- Email: [email protected]
Analysis of Sarcoptes scabiei finds no evidence of infection with Wolbachia
International Journal for Parasitology 35 (2005) 131–135 www.parasitology-online.com
Rapid communication
Analysis of Sarcoptes scabiei finds no evidence of infection with Wolbachia K.E. Mounseya,b, D.C. Holta,b, K. Fischerd, D.J. Kempd, B.J. Curriea,b,c, S.F. Waltona,b,* a
Menzies School of Health Research, Darwin, NT, Australia b Charles Darwin University, Darwin, NT, Australia c Northern Territory Clinical School, Flinders University, Darwin, NT, Australia d Queensland Institute of Medical Research, Brisbane, QLD, Australia Received 15 November 2004; received in revised form 22 November 2004; accepted 22 November 2004
Abstract The endosymbiont Wolbachia has been detected in a range of filarial nematodes and parasitic mites and is known to affect host reproductive compatibility and potentially evolutionary processes. PCR of Wolbachia surface protein (wsp), ftsZ and 16SrRNA genes from individual Sarcoptes scabiei mites obtained from a series of individual hosts, and database searches of an S. scabiei var. hominis EST library failed to detect Wolbachia genes. Therefore, Wolbachia appears not to be involved in the genetic subdivision observed between varieties of host-associated S. scabiei or, involved in the inflammatory disease pathogenesis of scabies unlike its activity in filarial infection. q 2004 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: Wolbachia; Sarcoptes scabiei; PCR
a-Proteobacteria of the genus Wolbachia are widespread endosymbionts of filarial nematodes and arthropods. They are generally found in the reproductive tissues of their host and are transmitted from infected females to their progeny. Wolbachia are most notoriously known for manipulating host reproduction to increase the proportion of females in the population. Consequently, infection with Wolbachia can result in male killing, parthenogenesis and feminisation (Stouthamer et al., 1993; Kageyama et al., 1998; Fialho and Stevens, 2000). Further, cytoplasmic incompatibility may occur between individuals when infected males mate with uninfected females, or between hosts carrying different variants of Wolbachia (Yen and Barr, 1971). Wolbachia is therefore proposed to have long term consequences on the evolution of its host organisms (Charlat et al., 2003). There have been numerous PCR-based surveys reporting that Wolbachia is widespread in arthropods, with distribution reported to be as high as 76% of 63 species examined * Corresponding author. Address: Menzies School of Health Research, P.O. Box 41096, Casuarina, NT 0811, Australia. Tel.: C61 8 8922 8928; fax: C61 8 8927 5187. E-mail address: [email protected] (S.F. Walton).
(Jeyaprakash and Hoy, 2000). A recent survey of Lepidoptera in Japan reported a 45% infection rate of 49 species tested (Tagami and Miura, 2004). Wolbachia are also found in most filarial nematodes, where they may play important roles in nematode reproduction and development (Hise et al., 2004). Importantly in nematodes, antibiotics targeted at the bacteria eventually result in host death, and thus antibiotic therapy has been heralded as a novel treatment for filariasis (Taylor and Hoerauf, 2001). This approach may also help overcome the severe post-treatment inflammatory response observed in filariasis caused by the release of Wolbachia into the blood (Cross et al., 2001). Several studies have identified Wolbachia in Acari, with surveys focusing on spider (Tetranychidae) and predatory (Phytoseiidae) mites, with prevalence rates of Wolbachia ranging from 17 to 30% of mite species tested (Breeuwer and Jacobs, 1996; Gotoh et al., 2003; Zchori-Fein and Perlman, 2004). These studies have commonly found that not all individuals of Tetranychidae populations were infected with Wolbachia. However, these surveys may have underestimated the prevalence of infection due to a low level of Wolbachia compared to host DNA, resulting in false negatives. In contrast, a long PCR approach
0020-7519/$30.00 q 2004 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijpara.2004.11.007
132
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135
consistently detected Wolbachia in mite samples (which previously failed to amplify with initial PCR) and was estimated to be seven times more sensitive than standard PCR (Jeyaprakash and Hoy, 2000, 2004). Scabies is a disease of public health significance caused by the ectoparasitic mite Sarcoptes scabiei (Acari: Sarcoptidae). Molecular studies have documented evidence of genetic division and limited interbreeding between varieties of host-associated mites (Walton et al., 1999, 2004). One hypothesis for such division is cytoplasmic incompatibility between scabies mites from different hosts carrying different variants of Wolbachia. Furthermore, the acute inflammatory response observed in scabies could partly be explained by the presence of Wolbachia. If Wolbachia were detected in S. scabiei there could be significant implications on population genetics, disease pathogenesis and treatment options for patients with scabies. In this study we examined different host derived populations of S. scabiei for the presence of Wolbachia using both PCR and database searches of a S. scabiei var. hominis EST library of over 35,000 sequences derived from approximately 600 mites. Sarcoptes scabiei used in this study were obtained from the Menzies School of Health Research collection, stored at K80 8C. Single mites had either been frozen without additive or frozen in digestion buffer (500 mg/mL proteinase K, 50 mM Tris–HCl, 1 mM EDTA, 0.5% SDS, pH 8.5). A total of 24 mites were tested, with two mites each obtained from 12 different hosts representing six species from a range of geographic locations (Table 1). Drosophila simulans strains known to be infected with Wolbachia were used as positive controls, obtained from the Centre for Environmental Stress and Adaptation Research (Latrobe University, Victoria, Australia). Frozen mites were homogensied in either 20 or 50 mL of PrepMan Ultra solution (Applied Biosystems, Foster City, CA, USA) using a motorised micropestle (Kontes). The samples were then boiled for 10 min and cooled on ice. Drosophila simulans DNA was prepared in the same way, except only the abdomen was used for DNA extraction, and the sample was homogenised in 50 mL of PrepMan Ultra solution. For mites stored in digestion buffer, 20 mL sterile distilled water was added and the samples incubated at room temperature for 2 h. PCR was performed on all samples to assess the suitability of DNA for further PCR amplification using universal insect 12SrRNA primers SRJ and SRN (Table 2). Reactions contained 1 mL of template DNA, 1!PCR Buffer (Qiagen, Clifton Hill, Victoria, Australia), 0.2 mM dNTPs, 0.125 mM of each primer and 1.25 U Taq polymerase (Qiagen) in a total reaction volume of 25 mL. Tween 20 was added to a final concentration of 2% to reactions, where the template DNA was prepared in digestion buffer. Samples were initially denatured for 2 min, followed by 35 cycles each consisting of 94 8C for 30 s, 40 8C for 30 s and 60 8C for 45 s.
Table 1 Sarcoptes scabiei mites tested for Wolbachia in this study Sample
Host species (common name)
Geographical origin
HS1-1
Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Macropus agilis (Agile wallaby) Macropus agilis (Agile wallaby) Sus domesticus (Domestic pig) Sus domesticus (Domestic pig) Vombatus ursinus (Wombat) Vombatus ursinus (Wombat) Cervus elaphus Cervus elaphus
Northern Territory, Australia
HS1-2 HS2-1 HS2-2 HS3-1 HS3-2 HS4-1 HS4-2 HS5-1 HS5-2 CF1-1 CF1-2 CF2-1 CF2-2 CF3-1 CF3-2 Wal-1 Wal-2 Pig-1 Pig-2 Wom-1 Wom-2 SpD1 SpD2
Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Panama Panama Panama Panama Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia USA USA Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Victoria, Australia Victoria, Australia Spain Spain
PCR to detect Wolbachia was performed on 12SrRNA PCR positive DNA samples. A long PCR technique was employed based on the FtsZ and wsp (Wolbachia Surface Protein) primers and method described by Jeyaprakash and Hoy (2000) (Table 2). Fifty microlitre reactions contained 1 mL template DNA, 1!PC2 buffer (50 mM Tris, pH 9.1, 16 mM ammonium sulfate, and 2.5 mM MgCl2), 0.35 mM dNTPs, 1.6 mM forward and reverse primers and 0.4 mL of a mixture of 5 U Taq to 1 U Pwo polymerase. Reactions were initially denatured for 2 min at 94 8C, then subjected to 10 cycles of 94 8C for 10 s, 65 8C for 30 s and 68 8C for 1 min, followed by 25 cycles of 94 8C for 10 s, 65 8C for 30 s and 68 8C for 1 min initially with an additional 20 s added to each subsequent cycle. To assess PCR sensitivity and test for inhibition, wsp DNA amplified from D. simulans was purified with MinElute purification columns (Qiagen) and serially diluted from 10 ng/mL to 1 fg/mL. These dilutions
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135
133
Table 2 PCR primers used in this study Name
Sequence (5 0 -3)
Reference
SRJ (insect 12S) SRN (insect 12S) Wsp-F Wsp-R FtsZ-F FtsZ-R 16SuF 16SuR 16SwolF 16SwolR
TACTATGTTACGACTTAT AAACTAGGATTAGATACCC TGGTCCAATAAGTGATGAAGAAACTAGCTA AAAAATTAAACGCTACTCCAGCTTCTGCAC TACTGACTGTTGGAGTTGTAACTAACGCGT TGCCAGTTGCAAGAACAGAAACTCTAACTC GCTTAACACATGCAAG CCATTGTAGCACGTGT TTGTAGCCTGCTATGGTATAACT GAATAGGTATGATTTTCATGT
(Kambhampati and Smith, 1995) (Kambhampati and Smith, 1995) (Jeyaprakash and Hoy, 2000) (Jeyaprakash and Hoy, 2000) (Jeyaprakash and Hoy, 2000) (Jeyaprakash and Hoy, 2000) (O’Neill et al., 1992) (O’Neill et al., 1992) (O’Neill et al., 1992) (O’Neill et al., 1992)
were then mixed with S. scabiei DNA preps prior to reamplification with wsp primers. Sarcoptes scabiei samples were also tested for Wolbachia by nested PCR using both general eubacterial and Wolbachia specific 16SrRNA primers (O’Neill et al., 1992) (Table 2). PCR reactions contained 1 mL template DNA, 1!PCR buffer (Qiagen), 0.2 mM dNTP, 0.2 mM of eubacterial specific 16SrRNA primers and 1.25 U Taq polymerase (Qiagen). Reactions were initially denatured for 2 min, followed by 35 cycles each consisting of 94 8C for 30 s, 50 8C for 30 s and 72 8C for 1 min and 30 s. One microlitre of these reactions were used as templates for the second round of PCR, using 0.2 mM of Wolbachia-specific 16SrRNA primers. Reactions were cycled as above, with the annealing temperature reduced to 45 8C. Following amplification all products were visualized on 1% agarose gels stained with ethidium bromide and photographed under UV light. A database of 9216 expressed sequence tags (ESTs) from a S. scabiei cDNA library (Fischer et al., 2003a) and 26,592
ESTs from a normalised S. scabiei cDNA library (Fischer et al., 2003b) were screened by BLASTn (Altschul et al., 1990) with ftsZ (U37260), wsp (AF217719) and 16SrRNA (U37261) sequences. A 1:10 dilution of the normalised cDNA library was also included in all PCR assays as described above. All 24 S. scabiei samples and D. simulans controls produced strong PCR amplification products with the 12SrRNA primers, confirming the integrity of DNA samples. In sample SpD2, an additional amplification product was observed, presumed to be co-amplified deer DNA (Fig. 1A). All S. scabiei genomic samples (Fig. 1B, C, D) and cDNA libraries (data not shown) tested negative for Wolbachia by PCR using the ftsZ, wsp, and nested 16SrRNA primer sets, whereas the D. simulans control, known to be infected with Wolbachia, was positive for all genes. Furthermore long PCR with serially diluted Wolbachia DNA mixed with S. scabiei DNA could sufficiently detect as low as 1 fg of Wolbachia DNA (Fig. 2). Screening over 35,000 Wolbachia ESTs with ftsZ, wsp and 16SrRNA
Fig. 1. Mite DNA extracts were tested by PCR for (A) 12SrRNA and the Wolbachia (B) FtsZ, (C) wsp, and (D) 16SrRNA genes.
134
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135
Fig. 2. Serial dilutions of Wolbachia DNA were mixed with mite DNA extracts and amplified using the wsp primers.
sequences using BLASTn did not produce any significant matches (e!0.001). This study, involving a PCR survey of both individual scabies mites and S. scabiei cDNA libraries, and database searching an S. scabiei EST database of over 35,000 sequences derived from approximately 600 scabies mites failed to identify Wolbachia infection in S. scabiei. Previous studies have reported frequent false negatives in PCR, particularly when dealing with smaller organisms which may contain low titers of bacteria (Jeyaprakash and Hoy, 2000). As S. scabiei is less than 0.4 mm in size, long PCR and nested PCR approaches were utilized to increase sensitivity but were still unable to detect Wolbachia in any mite samples. However, as little as 1 fg of Wolbachia DNA could be detected when mixed with S. scabiei DNA template, attesting to the sensitivity of the assay. In addition, several multi-mite preparations (i.e. five mites or more) and the S. scabiei cDNA library tested PCR negative for all Wolbachia genes (data not shown). Multiple sequence alignments indicated that the PCR primer sequences used in this study were conservative enough to identify the major subgroups of Wolbachia currently recognized. In many arthropod species it is evident that not all populations are infected; and secondly not all individuals in a natural population may be infected due to imperfect transmission between females and their progeny (Turelli and Hoffmann, 1995). Therefore inadequate sampling of a given species or population may have been a limitation of previous surveys. We tested mites from 12 different populations of S. scabiei, derived from six host species and varied geographical origins. In addition, our S. scabiei var. hominis EST library surveyed was generated from several hundred mites from a single host species. Although the cDNA library was constructed using oligo-dT for the first strand cDNA synthesis to target poly adenylated mRNAs, many sequences have been observed in the database which are not derived from a poly adenylated mRNA species, such as 18S and 28S ribosomal RNA, mitochondrial ribosomal RNA, and histone mRNA. Similarly, if Wolbachia was present in the mites used to construct the library, it is likely that Wolbachia sequences
would be identified, particularly in the S. scabiei EST normalized dataset. Previous surveys have identified Wolbachia in 17–30% of mite species examined. At present there is a paucity of information regarding Wolbachia–host interactions and therefore it is difficult to speculate on factors that drive host selection. It is currently unknown whether ancestral S. scabiei were infected with Wolbachia and the symbiont lost through evolution, or if they diverged prior to Wolbachia acquisition. To further clarify Wolbachia evolution, more comprehensive surveys of the class Acari would be required. The apparent absence of Wolbachia infection in S. scabiei indicate Wolbachia is unlikely to be a factor in the genetic division observed between host-associated populations of S. scabiei or involved in the inflammatory pathogenesis of scabies. Furthermore antibiotic therapy is not likely to help reduce the prevalence of scabies in endemic communities, as is proposed for filariasis.
Acknowledgements We thank the Centre for Environmental Stress and Adaptation Research (Latrobe University, Victoria, Australia) for providing the positive control Drosophila strains and L. Arlian, D. Taplin, M. Fuller, L. Skerratt, J. Alonso and the Berrimah Research Farm (Department of Business, Industry and Resource Development, NT Government, Australia) for providing S. scabiei mites. We also thank the Cooperative Research Centre for Aboriginal Health for providing KEM with a postgraduate research scholarship. This work was supported by the Australian National Health and Medical Research Council grants 283301 and 290208.
References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Breeuwer, J.A.J., Jacobs, G., 1996. Wolbachia: intracellular manipulators of mite reproduction. Exp. Appl. Acarol. 20, 421–434. Charlat, S., Hurst, G.D., Mercot, H., 2003. Evolutionary consequences of Wolbachia infections. Trends Genet. 19, 217–223. Cross, H.F., Haarbrink, M., Egerton, G., Yazdanbakhsh, M., Taylor, M., 2001. Severe reactions to filarial chemotherapy and release of Wolbachia endosymbionts into the blood. Lancet 358, 1873–1875. Fialho, R., Stevens, L., 2000. Male-killing Wolbachia in a flour beetle. Proc. R. Soc. Lond., B, Biol. Sci. 267, 1469–1473. Fischer, K., Holt, D.C., Harumal, P., Currie, B.J., Walton, S.F., Kemp, D.J., 2003a. Generation and characterization of cDNA clones from Sarcoptes scabiei var. hominis for an expressed sequence tag library: identification of homologues of house dust mite allergens. Am. J. Trop. Med. Hyg. 68, 61–64. Fischer, K., Holt, D.C., Wilson, P., Davis, J., Hewitt, V., Johnson, M., McGrath, A., Currie, B.J., Walton, S.F., Kemp, D.J., 2003b. Normalization of a cDNA library cloned in lambda ZAP by a long PCR and cDNA reassociation procedure. BioTechniques 34, 250–252 see also p. 254.
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135 Gotoh, T., Noda, J., Hong, X., 2003. Wolbachia distribution and cytoplasmic incompatibility based on a survey of 42 spider mite species (Acari: Tetranychidae) in Japan. Heredity 91, 208–216. Hise, A., Gillette-Ferguson, I., Pearlman, E., 2004. The role of endosymbiotic Wolbachia bacteria in filarial disease. Cell Microbiol. 6, 97–104. Jeyaprakash, A., Hoy, M.A., 2000. Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol. Biol. 9, 393–405. Jeyaprakash, A., Hoy, M.A., 2004. Multiple displacement amplification in combination with high-fidelity PCR improves detection of bacteria from single females or eggs of Metaseiulus occidentalis (Nesbitt) (Acari: Phytoseiidae). J. Invertebr. Pathol. 86, 111–116. Kageyama, D., Hoshizaki, S., Ishikawa, Y., 1998. Female biased sex ratio in the Asian corn borer, Ostrinia furnacalis: evidence for the occurrence of feminizing bacteria in an insect. Heredity 1998, 81. Kambhampati, S., Smith, P., 1995. PCR primers for the amplification of four insect mitochondrial gene fragments. Insect Mol. Biol. 4, 233–236. O’Neill, S.L., Giordano, R., Colbert, A.M.E., Karr, T.L., 1992. 16SrRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. PNAS 89, 2699–2702.
135
Stouthamer, R., Breeuwer, J.A.J., Luck, R.F., Werren, J., 1993. Molecular identification of organisms associated with parthenogenesis. Nature 361, 66–68. Tagami, Y., Miura, K., 2004. Distribution and prevalence of Wolbachia in Japanese populations of Lepidoptera. Insect Mol. Biol. 13, 359–364. Taylor, M., Hoerauf, A., 2001. A new approach to the treatment of filariasis. Curr. Opin. Infect. Dis. 14, 727–731. Turelli, M., Hoffmann, A., 1995. Cytoplasmic incompatibility in Drosophila simulans: dynamics and parameter estimates from natural populations. Genetics 140, 1319–1338. Walton, S., Choy, J., Bonson, A., Valle, A., McBroom, J., Taplin, D., Arlian, L., Mathews, J., Currie, B., Kemp, D.J, 1999. Genetically distinct dog-derived and human-derived Sarcoptes scabiei in scabies-endemic communities in northern Australia. Am. J. Trop. Med. Hyg. 61, 542–547. Walton, S., Dougall, A., Pizzutto, S., Holt, D., Taplin, D., Arlian, L., Morgan, M., Currie, B., Kemp, D., 2004. Genetic epidemiology of Sarcoptes scabiei (Acari: Sarcoptidae) in northern Australia. Int. J. Parasitol. 34, 839–849. Yen, J.J., Barr, A.R., 1971. New hypothesis for the case of cytoplasmic incompatibility in Culex pipiens. Nature 232, 657–658. Zchori-Fein, E., Perlman, S.J., 2004. Distribution of the bacterial symbiont Cardinium in arthropods. Mol. Ecol. 13, 2009–2016.
Rapid communication
Analysis of Sarcoptes scabiei finds no evidence of infection with Wolbachia K.E. Mounseya,b, D.C. Holta,b, K. Fischerd, D.J. Kempd, B.J. Curriea,b,c, S.F. Waltona,b,* a
Menzies School of Health Research, Darwin, NT, Australia b Charles Darwin University, Darwin, NT, Australia c Northern Territory Clinical School, Flinders University, Darwin, NT, Australia d Queensland Institute of Medical Research, Brisbane, QLD, Australia Received 15 November 2004; received in revised form 22 November 2004; accepted 22 November 2004
Abstract The endosymbiont Wolbachia has been detected in a range of filarial nematodes and parasitic mites and is known to affect host reproductive compatibility and potentially evolutionary processes. PCR of Wolbachia surface protein (wsp), ftsZ and 16SrRNA genes from individual Sarcoptes scabiei mites obtained from a series of individual hosts, and database searches of an S. scabiei var. hominis EST library failed to detect Wolbachia genes. Therefore, Wolbachia appears not to be involved in the genetic subdivision observed between varieties of host-associated S. scabiei or, involved in the inflammatory disease pathogenesis of scabies unlike its activity in filarial infection. q 2004 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. Keywords: Wolbachia; Sarcoptes scabiei; PCR
a-Proteobacteria of the genus Wolbachia are widespread endosymbionts of filarial nematodes and arthropods. They are generally found in the reproductive tissues of their host and are transmitted from infected females to their progeny. Wolbachia are most notoriously known for manipulating host reproduction to increase the proportion of females in the population. Consequently, infection with Wolbachia can result in male killing, parthenogenesis and feminisation (Stouthamer et al., 1993; Kageyama et al., 1998; Fialho and Stevens, 2000). Further, cytoplasmic incompatibility may occur between individuals when infected males mate with uninfected females, or between hosts carrying different variants of Wolbachia (Yen and Barr, 1971). Wolbachia is therefore proposed to have long term consequences on the evolution of its host organisms (Charlat et al., 2003). There have been numerous PCR-based surveys reporting that Wolbachia is widespread in arthropods, with distribution reported to be as high as 76% of 63 species examined * Corresponding author. Address: Menzies School of Health Research, P.O. Box 41096, Casuarina, NT 0811, Australia. Tel.: C61 8 8922 8928; fax: C61 8 8927 5187. E-mail address: [email protected] (S.F. Walton).
(Jeyaprakash and Hoy, 2000). A recent survey of Lepidoptera in Japan reported a 45% infection rate of 49 species tested (Tagami and Miura, 2004). Wolbachia are also found in most filarial nematodes, where they may play important roles in nematode reproduction and development (Hise et al., 2004). Importantly in nematodes, antibiotics targeted at the bacteria eventually result in host death, and thus antibiotic therapy has been heralded as a novel treatment for filariasis (Taylor and Hoerauf, 2001). This approach may also help overcome the severe post-treatment inflammatory response observed in filariasis caused by the release of Wolbachia into the blood (Cross et al., 2001). Several studies have identified Wolbachia in Acari, with surveys focusing on spider (Tetranychidae) and predatory (Phytoseiidae) mites, with prevalence rates of Wolbachia ranging from 17 to 30% of mite species tested (Breeuwer and Jacobs, 1996; Gotoh et al., 2003; Zchori-Fein and Perlman, 2004). These studies have commonly found that not all individuals of Tetranychidae populations were infected with Wolbachia. However, these surveys may have underestimated the prevalence of infection due to a low level of Wolbachia compared to host DNA, resulting in false negatives. In contrast, a long PCR approach
0020-7519/$30.00 q 2004 Australian Society for Parasitology Inc. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.ijpara.2004.11.007
132
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135
consistently detected Wolbachia in mite samples (which previously failed to amplify with initial PCR) and was estimated to be seven times more sensitive than standard PCR (Jeyaprakash and Hoy, 2000, 2004). Scabies is a disease of public health significance caused by the ectoparasitic mite Sarcoptes scabiei (Acari: Sarcoptidae). Molecular studies have documented evidence of genetic division and limited interbreeding between varieties of host-associated mites (Walton et al., 1999, 2004). One hypothesis for such division is cytoplasmic incompatibility between scabies mites from different hosts carrying different variants of Wolbachia. Furthermore, the acute inflammatory response observed in scabies could partly be explained by the presence of Wolbachia. If Wolbachia were detected in S. scabiei there could be significant implications on population genetics, disease pathogenesis and treatment options for patients with scabies. In this study we examined different host derived populations of S. scabiei for the presence of Wolbachia using both PCR and database searches of a S. scabiei var. hominis EST library of over 35,000 sequences derived from approximately 600 mites. Sarcoptes scabiei used in this study were obtained from the Menzies School of Health Research collection, stored at K80 8C. Single mites had either been frozen without additive or frozen in digestion buffer (500 mg/mL proteinase K, 50 mM Tris–HCl, 1 mM EDTA, 0.5% SDS, pH 8.5). A total of 24 mites were tested, with two mites each obtained from 12 different hosts representing six species from a range of geographic locations (Table 1). Drosophila simulans strains known to be infected with Wolbachia were used as positive controls, obtained from the Centre for Environmental Stress and Adaptation Research (Latrobe University, Victoria, Australia). Frozen mites were homogensied in either 20 or 50 mL of PrepMan Ultra solution (Applied Biosystems, Foster City, CA, USA) using a motorised micropestle (Kontes). The samples were then boiled for 10 min and cooled on ice. Drosophila simulans DNA was prepared in the same way, except only the abdomen was used for DNA extraction, and the sample was homogenised in 50 mL of PrepMan Ultra solution. For mites stored in digestion buffer, 20 mL sterile distilled water was added and the samples incubated at room temperature for 2 h. PCR was performed on all samples to assess the suitability of DNA for further PCR amplification using universal insect 12SrRNA primers SRJ and SRN (Table 2). Reactions contained 1 mL of template DNA, 1!PCR Buffer (Qiagen, Clifton Hill, Victoria, Australia), 0.2 mM dNTPs, 0.125 mM of each primer and 1.25 U Taq polymerase (Qiagen) in a total reaction volume of 25 mL. Tween 20 was added to a final concentration of 2% to reactions, where the template DNA was prepared in digestion buffer. Samples were initially denatured for 2 min, followed by 35 cycles each consisting of 94 8C for 30 s, 40 8C for 30 s and 60 8C for 45 s.
Table 1 Sarcoptes scabiei mites tested for Wolbachia in this study Sample
Host species (common name)
Geographical origin
HS1-1
Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Homo sapiens (Human) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Canis familiaris (Dog) Macropus agilis (Agile wallaby) Macropus agilis (Agile wallaby) Sus domesticus (Domestic pig) Sus domesticus (Domestic pig) Vombatus ursinus (Wombat) Vombatus ursinus (Wombat) Cervus elaphus Cervus elaphus
Northern Territory, Australia
HS1-2 HS2-1 HS2-2 HS3-1 HS3-2 HS4-1 HS4-2 HS5-1 HS5-2 CF1-1 CF1-2 CF2-1 CF2-2 CF3-1 CF3-2 Wal-1 Wal-2 Pig-1 Pig-2 Wom-1 Wom-2 SpD1 SpD2
Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Panama Panama Panama Panama Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia USA USA Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Northern Territory, Australia Victoria, Australia Victoria, Australia Spain Spain
PCR to detect Wolbachia was performed on 12SrRNA PCR positive DNA samples. A long PCR technique was employed based on the FtsZ and wsp (Wolbachia Surface Protein) primers and method described by Jeyaprakash and Hoy (2000) (Table 2). Fifty microlitre reactions contained 1 mL template DNA, 1!PC2 buffer (50 mM Tris, pH 9.1, 16 mM ammonium sulfate, and 2.5 mM MgCl2), 0.35 mM dNTPs, 1.6 mM forward and reverse primers and 0.4 mL of a mixture of 5 U Taq to 1 U Pwo polymerase. Reactions were initially denatured for 2 min at 94 8C, then subjected to 10 cycles of 94 8C for 10 s, 65 8C for 30 s and 68 8C for 1 min, followed by 25 cycles of 94 8C for 10 s, 65 8C for 30 s and 68 8C for 1 min initially with an additional 20 s added to each subsequent cycle. To assess PCR sensitivity and test for inhibition, wsp DNA amplified from D. simulans was purified with MinElute purification columns (Qiagen) and serially diluted from 10 ng/mL to 1 fg/mL. These dilutions
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135
133
Table 2 PCR primers used in this study Name
Sequence (5 0 -3)
Reference
SRJ (insect 12S) SRN (insect 12S) Wsp-F Wsp-R FtsZ-F FtsZ-R 16SuF 16SuR 16SwolF 16SwolR
TACTATGTTACGACTTAT AAACTAGGATTAGATACCC TGGTCCAATAAGTGATGAAGAAACTAGCTA AAAAATTAAACGCTACTCCAGCTTCTGCAC TACTGACTGTTGGAGTTGTAACTAACGCGT TGCCAGTTGCAAGAACAGAAACTCTAACTC GCTTAACACATGCAAG CCATTGTAGCACGTGT TTGTAGCCTGCTATGGTATAACT GAATAGGTATGATTTTCATGT
(Kambhampati and Smith, 1995) (Kambhampati and Smith, 1995) (Jeyaprakash and Hoy, 2000) (Jeyaprakash and Hoy, 2000) (Jeyaprakash and Hoy, 2000) (Jeyaprakash and Hoy, 2000) (O’Neill et al., 1992) (O’Neill et al., 1992) (O’Neill et al., 1992) (O’Neill et al., 1992)
were then mixed with S. scabiei DNA preps prior to reamplification with wsp primers. Sarcoptes scabiei samples were also tested for Wolbachia by nested PCR using both general eubacterial and Wolbachia specific 16SrRNA primers (O’Neill et al., 1992) (Table 2). PCR reactions contained 1 mL template DNA, 1!PCR buffer (Qiagen), 0.2 mM dNTP, 0.2 mM of eubacterial specific 16SrRNA primers and 1.25 U Taq polymerase (Qiagen). Reactions were initially denatured for 2 min, followed by 35 cycles each consisting of 94 8C for 30 s, 50 8C for 30 s and 72 8C for 1 min and 30 s. One microlitre of these reactions were used as templates for the second round of PCR, using 0.2 mM of Wolbachia-specific 16SrRNA primers. Reactions were cycled as above, with the annealing temperature reduced to 45 8C. Following amplification all products were visualized on 1% agarose gels stained with ethidium bromide and photographed under UV light. A database of 9216 expressed sequence tags (ESTs) from a S. scabiei cDNA library (Fischer et al., 2003a) and 26,592
ESTs from a normalised S. scabiei cDNA library (Fischer et al., 2003b) were screened by BLASTn (Altschul et al., 1990) with ftsZ (U37260), wsp (AF217719) and 16SrRNA (U37261) sequences. A 1:10 dilution of the normalised cDNA library was also included in all PCR assays as described above. All 24 S. scabiei samples and D. simulans controls produced strong PCR amplification products with the 12SrRNA primers, confirming the integrity of DNA samples. In sample SpD2, an additional amplification product was observed, presumed to be co-amplified deer DNA (Fig. 1A). All S. scabiei genomic samples (Fig. 1B, C, D) and cDNA libraries (data not shown) tested negative for Wolbachia by PCR using the ftsZ, wsp, and nested 16SrRNA primer sets, whereas the D. simulans control, known to be infected with Wolbachia, was positive for all genes. Furthermore long PCR with serially diluted Wolbachia DNA mixed with S. scabiei DNA could sufficiently detect as low as 1 fg of Wolbachia DNA (Fig. 2). Screening over 35,000 Wolbachia ESTs with ftsZ, wsp and 16SrRNA
Fig. 1. Mite DNA extracts were tested by PCR for (A) 12SrRNA and the Wolbachia (B) FtsZ, (C) wsp, and (D) 16SrRNA genes.
134
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135
Fig. 2. Serial dilutions of Wolbachia DNA were mixed with mite DNA extracts and amplified using the wsp primers.
sequences using BLASTn did not produce any significant matches (e!0.001). This study, involving a PCR survey of both individual scabies mites and S. scabiei cDNA libraries, and database searching an S. scabiei EST database of over 35,000 sequences derived from approximately 600 scabies mites failed to identify Wolbachia infection in S. scabiei. Previous studies have reported frequent false negatives in PCR, particularly when dealing with smaller organisms which may contain low titers of bacteria (Jeyaprakash and Hoy, 2000). As S. scabiei is less than 0.4 mm in size, long PCR and nested PCR approaches were utilized to increase sensitivity but were still unable to detect Wolbachia in any mite samples. However, as little as 1 fg of Wolbachia DNA could be detected when mixed with S. scabiei DNA template, attesting to the sensitivity of the assay. In addition, several multi-mite preparations (i.e. five mites or more) and the S. scabiei cDNA library tested PCR negative for all Wolbachia genes (data not shown). Multiple sequence alignments indicated that the PCR primer sequences used in this study were conservative enough to identify the major subgroups of Wolbachia currently recognized. In many arthropod species it is evident that not all populations are infected; and secondly not all individuals in a natural population may be infected due to imperfect transmission between females and their progeny (Turelli and Hoffmann, 1995). Therefore inadequate sampling of a given species or population may have been a limitation of previous surveys. We tested mites from 12 different populations of S. scabiei, derived from six host species and varied geographical origins. In addition, our S. scabiei var. hominis EST library surveyed was generated from several hundred mites from a single host species. Although the cDNA library was constructed using oligo-dT for the first strand cDNA synthesis to target poly adenylated mRNAs, many sequences have been observed in the database which are not derived from a poly adenylated mRNA species, such as 18S and 28S ribosomal RNA, mitochondrial ribosomal RNA, and histone mRNA. Similarly, if Wolbachia was present in the mites used to construct the library, it is likely that Wolbachia sequences
would be identified, particularly in the S. scabiei EST normalized dataset. Previous surveys have identified Wolbachia in 17–30% of mite species examined. At present there is a paucity of information regarding Wolbachia–host interactions and therefore it is difficult to speculate on factors that drive host selection. It is currently unknown whether ancestral S. scabiei were infected with Wolbachia and the symbiont lost through evolution, or if they diverged prior to Wolbachia acquisition. To further clarify Wolbachia evolution, more comprehensive surveys of the class Acari would be required. The apparent absence of Wolbachia infection in S. scabiei indicate Wolbachia is unlikely to be a factor in the genetic division observed between host-associated populations of S. scabiei or involved in the inflammatory pathogenesis of scabies. Furthermore antibiotic therapy is not likely to help reduce the prevalence of scabies in endemic communities, as is proposed for filariasis.
Acknowledgements We thank the Centre for Environmental Stress and Adaptation Research (Latrobe University, Victoria, Australia) for providing the positive control Drosophila strains and L. Arlian, D. Taplin, M. Fuller, L. Skerratt, J. Alonso and the Berrimah Research Farm (Department of Business, Industry and Resource Development, NT Government, Australia) for providing S. scabiei mites. We also thank the Cooperative Research Centre for Aboriginal Health for providing KEM with a postgraduate research scholarship. This work was supported by the Australian National Health and Medical Research Council grants 283301 and 290208.
References Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Breeuwer, J.A.J., Jacobs, G., 1996. Wolbachia: intracellular manipulators of mite reproduction. Exp. Appl. Acarol. 20, 421–434. Charlat, S., Hurst, G.D., Mercot, H., 2003. Evolutionary consequences of Wolbachia infections. Trends Genet. 19, 217–223. Cross, H.F., Haarbrink, M., Egerton, G., Yazdanbakhsh, M., Taylor, M., 2001. Severe reactions to filarial chemotherapy and release of Wolbachia endosymbionts into the blood. Lancet 358, 1873–1875. Fialho, R., Stevens, L., 2000. Male-killing Wolbachia in a flour beetle. Proc. R. Soc. Lond., B, Biol. Sci. 267, 1469–1473. Fischer, K., Holt, D.C., Harumal, P., Currie, B.J., Walton, S.F., Kemp, D.J., 2003a. Generation and characterization of cDNA clones from Sarcoptes scabiei var. hominis for an expressed sequence tag library: identification of homologues of house dust mite allergens. Am. J. Trop. Med. Hyg. 68, 61–64. Fischer, K., Holt, D.C., Wilson, P., Davis, J., Hewitt, V., Johnson, M., McGrath, A., Currie, B.J., Walton, S.F., Kemp, D.J., 2003b. Normalization of a cDNA library cloned in lambda ZAP by a long PCR and cDNA reassociation procedure. BioTechniques 34, 250–252 see also p. 254.
K.E. Mounsey et al. / International Journal for Parasitology 35 (2005) 131–135 Gotoh, T., Noda, J., Hong, X., 2003. Wolbachia distribution and cytoplasmic incompatibility based on a survey of 42 spider mite species (Acari: Tetranychidae) in Japan. Heredity 91, 208–216. Hise, A., Gillette-Ferguson, I., Pearlman, E., 2004. The role of endosymbiotic Wolbachia bacteria in filarial disease. Cell Microbiol. 6, 97–104. Jeyaprakash, A., Hoy, M.A., 2000. Long PCR improves Wolbachia DNA amplification: wsp sequences found in 76% of sixty-three arthropod species. Insect Mol. Biol. 9, 393–405. Jeyaprakash, A., Hoy, M.A., 2004. Multiple displacement amplification in combination with high-fidelity PCR improves detection of bacteria from single females or eggs of Metaseiulus occidentalis (Nesbitt) (Acari: Phytoseiidae). J. Invertebr. Pathol. 86, 111–116. Kageyama, D., Hoshizaki, S., Ishikawa, Y., 1998. Female biased sex ratio in the Asian corn borer, Ostrinia furnacalis: evidence for the occurrence of feminizing bacteria in an insect. Heredity 1998, 81. Kambhampati, S., Smith, P., 1995. PCR primers for the amplification of four insect mitochondrial gene fragments. Insect Mol. Biol. 4, 233–236. O’Neill, S.L., Giordano, R., Colbert, A.M.E., Karr, T.L., 1992. 16SrRNA phylogenetic analysis of the bacterial endosymbionts associated with cytoplasmic incompatibility in insects. PNAS 89, 2699–2702.
135
Stouthamer, R., Breeuwer, J.A.J., Luck, R.F., Werren, J., 1993. Molecular identification of organisms associated with parthenogenesis. Nature 361, 66–68. Tagami, Y., Miura, K., 2004. Distribution and prevalence of Wolbachia in Japanese populations of Lepidoptera. Insect Mol. Biol. 13, 359–364. Taylor, M., Hoerauf, A., 2001. A new approach to the treatment of filariasis. Curr. Opin. Infect. Dis. 14, 727–731. Turelli, M., Hoffmann, A., 1995. Cytoplasmic incompatibility in Drosophila simulans: dynamics and parameter estimates from natural populations. Genetics 140, 1319–1338. Walton, S., Choy, J., Bonson, A., Valle, A., McBroom, J., Taplin, D., Arlian, L., Mathews, J., Currie, B., Kemp, D.J, 1999. Genetically distinct dog-derived and human-derived Sarcoptes scabiei in scabies-endemic communities in northern Australia. Am. J. Trop. Med. Hyg. 61, 542–547. Walton, S., Dougall, A., Pizzutto, S., Holt, D., Taplin, D., Arlian, L., Morgan, M., Currie, B., Kemp, D., 2004. Genetic epidemiology of Sarcoptes scabiei (Acari: Sarcoptidae) in northern Australia. Int. J. Parasitol. 34, 839–849. Yen, J.J., Barr, A.R., 1971. New hypothesis for the case of cytoplasmic incompatibility in Culex pipiens. Nature 232, 657–658. Zchori-Fein, E., Perlman, S.J., 2004. Distribution of the bacterial symbiont Cardinium in arthropods. Mol. Ecol. 13, 2009–2016.