senescent cells was not observed in quiescent cells induced by contact inhibition (Fig. 2). Apart from the IGF-1 receptor which showed an increase in confluence induced quiescent cells, contact inhibition essentially
3.3. Analysis by Western blotting In order to see whether the differential expression of the growth factor receptors observed at the mRNA level were also reflected at the protein level, we further carried out Western blot analysis using whole cell lystaes prepared at various stages during cell senescing. As shown in Fig. 3, insulin receptor b-subunit decreased progressively as cells underwent replicative senescence (Fig. 3, lanes 1–4). Further decrease was not observed in deep senescent cells (4 weeks into senescence, Fig. 3, lane 5). PDGF a-receptor decreased markedly in replicatively senescent cells (Fig. 3, lanes 1–4). A further decrease of the receptor was detected in the deep senescent cells (Fig. 3, lane 5). Similarly, IGF-1 receptor also decreased progressively as cells underwent replicative senescence with a further decrease being detected in the deep senescent cells (Fig. 3). The PDGF b-receptor only showed a significant decrease in the deep replicative senescent cells (Fig. 3). In contrast to the marked decrease of PDGF areceptor, however, a substantial level of IGF-1 receptor and PDGF b-receptor still could be detected in senescent and deep senescent cells (Fig. 3, lanes 4 and 5). No decrease was observed in PDGF a-receptor and IGF-1 receptor in contact inhibited cells (data not shown). This suggests that the decrease in the growth factor receptors observed in the replicatively senescent cells was not related to reversible cell cycle arrest. FGF receptor 1 level increased as cells underwent senescence with the increase in the near senescent cells being statistically significant (Fig. 3). EGF receptor showed no significant change in replicatively senescing cells (Fig. 3). The protein expression of receptors in H2O2 induced premature senescent cells did not follow the same pattern as seen in replicatively senescent cells. Insulin receptor b-subunit showed a decrease in premature senescent cells but the decrease was not as significant as in the replicatively senescent cells (Fig. 3, lane 6; P = 0.06). Receptors for PDGF, IGF-1, FGF and EGF did not show any significant changes in premature senescent cells (Fig. 3). No significant changes in the levels of these receptors could be detected in the premature senescent cells that had been cultured for three weeks (data not shown). This suggests that the difference in protein expression levels observed in replicative and H2O2 induced premature senescence did not relate to the period of culture.
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
6391
Fig. 2. mRNA levels of insulin receptor and other growth factor receptors in replicative senescent cells and oxidative stress-induced premature senescent cells. Semi-quantitative RT-PCR was used to analyze the relative expression levels of mRNAs of insulin receptor and growth factor receptors in young control IMR-90 cells (lane 1), contact inhibition induced quiescent cells (lane 2), near senescent cells (PD 58, lane 3), replicative senescent cells (lane 4) and H2O2 induced premature senescent cells (lane 5). Actin mRNA was used as reference. Results of densitometry analysis are expressed as arbitrary unit and summarized in the histograms (shown for IR were the combined densitometry values of the two isoforms). The data represent the mean ± S.E. of three independent experiments. Statistical analysis was performed by StudentÕs t test as compared with young control cells: *P < 0.05, **P < 0.01.
Fig. 3. Protein levels of insulin receptor and other growth factor receptors in replicative senescent cells and oxidative stress-induced premature senescent cells. Western blotting using respective antibodies was used to analyze protein levels of insulin receptor and growth factor receptors in young control IMR-90 cells (lane 1), cells at PD56 (lane 2), cells at PD58 (lane 3), replicative senescent cells (lane 4), deep senescent cells (4 weeks into senescence, lane 5) and H2O2 induced premature senescent cells (lane 6). Actin was used as loading control. Results of densitometry analysis are expressed as arbitrary unit and summarized in the histograms. The data represent the mean ± S.E. of three independent experiments. Statistical analysis was performed by StudentÕs t test as compared with young control cells: *P < 0.05, **P < 0.01.
6392
4. Discussion Many studies have attempted to identify genes/proteins that show age-related changes in their expression in various senescing cells in order to understand molecular mechanisms underlying cellular senescence. DNA microarray and proteomic approaches have been employed in this regard and have generated much useful information in terms of understanding the changes in metabolism, cell cycle regulation, signal transduction and morphology in senescent cells [30–34]. Toussaint and co-workers [31] found that some growth factor receptors such as IGF-1 receptor and EGF receptor showed age- as well as stress-related differential expression in human foreskin fibroblasts. However, candidate analyses of the expression of growth factor receptors both at mRNA and protein levels in a defined cell system under different types of senescence are still lacking. In this study we specifically compared the expression of the insulin receptor, and other major growth factor receptors in proliferating, replicative senescent and H2O2 induced premature senescent human fibroblast IMR-90 cells. In cells which had undergone replicative senescence there was a reduction in protein expression of the insulin receptor, PDGF a-receptor, PDGF b-receptor and IGF-1 receptor compared to young cells. The magnitude of reduction varied greatly among these receptors; the PDGF a-receptor showed the most marked decrease (to almost non-detectable levels in deep senescence) whereas other receptors, such as PDGF b-receptor, only decreased by approximately 10% in deep senescence. These decreases in protein expression of growth receptors may contribute, at least in part, to the loss of proliferative capacity in senescent cells. Age-related downregulation in cell surface growth factor receptors have been observed in various cell systems [19]. Consistent with previous reports that the PDGF receptor was downregulated in ageing cells this study demonstrated a marked decrease of PDGF a-receptor in replicatively senescent human fibroblasts. PDGF is a major potent mitogen for fibroblasts and other cells [35]. PDGF isoforms are homo- and heterodimers of disulfide-bonded A- and B-polypeptide chain. The a-receptor binds both the A- and B-chains of PDGF with high affinity, whereas the b-receptor binds only the B-chain with high affinity [35]. It is conceivable therefore that a decrease in PDGF receptors, particularly such a marked decrease in PDGF a-receptor may have a major deleterious effect in cell signalling in senescence. It should be noted, however, that a decrease in any one particular receptor might not be responsible for the diminished serum responsiveness in senescent cells since such a diminished mitogenic responsiveness generally occurs in complete culture medium. It is also worth noting that molecules other than membrane receptors may also interfere with signalling response to growth factors. For example, Park and co-workers [36,37] demonstrated that some membrane proteins that are involved in receptor endocytosis such as caveolin and amphiphysin-1 were respectively up and downregulated in senescent human fibroblasts and may be involved in functional inhibition of growth factor signalling. Similarly, overexpression of osteonectin has been found in senescent human fibroblasts [38,39] which may be involved in the inhibition of PDGF signalling [40]. It is well known that both insulin receptor isoforms (IR-A [exon 11] and IR-B [exon 11+]) can heterodimerise with IGF-1 receptor to form hybrid receptors [41,42]. These hybrid
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
receptors generally have a higher affinity for IGF-1 than insulin and are therefore believed to provide additional binding sites to IGF-1 and to increase cell sensitivity to this growth receptor [42,43]. As the hybrid receptors are predicted to form randomly it is conceivable that if expression of the insulin receptor becomes less than that of IGF-1 receptor the insulin receptor will be more likely to be involved in IR-IGF-1R hybrid formation thereby render the cells insulin resistant. This may be the case in oxidative stress-induced senescent cells as the insulin receptor showed a decrease (although not statistically significant) whereas IGF-1 receptor remained unchanged (see lane 6 in Fig. 3). Also, decreases in both insulin receptor and IGF-1 receptor in replicative senescent cells will inevitably reduce cell sensitivity to IGF-1. Among the growth factor receptors that decreased at the protein level most of them remained readily detectable in replicatively senescent cells, suggesting that loss of response to mitogenic stimulation in senescent cells can not be solely accounted for at the cell surface receptor level. Alteration of downstream signalling pathways may also contribute to the diminished responsiveness in senescent cells. Indeed downregulation of some components in the two major signalling cascades, the PI-3 kinase/PKB(Akt) and the Raf/MEK/ERK pathways, which are involved in proliferative response to mitogenic signals have been reported in many cell system (reviewed in [18,19]). It is conceivable therefore that loss of proliferative response to mitogenic stimulation is due to the combined consequences of decreases in expression of growth factor receptors and downregulation of downstream signalling components as well as alterations in other molecules that interact with the receptors. It is interesting to note the elevated levels of FGF receptor 1 in near senescent cells as recent studies indicated the negative effects of FGFs and FGF receptors on proliferation of some cell types [44]. Premature senescence induced by oxidative stress shares morphological as well as many molecular features with replicative senescence [7,45]. The premature senescent cells used in this study were induced by acute subcytotoxic H2O2 treatment and displayed a range of markers as in replicative senescent cells (see Fig. 1). Surprisingly, however, the expression profile of the insulin receptor and other growth factor receptors did not reflect what was observed in replicative senescent cells. The insulin receptor showed a decrease in premature senescent cells but the extent of the decrease was not as significant as that in replicative senescent cells. In contrast to decreased levels in replicative senescent cells IGF-1 receptor, PDGF a- and breceptors in premature senescent cells remained essentially unchanged as compared with the control young cells. We have noticed that upon a single treatment with H2O2 a fraction of cells arrested only temporarily and were able to resume cell cycle whereas the majority of cells underwent senescence [7]. We demonstrated that the heterogeneity in premature senescence by oxidative stress correlates with differential DNA damage during the cell cycle [46]. The small fraction of cells that could recover from a single H2O2 treatment can be largely suppressed by a second H2O2 treatment [7]. The premature senescent cells used in this study were induced by two H2O2 treatments thus the absence of significant decrease in growth factor receptors in the H2O2 induced premature senescent cells is unlikely to be due to heterogeneity in the cell population. Rather it suggests that there may be distinct differences between replicative senescence and acute oxidative
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394
stress-induced premature senescence. Using proteomic analysis, Toussaint and co-workers [32,33] compared protein profiles between replicative senescence and stress-induced premature senescence and found that only a part of the protein expression changes observed in replicative senescence were also observed in premature senescence. From this proteomic evidence they concluded that replicative senescence and stressinduced premature senescence have different phenotypes [32]. Our observation of the difference in growth factor receptor expression between replicative senescence and H2O2 induced premature senescence is in agreement with this conclusion. It remains to be investigated whether the loss of response to mitogenic stimuli in H2O2 induced premature senescence is due to defects caused in post-receptor signalling components or oxidative damage of the receptors and/or some membrane components that are essential for proper ligand-receptor binding and internalization even though the levels of receptor proteins were not affected. The clear correlations between mRNA and protein levels for insulin receptor and PDGF a-receptor both in replicative and premature senescent cells suggest that these two receptors are largely regulated at transcriptional level. Such correlations were not observed for the PDGF b-receptor and IGF-1 receptor suggesting that post-transcriptional regulation may also be involved in the expression of growth receptors. In conclusion, this study examined for the first time the expression of insulin receptors and other major growth factor receptors at both mRNA and protein levels in human fibroblasts that underwent replicative senescence and oxidatively premature senescence. Apart from FGF receptor and EGF receptor all other major growth factor receptors studied, including the insulin receptor decreased to various extents at the protein level when cells entered replicatively senescent state, thus, may account at least in part for loss of response of senescent cells to mitogenic stimuli. Major growth factor receptors in oxidative stress-induced premature senescent cells, however, remained essentially unchanged, suggesting that replicative senescence and oxidative stress-induced premature senescence may be indeed different phenotypes and that defects in post-receptor signalling components may be more important for the diminished responsiveness to mitogens in stress-induced senescent cells. Acknowledgements: This work was supported in part by the European Union, the Parthenon Trust, the National Institutes of Health and British Heart Foundation.
6393
[7]
[8]
[9]
[10] [11]
[12] [13]
[14]
[15] [16] [17] [18] [19]
[20]
[21]
[22]
References [1] Harley, C.B., Futcher, A.B. and Greider, C.W. (1990) Telomeres shorten during ageing of human fibroblasts. Nature 345, 458–460. [2] Baird, D.M., Rowson, J., Wynford-Thomas, D. and Kipling, D. (2003) Extensive allelic variation and ultrashort telomeres in senescent human cells. Nat. Genet. 33, 203–207. [3] Baird, D.M. and Kipling, D. (2004) The extent and significance of telomere loss with age. Ann. NY Acad. Sci. 1019, 265–268. [4] Di Leonardo, A., Linke, S.P., Clarkin, K. and Wahl, G.M. (1994) DNA damage triggers a prolonged p53-dependent G1 arrest and long-term induction of Cip1 in normal human fibroblasts. Genes Dev. 8, 2540–2551. [5] Chen, Q., Fischer, A., Reagan, J.D., Yan, L.J. and Ames, B.N. (1995) Oxidative DNA damage and senescence of human diploid fibroblast cells. Proc. Natl. Acad. Sci. USA 92, 4337–4341. [6] Robles, S.J. and Adami, G.R. (1998) Agents that cause DNA double strand breaks lead to p16INK4a enrichment and the
[23]
[24]
[25]
[26]
premature senescence of normal fibroblasts. Oncogene 16, 1113– 1123. Chen, J.H., Stoeber, K., Kingsbury, S., Ozanne, S.E., Williams, G.H. and Hales, C.N. (2004) Loss of proliferative capacity and induction of senescence in oxidatively stressed human fibroblasts. J. Biol. Chem. 279, 49439–49446. Ogryzko, V.V., Hirai, T.H., Russanova, V.R., Barbie, D.A. and Howard, B.H. (1996) Human fibroblast commitment to a senescence-like state in response to histone deacetylase inhibitors is cell cycle dependent. Mol. Cell. Biol. 16, 5210–5218. Serrano, M., Lin, A.W., McCurrach, M.E., Beach, D. and Lowe, S.W. (1997) Oncogenic ras provokes premature cell senescence associated with accumulation of p53 and p16INK4a. Cell 88, 593– 602. Zhu, J., Woods, D., McMahon, M. and Bishop, J.M. (1998) Senescence of human fibroblasts induced by oncogenic Raf. Genes Dev. 12, 2997–3007. Dimri, G.P., Itahana, K., Acosta, M. and Campisi, J. (2000) Regulation of a senescence checkpoint response by the E2F1 transcription factor and p14ARF tumor suppressor. Mol. Cell. Biol. 20, 273–285. Li, G.Z., Eller, M.S., Firoozabadi, R. and Gilchrest, B.A. (2003) Evidence that exposure of the telomere 3 0 overhang sequence induces senescence. Proc. Natl. Acad. Sci. USA 100, 527–531. Chen, Q.M., Prowse, K.R., Tu, V.C., Purdom, S. and Linskens, M.H. (2001) Uncoupling the senescent phenotype from telomere shortening in hydrogen peroxide-treated fibroblasts. Exp. Cell Res. 265, 294–303. Duan, J., Duan, J., Zhang, Z. and Tong, T. (2005) Irreversible cellular senescence induced by prolonged exposure to H2O2 involves DNA-damage-and-repair genes and telomere shortening. Int. J. Biochem. Cell Biol. 37, 1407–1420. von Zglinicki, T., Saretzki, G., Docke, W. and Lotze, C. (1995) Mild hyperoxia shortens telomeres and inhibits proliferation of fibroblasts: a model for senescence. Exp. Cell Res. 220, 186–193. von Zglinicki, T., Pilger, R. and Sitte, N. (2000) Accumulation of single-strand breaks is the major cause of telomere shortening in human fibroblasts. Free Radic. Biol. Med. 28, 64–74. von Zglinicki, T. (2002) Oxidative stress shortens telomeres. Trends Biochem. Sci. 27, 339–344. Cristofalo, V.J., Lorenzini, A., Allen, R.G., Torres, C. and Tresini, M. (2004) Replicative senescence: a critical review. Mech. Ageing Dev. 125, 827–848. Yeo, E.J. and Park, S.C. (2002) Age-dependent agonist-specific dysregulation of membrane-mediated signal transduction: emergence of the gate theory of aging. Mech. Ageing Dev. 123, 1563– 1578. Matsuda, T., Okamura, K., Sato, Y., Morimoto, A., Ono, M., Kohno, K. and Kuwano, M. (1992) Decreased response to epidermal growth factor during cellular senescence in cultured human microvascular endothelial cells. J. Cell. Physiol. 150, 510– 516. Tang, Z., Zhang, Z., Zheng, Y., Corbley, M.J. and Tong, T. (1994) Cell aging of human diploid fibroblasts is associated with changes in responsiveness to epidermal growth factor and changes in HER-2 expression. Mech. Ageing Dev. 73, 57–67. Reenstra, W.R., Yaar, M. and Gilchrest, B.A. (1996) Aging affects epidermal growth factor receptor phosphorylation and traffic kinetics. Exp. Cell Res. 227, 252–255. Shiraha, H., Gupta, K., Drabik, K. and Wells, A. (2000) Aging fibroblasts present reduced epidermal growth factor (EGF) responsiveness due to preferential loss of EGF receptors. J. Biol. Chem. 275, 19343–19351. Ribault, D., Habib, M., Abdel-Majid, K., Barbara, A. and Mitrovic, D. (1998) Age-related decrease in the responsiveness of rat articular chondrocytes to EGF is associated with diminished number and affinity for the ligand of cell surface binding sites. Mech. Ageing Dev. 100, 25–40. Aoyagi, M., Fukai, N., Ogami, K., Yamamoto, M. and Yamamoto, K. (1995) Kinetics of 125I-PDGF binding and down-regulation of PDGF receptor in human arterial smooth muscle cell strains during cellular senescence in vitro. J. Cell. Physiol. 164, 376–384. Yeo, E.J., Jang, I.S., Lim, H.K., Ha, K.S. and Park, S.C. (2002) Agonist-specific differential changes of cellular signal transduction
6394
[27]
[28] [29]
[30] [31]
[32]
[33]
[34]
[35] [36]
J.-H. Chen et al. / FEBS Letters 579 (2005) 6388–6394 pathways in senescent human diploid fibroblasts. Exp. Gerontol. 37, 871–883. Mori, S., Kawano, M., Kanzaki, T., Morisaki, N., Saito, Y. and Yoshida, S. (1993) Decreased expression of the platelet-derived growth factor beta-receptor in fibroblasts from a patient with WernerÕs syndrome. Eur. J. Clin. Invest. 23, 161–165. Itahana, K., Dimri, G. and Campisi, J. (2001) Regulation of cellular senescence by p53. Eur. J. Biochem. 268, 2784–2791. Stein, G.H., Drullinger, L.F., Soulard, A. and Dulic, V. (1999) Differential roles for cyclin-dependent kinase inhibitors p21 and p16 in the mechanisms of senescence and differentiation in human fibroblasts. Mol. Cell. Biol. 19, 2109–2117. Shelton, D.N., Chang, E., Whittier, P.S., Choi, D. and Funk, W.D. (1999) Microarray analysis of replicative senescence. Curr. Biol. 9, 939–945. de Magalhaes, J.P., Chainiaux, F., de Longueville, F., Mainfroid, V., Migeot, V., Marcq, L., Remacle, J., Salmon, M. and Toussaint, O. (2004) Gene expression and regulation in H2O2induced premature senescence of human foreskin fibroblasts expressing or not telomerase. Exp. Gerontol. 39, 1379–1389. Dierick, J.F., Eliaers, F., Remacle, J., Raes, M., Fey, S.J., Larsen, P.M. and Toussaint, O. (2002) Stress-induced premature senescence and replicative senescence are different phenotypes, proteomic evidence. Biochem. Pharmacol. 64, 1011–1017. Dierick, J.F., Kalume, D.E., Wenders, F., Salmon, M., Dieu, M., Raes, M., Roepstorff, P. and Toussaint, O. (2002) Identification of 30 protein species involved in replicative senescence and stressinduced premature senescence. FEBS Lett. 531, 499–504. Yoon, I.K., Kim, H.K., Kim, Y.K., Song, I.H., Kim, W., Kim, S., Baek, S.H., Kim, J.H. and Kim, J.R. (2004) Exploration of replicative senescence-associated genes in human dermal fibroblasts by cDNA microarray technology. Exp. Gerontol. 39, 1369–1378. Heldin, C.H. and Westermark, B. (1999) Mechanism of action and in vivo role of platelet-derived growth factor. Physiol. Rev. 79, 1283–1316. Park, W.Y., Park, J.S., Cho, K.A., Kim, D.I., Ko, Y.G., Seo, J.S. and Park, S.C. (2000) Up-regulation of caveolin attenuates epidermal growth factor signaling in senescent cells. J. Biol. Chem. 275, 20847–20852.
[37] Park, S.C., Park, J.S., Park, W.Y., Cho, K.A., Ahn, J.S. and Jang, I.S. (2002) Down-regulation of receptor-mediated endocytosis is responsible for senescence-associated hyporesponsiveness. Ann. NY Acad. Sci. 959, 45–49. [38] Lecka-Czernik, B., Moerman, E.J., Jones, R.A. and Goldstein, S. (1996) Identification of gene sequences overexpressed in senescent and Werner syndrome human fibroblasts. Exp. Gerontol. 31, 159– 174. [39] Dumont, P., Burton, M., Chen, Q.M., Gonos, E.S., Frippiat, C., Mazarati, J.B., Eliaers, F., Remacle, J. and Toussaint, O. (2000) Induction of replicative senescence biomarkers by sublethal oxidative stresses in normal human fibroblast. Free Radic. Biol. Med. 28, 361–373. [40] Raines, E.W., Lane, T.F., Iruela-Arispe, M.L., Ross, R. and Sage, E.H. (1992) The extracellular glycoprotein SPARC interacts with platelet-derived growth factor (PDGF)-AB and -BB and inhibits the binding of PDGF to its receptors. Proc. Natl. Acad. Sci. USA 89, 1281–1285. [41] Moxham, C.P. and Jacobs, S. (1992) Insulin/IGF-I receptor hybrids: a mechanism for increasing receptor diversity. J. Cell. Biochem. 48, 136–140. [42] Pandini, G., Frasca, F., Mineo, R., Sciacca, L., Vigneri, R. and Belfiore, A. (2002) Insulin/insulin-like growth factor I hybrid receptors have different biological characteristics depending on the insulin receptor isoform involved. J. Biol. Chem. 277, 39684– 39695. [43] Soos, M.A., Field, C.E. and Siddle, K. (1993) Purified hybrid insulin/insulin-like growth factor-I receptors bind insulin-like growth factor-I, but not insulin, with high affinity. Biochem. J. 290 (Pt 2), 419–426. [44] Ornitz, D.M. and Itoh, N. (2001) Fibroblast growth factors. Genome Biol. 2, REVIEWS3005. [45] Chen, Q. and Ames, B.N. (1994) Senescence-like growth arrest induced by hydrogen peroxide in human diploid fibroblast F65 cells. Proc. Natl. Acad. Sci. USA 91, 4130–4134. [46] Chen, J.H., Ozanne, S.E. and Hales, C.N. (2005) Heterogeneity in premature senescence by oxidative stress correlates with differential DNA damage during the cell cycle. DNA Repair (Amst) 4, 1140–1148.