- Email: [email protected]
Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death
Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death Kyung-Ah Park a, 1, Nuri Yun b, 1, Young J. Oh a, * a b
Department of Systems Biology, Yonsei University College of Life Science and Biotechnology, Seoul, 03722, Republic of Korea Institute of Life Science & Biotechnology, Yonsei University, Seoul, 03722, Republic of Korea
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 September 2019 Accepted 21 September 2019 Available online xxx
Neurodegenerative diseases are associated with elevated levels of metal elements, which are well-known inducers of reactive oxygen species (ROS) in cells. Because dopaminergic neurons in the substantia nigra are vulnerable to ROS, dysregulation of metals and the resulting accumulation of ROS could be a cause of dopaminergic neurodegeneration. In this study, we showed that overexpression of anamorsin protected MN9D dopaminergic neuronal cells from cupric chloride-induced death. This cytoprotection was achieved by specifically decreasing ROS levels. As determined by mini two-dimensional electrophoretic assay, an acidic shift of anamorsin occurred during drug-induced death, which seemed to be mediated by oxidative modification of three of its CXXC motifs. Consequently, drug-induced dissociation of ASK1 from Trx1 and subsequent phosphorylation of JNK and p38 MAPK were inhibited in MN9D cells overexpressing anamorsin. Taken together, our results indicate that anamorsin exerts a neuroprotective effect by reducing intracellular ROS levels and subsequently attenuating activated stress-activated MAP kinases pathways. © 2019 Elsevier Inc. All rights reserved.
Keywords: Anamorsin Cupric chloride Reactive oxygen species Mitogen-activated protein kinase
1. Introduction Neurodegenerative diseases involve a progressive loss of specific neuronal cell populations and are associated with a surge of reactive oxygen species (ROS), mitochondrial dysfunction, and accumulation of protein aggregates [1,2]. Oxidative stress is the result of dysregulated production and clearance of ROS [3]. Intracellular ROS are associated with disruptions in redox circuitry and macromolecular damage, and can therefore cause neuronal death. ROS are produced through different pathways, including direct interaction between oxygen species and redox-active metals, which typically accumulate during brain aging [4,5]. Through reactions between metals and oxygen, hydrogen peroxide and superoxide anion are generated, leading to the production of hydroxyl radicals, which are involved in neurodegeneration [3]. Cysteine residues of catalytic proteins are oxidatively modified by disulfide formation, glutathionylation, and S-nitrosylation [6,7]. For
* Corresponding author. Department of Systems Biology, Yonsei University College of Life Science and Biotechnology, Yonsei-ro 50, Seodaemun-gu, Seoul, 03722, Republic of Korea. E-mail address: [email protected] (Y.J. Oh). 1 These authors made equal contributions to this work.
example, hydrogen peroxide is well known for its role in oxidizing thiol groups of cysteine residues. The reaction of cysteinyl thiolates with hydrogen peroxide can lead to the formation of sulfenic acid, sulfinic acid, and sulfonic acid in addition to disulfide bond formation and glutathione conjugation [8,9]. These cysteine oxidations can change the activities of cellular proteins, which can alter their physiological roles [10]. Certain proteins exert pro-survival functions upon oxidation of their cysteine residues [11e13]. Some such proteins contain CXXC motifs, in which two cysteines are separated by two other amino acids, which are well-known cysteine redox motifs [7,14,15]. CXXC motifs are necessary for metal binding, DNA binding, and iron-sulfur cluster biogenesis [16,17]. Anamorsin, first identified as an anti-apoptotic protein, is indispensable for definitive hematopoiesis [18]. Although anamorsin does not show sequence homology with other cell deathregulating proteins, previous studies demonstrate that Dre2, a yeast homolog of anamorsin, encodes a conserved Fe/S cluster protein and controls mitochondrial integrity and cell death [19,20]. Yang et al. suggest that anamorsin controls proliferation, migration, and apoptosis of vascular smooth muscle cells by regulating Bcl-2 and Bax [21]. Also, its depletion inhibits proliferation of chronic myeloid leukemia cells and triggers apoptosis [22]. Using in situ
https://doi.org/10.1016/j.bbrc.2019.09.089 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
2
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
hybridization and immunoblot analyses, we revealed that anamorsin is distributed across the brain [23]. RNA interferencemediated knockdown of anamorsin renders neuronal cells more vulnerable to apoptosis, whereas reintroduction of anamorsin makes neuronal cells resistant to drug-induced death [24]. In support of our findings, anamorsin was shown to inhibit ischemiainduced damage through regulation of MAPK and apoptotic signaling pathways [25]. The specific aim of this study was to explore the mechanism governing the neuroprotective role of anamorsin using an ROSinduced neuronal cell death paradigm. We hypothesized that the anti-apoptotic role of anamorsin can be mediated by its CXXC motifs that are oxidized via the capture of ROS after exposure to cupric chloride. We also hypothesized that outcomes of this event are linked to attenuation of drug- and stress-induced MAPK signaling. 2. Materials and methods 2.1. Cell culture MN9D dopaminergic neuronal cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Sigma, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY, USA) [26]. Cells were seeded at a density of 1 106 cells in P-100 dishes or 2 105 cells in 6-well plates. One day after plating, transfection was performed using Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA). Twenty-four hour after transfection, cells were used for experiments. The medium was changed to serum-free N2 medium and treated with 250 mM cupric chloride (Sigma) for the indicated durations [26e28]. 2.2. Plasmid and transfection pcDNA3 containing mouse anamorsin cDNA was gifted from Dr. Hirohiko Shibayama at Osaka University. FLAG-tagged mouse anamorsin was amplified by polymerase chain reaction with the primers 50 CTCTCGAGATGGACTATAAGGACGATGATGACAAGATGGAGGAGTTTGGG-30 and 50 -GCAATCTCCAGGATGCCTAGTCTAGAGG-30 and subcloned into the pCI-neo vector (Promega, Madison, WI, USA). pCI-neo vector encoding CXXC triple-mutant anamorsin was generated using a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) with the following primer sets: 50 - GAGGAAGGCCAGTAAGAACAGC ACCAGTGGCCTCGCAGAG-30 and 50 -CTCTGCGAGGCCACTGGTGCTGT TCTTACTGGCCTTCCTC-3’ (C244/247/249S), 50 - CCCAAGTCAGCCAGTGGAAATAGCTACCTGGGTGAC-30 and 50 - GTCACCCAGGTAGCTATTTCCACTGGCTGACTTGGG-3’ (C271/274S), and 50 - GACGC TTTCCGCAGTGCCAACAGCCCCTACCTCGGG-30 and 50 - CCCGAGGTAGGGGCTGTTGGCACTGCGGAAAGCGTC-3’ (C282/285S). All constructs were confirmed by DNA sequencing. 2.3. Viability assay The rate of cell survival was determined by colorimetric measurement using 3-[4,5-dimethylthiazol-2-yl]-2,5diphenyltetrazolium bromide (MTT) reduction assay [29]. Values are expressed as a percentage of untreated control cells (100%). To assess apoptotic features, cells were subjected to fluorescenceactivated cell sorting (FACS) analysis for Annexin V binding and propidium iodide (PI) uptake using a FITC Annexin V Apoptosis Detection Kit 1 (BD Biosciences, Mountain View, CA, USA) and then analyzed with FACS Calibur (BD Biosciences). Calculations were performed with the CellQuest program (BD Biosciences).
2.4. Measurement of calcium (Ca2þ) and mitochondria permeability: After drug treatment, cytosolic Ca2þ was measured with 3 mM Fluo-3 mixed with pluronic acid for 30 min at 37 C. Mitochondrial permeability was measured by incubation with 250 mM Mitotracker for 20 min at 37 C. After incubation, cells were then washed with DMEM. All reagents were purchased from Thermo Fisher Scientific. Fluorescent images were taken under an Axiovert 100 microscope (Carl Zeiss, Zena, Germany). 2.5. ROS measurement Levels of intracellular ROS were determined with 20 -70 dichlorofluorscein diacetate (DCF-DA). After drug treatment, cells were stained with 3 mM DCF-DA for 20 min at 37 C followed by washes with chilled phosphate-buffered saline (PBS). Cells were analyzed with FACS Calibur followed by calculation with the CellQuest program. Fluorescent images were taken under an Axiovert 100 microscope. 2.6. Mini two-dimensional electrophoresis (2DE) Unless otherwise stated, all chemicals used for mini-2DE were purchased from Sigma. Mini-2DE experiments were performed as previously described [30]. After drug treatment, cells were solubilized in sample buffer containing 7 M urea/2 M thiourea/4% CHAPS/ 40 mM Tris-HCl/100 mM dithiothreitol/2 mM tributyl phosphine/ 2 mM phenylmethylsulfonyl fluoride/100 mg/ml leupeptin/150 units/ml endonuclease/1% IPG buffer. Whole-cell lysates (50 mg) were processed using a 7-cm Immobiline DryStrip (pH 3-10NL; GE Healthcare Life Sciences, Marlborough, MA, USA) for isoelectric focusing. After the equilibration step, SDS-PAGE was performed on a 12.5% gel in a Mini-Protean 3 Electrophoresis Cell (Bio-Rad, Hercules, CA, USA). Gels were subjected to immunoblot analysis. 2.7. Redox Western blot After drug treatment, cells were washed with 5 mM N-ethylmaleimide (NEM) in chilled PBS (Lonza, Basel, Switzerland), and cell lysates were prepared with 50 mM NEM in RIPA buffer containing 50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 0.1% SDS, and complete protease inhibitor cocktail (Roche, Mannheim, Germany). For sample nonreducing conditions, protein (30 mg) was prepared with 3 nonreducing sample buffer. For sample-reducing conditions, protein was prepared with 5 sample buffer containing 500 mM DTT, separated by 11.5% SDS-PAGE, and subjected to immunoblot analyses using Flag-horseradish peroxidase (HRP)-conjugated antibodies. 2.8. Immunoblot analysis After drug treatment, cells were lysed on ice in RIPA buffer and homogenized using a 1-ml syringe with a 26-gauge needle. Cell lysates were centrifuged at 15,000g for 15 min at 4 C. Supernatant proteins were quantified using Bradford protein assay reagent (Bio-Rad), separated on SDS-PAGE gels, and blotted onto PVDF membranes (Pall Corp., Ann Arbor, MI, USA). Membranes were probed with the following primary antibodies: rat anti-anamorsin (1:20,000; gifted by Hirohiko Shibayama), HRP-conjugated antiHA antibody (1:2500; Sigma), mouse anti-glyceraldehyde 3phosphate dehydrogenase (GAPDH; 1:5000; Chemicon, Dundee, UK), rabbit anti-JNK1 (1:1000), rabbit anti-p-JNK1 (1:1000), rabbit anti-p38 (1:1000), or rabbit anti-p-p38 antibody (1:1000; all from
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Cell Signaling Technology, Boston, MA). After washes with Trisbuffered saline containing 0.1% Tween-20, cells were incubated with goat anti-rabbit HRP-conjugated antibody (1:4000), goat antimouse HRP-conjugated antibody (1:4000), or goat anti-rat HRPconjugated antibody (1:5000; all from Santa Cruz Biotechnology, Santa Cruz, CA). Specific bands were detected using enhanced chemiluminescence (Amersham Pharmacia Biotech, Piscataway, NJ, USA). 3. Results and discussion 3.1. Anamorsin attenuates copper-induced MN9D cell death Previous studies show that anamorsin has an anti-apoptotic function in non-neuronal cells [18,21,24,31]. We showed that expression of anamorsin is relatively high in the brain [23], raising the possibility of its anti-cell death role in the nervous system [24]. Based on these studies, we evaluated its neuroprotective role in cupric chloride-induced neuronal death. Immunoblot analyses demonstrated that MN9D cells transfected with vector containing FLAG-tagged anamorsin cDNA overexpressed anamorsin (Fig. 1A). MTT reduction assays showed that cell viability was higher in MN9D cells overexpressing anamorsin after treatment with cupric chloride for 24 h (Fig. 1B). To further confirm these results, MN9D cells were subjected to fluorogenic cell death assays using an Annexin V/PI staining kit followed by FACS analysis after drug treatment. The amount of Annexin V-positive cells was reduced by approximately 10% (29.27% vs. 20.59%; Fig. 1C). The amount of PIpositive cells was also reduced in anamorsin-overexpressing MN9D cells (20.37% vs. 15.47%; Fig. 1D). Taken together, these results indicate that anamorsin attenuated cupric chloride-induced neuronal death. 3.2. Anamorsin attenuates cupric chloride-induced ROS production To identify initial cell death triggers that are blocked by anamorsin, we measured cytosolic Ca2þ levels, mitochondria permeability, and ROS levels using three fluorescent dyes: Fluo-3, Mitotracker red, and DCF-DA, respectively. We found that levels of cytosolic Ca2þ were dramatically increased in blank vectortransfected MN9D cells after treatment with cupric chloride (Fig. 2A, upper panels). Cupric chloride-induced surge of cytosolic Ca2þ was not altered in anamorsin-overexpressing MN9D cells. We then compared the intensity of Mitotracker red fluorescent signals in two groups after cupric chloride treatment. Cupric chlorideinduced loss of mitochondrial permeability and a resulting decrease in red fluorescence was detected in both groups (Fig. 2A, middle panels), indicating that cytosolic Ca2þ levels and mitochondria permeability were not affected by anamorsin. To measure changes in intracellular ROS levels, MN9D cells were loaded with DCF-DA dyes after cupric chloride treatment. Compared with DCFDA-positive signal in blank vector-transfected MN9D cells, green fluorescence signals in anamorsin-overexpressing MN9D cells were significantly attenuated (Fig. 2A, bottom panels). To further clarify whether the drug-induced surge in intracellular ROS levels was attenuated in anamorsin-overexpressing cells, cells were transfected with red fluorescent protein (RFP)-tagged anamorsin were treated with cupric chloride and loaded with DCF-DA. Using FACS analyses, cells positive for RFP and DCF-DA signals were counted to calculate the number of DCF-DA-positive cells among RFP-positive cells in both groups. Compared with RFP vector-expressing MN9D cells, RFP-tagged anamorsin-overexpressing MN9D cells showed a dramatically reduced number of DCF-DA-positive cells after drug treatment (51.30% vs. 16.14%; Fig. 2B). Double immunofluorescence experiments demonstrated that the number of RFP and DCF-DA
double-positive yellow spots was significantly reduced anamorsin-overexpressing cells (Supplementary Fig. 1).
3
in
3.3. CXXC motifs of anamorsin are oxidized after treatment with cupric chloride As various proteins protect cell death by being oxidized [11e13], we tested whether ROS-mediated modification of anamorsin occurs during cupric chloride-induced cell death. To examine oxidative modification of anamorsin, we performed mini-2DE analyses using MN9D cells treated with or without cupric chloride. The mini-2DE technique can separate proteins by their own isoelectric point (pI). If the protein is oxidized, the protein spot will shift to the more acidic side than the original spot. In untreated control cells, two anamorsin spots were detected. The main spot was larger and more basic (black arrow #1) than the second spot (black arrow #2). The main spot was detected at the theoretical pI value of anamorsin. However, in cupric chloride-treated cells, the intensity of the second spot was higher (red arrow #2), and one additional spot was detected at a more acidic position (red arrow #3; Fig. 3B, right panels). However, the total amount of anamorsin in each sample was the same (Fig. 3B, left panel), indicating that cupric chloride specifically induced an acidic shift of anamorsin. To examine whether this acidic shift of anamorsin reflects its redox status after drug treatment, cell lysates were subject to immunoblot analyses in non-reducing or reducing conditions (Fig. 3C) as previously described [32]. In non-reduced samples, relatively faint upper size bands were detected in anamorsinoverexpressing cells after drug treatment (Fig. 3C, left panel, lane 4), whereas these bands were not detected in untreated control samples (Fig. 3C, left panel, lane 2). These upper size bands disappeared under reducing conditions (Fig. 3C, right panel). These results indicate that oxidative modification of anamorsin occurred during cupric chloride-induced neuronal death. Anamorsin has three conserved CXXC motifs (Fig. 3A). To determine the relationship between these CXXC motifs and the acidic shift of anamorsin, a triple CXXC mutant was constructed in which cysteine residues were mutated to serine. With this mutant, the same experiment was performed to determine whether the CXXC motifs are responsible for oxidative modification of anamorsin after treatment with cupric chloride (Fig. 3D). As expected, even under non-reducing conditions, triple CXXC mutant anamorsin did not show the upper size bands that were detected in wild-type anamorsin in non-reducing conditions (red arrows). These results show that cupric chloride-induced oxidative modification of anamorsin was mediated by cysteine residues in the CXXC motif. 3.4. Anamorsin attenuates cupric chloride-induced activation of JNK and p38 through interaction with thioredoxin 1 Thioredoxin is a small thiol disulfide oxidoreductase first identified in E. coli and is involved in a wide range of cellular redox processes [33]. Mammalian thioredoxin has two well-known isoforms: Trx1 and Trx2. Thioredoxin was identified as an ASK1 binding protein that negatively regulates ASK1 kinase activity [34]. ROS can dissociate ASK1 from thioredoxin, and liberated ASK1 becomes activated and in turn activates the downstream MAP kinase, leading to cell death [35e38]. Therefore, we tested whether the JNK1/p38 axis is activated during cupric chloride-induced cell death. Co-immunoprecipitation assay showed the dissociation of ASK1 from thioredoxin in cupric chloride-treated cells (Fig. 4A, right panel, lane 3 vs. lane 4). Under these conditions, phosphorylated forms of JNK and p38 increased in the cupric chloride-treated lane (Fig. 4B). We then tested whether anamorsin can attenuate
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
4
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. Anamorsin attenuates cupric chloride-induced cell death. (AeD) MN9D cells were transfected with pCI vector containing FLAG-tagged anamorsin (AM) cDNA sequences. (B) MTT assay and (C, D) FACS analysis of Annexin V/PI uptake was performed after 250 mM cupric chloride treatment. (B) MTT assay was performed upon exposure to cupric chloride for the indicated time periods. Cell viability was assessed by the percentage of viable cells in drug-treated groups over that in untreated control groups (100%). Data are expressed as the mean ± standard deviation for three independent experiments performed in triplicate. Student’s t-tests were used to determine significant differences between group. *p < 0.05; n.s., not significant. Values from FACS analysis of (C) Annexin V- or (D) PI-positive cells are expressed as a percentage of the total number of counted cells.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. Anamorsin attenuates the cupric chloride-induced increase in ROS. (A) MN9D cells transfected with a vector containing anamorsin cDNA sequences were treated with 250 mM cupric chloride for 18 h. Cells were then loaded with Fluo-3, Mitotracker red, and DCF-DA to measure cytosolic Ca2þ, mitochondrial permeability, and ROS, respectively. Representative fluorescence microscopy and phase-contrast microscopy images are provided. Scale bar, 100 mm. (B) Cells were transfected with vector containing RFP-tagged anamorsin cDNA sequences. Cells were then treated with 250 mM cupric chloride and subjected to FACS analysis. DCF-DA-positive cells among RFP-tagged anamorsin-expressing cells were counted.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
6
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 3. Cupric chloride-induced oxidative modification of anamorsin is attenuated in anamorsin-overexpressing cells. (A) CXXC motif alignment of human, mouse, and yeast anamorsin. (B) MN9D cells were treated with 250 mM cupric chloride for 10 h and subjected to immunoblot (left panel) and mini-2DE (two right panels) analyses. In mini-2DE, spot #1 had an estimated pI value of 5.11. Two acidic shift spots of anamorsin are indicated by #2 and #3. (C, D) MN9D cells transfected with vector containing FLAG-tagged anamorsin cDNA sequences (wild-type, W) or triple CXXC mutant (3 M) were treated with 250 mM cupric chloride for 10 h. Cell lysates were separated under non-reducing or reducing conditions and subjected to immunoblot analyses using anti-FLAG-HRP antibody. Anti-GAPDH antibody was used as a loading control. Asterisks refer to non-specific bands.
drug-induced phosphorylation of JNK and p38. In anamorsinoverexpressing cells, decreased levels of the phosphorylated forms of JNK1 and p38 appeared upon exposure to cupric chloride (Fig. 4C), indicating that anamorsin regulates the ASK-MAP kinase pathway. In a separate experiment, we found that anamorsin translocated into the nucleus after drug treatment (Supplementary Fig. 2). Interestingly, Trx1 also translocated into the nucleus upon exposure to cupric chloride (Supplementary Fig. 3). Binding between anamorsin and Trx1 was detected in both the cytosol and nucleus. Thioredoxin has two cysteine residues that can be oxidized from the reduced form Trx-(SH)2 to the oxidized form Trx-S2 by
ROS. Because only the reduced form Trx-(SH)2 binds to ASK1, the activity of ASK1 and its downstream MAP kinases depends on cellular ROS. In the present study, anamorsin overexpression attenuated the drug-induced increase in intracellular ROS. Consequently, anamorsin regulated thioredoxin oxidation and subsequently attenuated activation of JNK/p38. Although we did not examine the role of nuclearly translocated anamorsin and thioredoxin, our results demonstrate a novel anti-cell death mechanism in which anamorsin negatively regulates the ASK1-MAPK pathway by interacting with thioredoxin. The name “anamorsin” in Latin means anti-apoptotic molecule
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.089. References
Fig. 4. Anamorsin negatively regulates JNK and P38 phosphorylation. (A) MN9D cells transfected with vector containing HA-tagged ASK1 cDNA sequences were treated with 250 mM cupric chloride for 10 h. Cell lysates were subjected to immunoprecipitation using anti-thioredoxin antibody followed by immunoblot analyses using antiHA antibody. (B) MN9D cells or (C) MN9D cells transfected with vector containing FLAG-tagged anamorsin cDNA sequences were treated with 250 mM cupric chloride for 10 h. Cell lysates were subjected to immunoblot analyses using the indicated antibodies.
[18]. However, its underlying molecular pathways are not understood. Here, we show that the oxidative modification of CXXC motifs comprises a critical step in the inhibition of neurodegeneration. This event is ROS-specific, as anamorsin did not affect dysregulation of mitochondria permeability or the surge of cytosolic Ca2þ. Accumulating evidence supports the notion that higher levels of ROS play a critical role in causing dopaminergic neurodegeneration in the substantia nigra. Oxidative modification of several disease-related proteins is responsible for dopaminergic neurodegeneration. Notably, oxidized a-synuclein exhibits a greater tendency to be misfolded and appears to be associated with neurodegeneration [39]. Dopamine directly binds to oxidatively modified parkin and inactivates its E3 ligase activity [40]. Oxidative modification downregulates functions of DJ-1 and ubiquitin carboxyl-terminal hydrolase L1 [41,42]. Taken together, these studies demonstrate a direct link between oxidative damage to these proteins and the pathogenesis of Parkinson’s disease. Our study extends these findings by reporting a novel mechanism by which oxidative modification of anamorsin attenuates MAPKmediated neurodegeneration, potentially via interacting with the redox protein thioredoxin. Acknowledgments This research was supported by the Small Grant for Exploratory Research Program (No.2018R1D1A1A02085731 to NY) through the National Research Foundation of Korea (NRF) grant funded by Ministry of Education and by the Brain Research Program (2017M37A1025369 to YJO) through the NRF grant funded by Ministry of Science and ICT.
[1] B.M. Morrison, P.R. Hof, J.H. Morrison, Determinants of neuronal vulnerability in neurodegenerative diseases, Ann. Neurol. 44 (1998) S32eS44. [2] C.A. Ross, M.A. Poirier, Protein aggregation and neurodegenerative disease, Nat. Med. 10 (Suppl) (2004) S10eS17. [3] K.J. Barnham, C.L. Masters, A.I. Bush, Neurodegenerative diseases and oxidative stress, Nat. Rev. Drug Discov. 3 (2004) 205e214. [4] W.H. Koppenol, The Haber-Weiss cycle–70 years later, Redox Rep. 6 (2001) 229e234. [5] M.A. Greenough, J. Camakaris, A.I. Bush, Metal dyshomeostasis and oxidative stress in Alzheimer’s disease, Neurochem. Int. 62 (2013) 540e555. [6] P. Ghezzi, Oxidoreduction of protein thiols in redox regulation, Biochem. Soc. Trans. 33 (2005) 1378e1381. [7] D.E. Fomenko, V.N. Gladyshev, Identity and functions of CxxC-derived motifs, Biochemistry 42 (2003) 11214e11225. [8] C. Jacob, A.L. Holme, F.H. Fry, The sulfinic acid switch in proteins, Org. Biomol. Chem. 2 (2004) 1953e1956. [9] L.B. Poole, P.A. Karplus, A. Claiborne, Protein sulfenic acids in redox signaling, Annu. Rev. Pharmacol. Toxicol. 44 (2004) 325e347. [10] S. Biswas, A.S. Chida, I. Rahman, Redox modifications of protein-thiols: emerging roles in cell signaling, Biochem. Pharmacol. 71 (2006) 551e564. [11] J. Wang, C.S. Sevier, formation and reversibility of BiP protein cysteine oxidation facilitate cell survival during and post oxidative stress, J. Biol. Chem. 291 (2016) 7541e7557. [12] M.A. Wilson, The role of cysteine oxidation in DJ-1 function and dysfunction, Antioxidants Redox Signal. 15 (2011) 111e122. [13] B. Carroll, E.G. Otten, D. Manni, R. Stefanatos, F.M. Menzies, G.R. Smith, D. Jurk, N. Kenneth, S. Wilkinson, J.F. Passos, J. Attems, E.A. Veal, E. Teyssou, D. Seilhean, S. Millecamps, E.L. Eskelinen, A.K. Bronowska, D.C. Rubinsztein, A. Sanz, V.I. Korolchuk, Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis, Nat. Commun. 9 (2018) 256. [14] A. Holmgren, Antioxidant function of thioredoxin and glutaredoxin systems, Antioxidants Redox Signal. 2 (2000) 811e820. [15] J.L. Martin, Thioredoxin–a fold for all reasons, Structure 3 (1995) 245e250. [16] S. Ollagnier-de-Choudens, T. Mattioli, Y. Takahashi, M. Fontecave, Iron-sulfur cluster assembly: characterization of IscA and evidence for a specific and functional complex with ferredoxin, J. Biol. Chem. 276 (2001) 22604e22607. [17] C. Krebs, J.N. Agar, A.D. Smith, J. Frazzon, D.R. Dean, B.H. Huynh, M.K. Johnson, IscA, an alternate scaffold for Fe-S cluster biosynthesis, Biochemistry 40 (2001) 14069e14080. [18] H. Shibayama, E. Takai, I. Matsumura, M. Kouno, E. Morii, Y. Kitamura, J. Takeda, Y. Kanakura, Identification of a cytokine-induced antiapoptotic molecule anamorsin essential for definitive hematopoiesis, J. Exp. Med. 199 (2004) 581e592. [19] Y. Zhang, E.R. Lyver, E. Nakamaru-Ogiso, H. Yoon, B. Amutha, D.W. Lee, E. Bi, T. Ohnishi, F. Daldal, D. Pain, A. Dancis, Dre2, a conserved eukaryotic Fe/S cluster protein, functions in cytosolic Fe/S protein biogenesis, Mol. Cell. Biol. 28 (2008) 5569e5582. [20] L. Vernis, C. Facca, E. Delagoutte, N. Soler, R. Chanet, B. Guiard, G. Faye, G. Baldacci, A newly identified essential complex, Dre2-Tah18, controls mitochondria integrity and cell death after oxidative stress in yeast, PLoS One 4 (2009) e4376. [21] Z. Yang, W.E. Wang, Q. Zhang, CIAPIN1 siRNA inhibits proliferation, migration and promotes apoptosis of VSMCs by regulating Bcl-2 and Bax, Curr. Neurovascular Res. 10 (2013) 4e10. [22] J. Wang, Q. Li, C. Wang, Q. Xiong, Y. Lin, Q. Sun, H. Jin, F. Yang, X. Ren, T. Pang, Knock-down of CIAPIN1 sensitizes K562 chronic myeloid leukemia cells to Imatinib by regulation of cell cycle and apoptosis-associated members via NFkappaB and ERK5 signaling pathway, Biochem. Pharmacol. 99 (2016) 132e145. [23] K.A. Park, N. Yun, D.I. Shin, S.Y. Choi, H. Kim, W.K. Kim, Y. Kanakura, H. Shibayama, Y.J. Oh, Nuclear translocation of anamorsin during druginduced dopaminergic neurodegeneration in culture and in rat brain, J. Neural Transm. 118 (2011) 433e444. [24] N. Yun, Y.M. Lee, C. Kim, H. Shibayama, A. Tanimura, Y. Hamanaka, Y. Kanakura, I.S. Park, A. Jo, J.H. Shin, C. Ju, W.K. Kim, Y.J. Oh, Anamorsin, a novel caspase-3 substrate in neurodegeneration, J. Biol. Chem. 289 (2014) 22183e22195. [25] H.J. Yeo, M.J. Shin, E.J. Yeo, Y.J. Choi, D.W. Kim, D.S. Kim, W.S. Eum, S.Y. Choi, Tat-CIAPIN1 inhibits hippocampal neuronal cell damage through the MAPK and apoptotic signaling pathways, Free Radic. Biol. Med. 135 (2019) 68e78. [26] H.K. Choi, L.A. Won, P.J. Kontur, D.N. Hammond, A.P. Fox, B.H. Wainer, P.C. Hoffmann, A. Heller, Immortalization of embryonic mesencephalic dopaminergic neurons by somatic cell fusion, Brain Res. 552 (1991) 67e76. [27] J. Lim, H.W. Kim, M.B. Youdim, I.J. Rhyu, K.M. Choe, Y.J. Oh, Binding preference of p62 towards LC3-ll during dopaminergic neurotoxin-induced impairment of autophagic flux, Autophagy 7 (2011) 51e60.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
8
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[28] J. Bottenstein, I. Hayashi, S. Hutchings, H. Masui, J. Mather, D.B. McClure, S. Ohasa, A. Rizzino, G. Sato, G. Serrero, R. Wolfe, R. Wu, The growth of cells in serum-free hormone-supplemented media, Methods Enzymol. 58 (1979) 94e109. [29] J.H. Oh, W.S. Choi, J.E. Kim, J.W. Seo, K.L. O’Malley, Y.J. Oh, Overexpression of HA-Bax but not Bcl-2 or Bcl-XL attenuates 6-hydroxydopamine-induced neuronal apoptosis, Exp. Neurol. 154 (1998) 193e198. [30] Y.M. Lee, S.H. Park, D.I. Shin, J.Y. Hwang, B. Park, Y.J. Park, T.H. Lee, H.Z. Chae, B.K. Jin, T.H. Oh, Y.J. Oh, Oxidative modification of peroxiredoxin is associated with drug-induced apoptotic signaling in experimental models of Parkinson disease, J. Biol. Chem. 283 (2008) 9986e9998. [31] Y. Saito, H. Shibayama, H. Tanaka, A. Tanimura, Y. Kanakura, A cell-deathdefying factor, anamorsin mediates cell growth through inactivation of PKC and p38MAPK, Biochem. Biophys. Res. Commun. 405 (2011) 303e307. [32] S. Fourquet, R. Guerois, D. Biard, M.B. Toledano, Activation of NRF2 by nitrosative agents and H2O2 involves KEAP1 disulfide formation, J. Biol. Chem. 285 (2010) 8463e8471. [33] Y.M. Go, D.P. Jones, Redox control systems in the nucleus: mechanisms and functions, Antioxidants Redox Signal. 13 (2010) 489e509. [34] M. Saitoh, H. Nishitoh, M. Fujii, K. Takeda, K. Tobiume, Y. Sawada, M. Kawabata, K. Miyazono, H. Ichijo, Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1, EMBO J. 17 (1998) 2596e2606. [35] H. Ichijo, E. Nishida, K. Irie, P. ten Dijke, M. Saitoh, T. Moriguchi, M. Takagi, K. Matsumoto, K. Miyazono, Y. Gotoh, Induction of apoptosis by ASK1, a
[36] [37]
[38]
[39]
[40]
[41]
[42]
mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways, Science 275 (1997) 90e94. J. Matsukawa, A. Matsuzawa, K. Takeda, H. Ichijo, The ASK1-MAP kinase cascades in mammalian stress response, J. Biochem. 136 (2004) 261e265. J.A. McCubrey, M.M. Lahair, R.A. Franklin, Reactive oxygen species-induced activation of the MAP kinase signaling pathways, Antioxidants Redox Signal. 8 (2006) 1775e1789. K. Takeda, T. Noguchi, I. Naguro, H. Ichijo, Apoptosis signal-regulating kinase 1 in stress and immune response, Annu. Rev. Pharmacol. Toxicol. 48 (2008) 199e225. B.I. Giasson, J.E. Duda, I.V. Murray, Q. Chen, J.M. Souza, H.I. Hurtig, H. Ischiropoulos, J.Q. Trojanowski, V.M. Lee, Oxidative damage linked to neurodegeneration by selective alpha-synuclein nitration in synucleinopathy lesions, Science 290 (2000) 985e989. M.J. LaVoie, B.L. Ostaszewski, A. Weihofen, M.G. Schlossmacher, D.J. Selkoe, Dopamine covalently modifies and functionally inactivates parkin, Nat. Med. 11 (2005) 1214e1221. J. Choi, A.I. Levey, S.T. Weintraub, H.D. Rees, M. Gearing, L.S. Chin, L. Li, Oxidative modifications and down-regulation of ubiquitin carboxyl-terminal hydrolase L1 associated with idiopathic Parkinson’s and Alzheimer’s diseases, J. Biol. Chem. 279 (2004) 13256e13264. J. Choi, M.C. Sullards, J.A. Olzmann, H.D. Rees, S.T. Weintraub, D.E. Bostwick, M. Gearing, A.I. Levey, L.S. Chin, L. Li, Oxidative damage of DJ-1 is linked to sporadic Parkinson and Alzheimer diseases, J. Biol. Chem. 281 (2006) 10816e10824.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
Contents lists available at ScienceDirect
Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc
Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death Kyung-Ah Park a, 1, Nuri Yun b, 1, Young J. Oh a, * a b
Department of Systems Biology, Yonsei University College of Life Science and Biotechnology, Seoul, 03722, Republic of Korea Institute of Life Science & Biotechnology, Yonsei University, Seoul, 03722, Republic of Korea
a r t i c l e i n f o
a b s t r a c t
Article history: Received 11 September 2019 Accepted 21 September 2019 Available online xxx
Neurodegenerative diseases are associated with elevated levels of metal elements, which are well-known inducers of reactive oxygen species (ROS) in cells. Because dopaminergic neurons in the substantia nigra are vulnerable to ROS, dysregulation of metals and the resulting accumulation of ROS could be a cause of dopaminergic neurodegeneration. In this study, we showed that overexpression of anamorsin protected MN9D dopaminergic neuronal cells from cupric chloride-induced death. This cytoprotection was achieved by specifically decreasing ROS levels. As determined by mini two-dimensional electrophoretic assay, an acidic shift of anamorsin occurred during drug-induced death, which seemed to be mediated by oxidative modification of three of its CXXC motifs. Consequently, drug-induced dissociation of ASK1 from Trx1 and subsequent phosphorylation of JNK and p38 MAPK were inhibited in MN9D cells overexpressing anamorsin. Taken together, our results indicate that anamorsin exerts a neuroprotective effect by reducing intracellular ROS levels and subsequently attenuating activated stress-activated MAP kinases pathways. © 2019 Elsevier Inc. All rights reserved.
Keywords: Anamorsin Cupric chloride Reactive oxygen species Mitogen-activated protein kinase
1. Introduction Neurodegenerative diseases involve a progressive loss of specific neuronal cell populations and are associated with a surge of reactive oxygen species (ROS), mitochondrial dysfunction, and accumulation of protein aggregates [1,2]. Oxidative stress is the result of dysregulated production and clearance of ROS [3]. Intracellular ROS are associated with disruptions in redox circuitry and macromolecular damage, and can therefore cause neuronal death. ROS are produced through different pathways, including direct interaction between oxygen species and redox-active metals, which typically accumulate during brain aging [4,5]. Through reactions between metals and oxygen, hydrogen peroxide and superoxide anion are generated, leading to the production of hydroxyl radicals, which are involved in neurodegeneration [3]. Cysteine residues of catalytic proteins are oxidatively modified by disulfide formation, glutathionylation, and S-nitrosylation [6,7]. For
* Corresponding author. Department of Systems Biology, Yonsei University College of Life Science and Biotechnology, Yonsei-ro 50, Seodaemun-gu, Seoul, 03722, Republic of Korea. E-mail address: [email protected] (Y.J. Oh). 1 These authors made equal contributions to this work.
example, hydrogen peroxide is well known for its role in oxidizing thiol groups of cysteine residues. The reaction of cysteinyl thiolates with hydrogen peroxide can lead to the formation of sulfenic acid, sulfinic acid, and sulfonic acid in addition to disulfide bond formation and glutathione conjugation [8,9]. These cysteine oxidations can change the activities of cellular proteins, which can alter their physiological roles [10]. Certain proteins exert pro-survival functions upon oxidation of their cysteine residues [11e13]. Some such proteins contain CXXC motifs, in which two cysteines are separated by two other amino acids, which are well-known cysteine redox motifs [7,14,15]. CXXC motifs are necessary for metal binding, DNA binding, and iron-sulfur cluster biogenesis [16,17]. Anamorsin, first identified as an anti-apoptotic protein, is indispensable for definitive hematopoiesis [18]. Although anamorsin does not show sequence homology with other cell deathregulating proteins, previous studies demonstrate that Dre2, a yeast homolog of anamorsin, encodes a conserved Fe/S cluster protein and controls mitochondrial integrity and cell death [19,20]. Yang et al. suggest that anamorsin controls proliferation, migration, and apoptosis of vascular smooth muscle cells by regulating Bcl-2 and Bax [21]. Also, its depletion inhibits proliferation of chronic myeloid leukemia cells and triggers apoptosis [22]. Using in situ
https://doi.org/10.1016/j.bbrc.2019.09.089 0006-291X/© 2019 Elsevier Inc. All rights reserved.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
2
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
hybridization and immunoblot analyses, we revealed that anamorsin is distributed across the brain [23]. RNA interferencemediated knockdown of anamorsin renders neuronal cells more vulnerable to apoptosis, whereas reintroduction of anamorsin makes neuronal cells resistant to drug-induced death [24]. In support of our findings, anamorsin was shown to inhibit ischemiainduced damage through regulation of MAPK and apoptotic signaling pathways [25]. The specific aim of this study was to explore the mechanism governing the neuroprotective role of anamorsin using an ROSinduced neuronal cell death paradigm. We hypothesized that the anti-apoptotic role of anamorsin can be mediated by its CXXC motifs that are oxidized via the capture of ROS after exposure to cupric chloride. We also hypothesized that outcomes of this event are linked to attenuation of drug- and stress-induced MAPK signaling. 2. Materials and methods 2.1. Cell culture MN9D dopaminergic neuronal cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Sigma, St. Louis, MO, USA) supplemented with 10% heat-inactivated fetal bovine serum (Gibco, Grand Island, NY, USA) [26]. Cells were seeded at a density of 1 106 cells in P-100 dishes or 2 105 cells in 6-well plates. One day after plating, transfection was performed using Lipofectamine™ 2000 Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA). Twenty-four hour after transfection, cells were used for experiments. The medium was changed to serum-free N2 medium and treated with 250 mM cupric chloride (Sigma) for the indicated durations [26e28]. 2.2. Plasmid and transfection pcDNA3 containing mouse anamorsin cDNA was gifted from Dr. Hirohiko Shibayama at Osaka University. FLAG-tagged mouse anamorsin was amplified by polymerase chain reaction with the primers 50 CTCTCGAGATGGACTATAAGGACGATGATGACAAGATGGAGGAGTTTGGG-30 and 50 -GCAATCTCCAGGATGCCTAGTCTAGAGG-30 and subcloned into the pCI-neo vector (Promega, Madison, WI, USA). pCI-neo vector encoding CXXC triple-mutant anamorsin was generated using a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA) with the following primer sets: 50 - GAGGAAGGCCAGTAAGAACAGC ACCAGTGGCCTCGCAGAG-30 and 50 -CTCTGCGAGGCCACTGGTGCTGT TCTTACTGGCCTTCCTC-3’ (C244/247/249S), 50 - CCCAAGTCAGCCAGTGGAAATAGCTACCTGGGTGAC-30 and 50 - GTCACCCAGGTAGCTATTTCCACTGGCTGACTTGGG-3’ (C271/274S), and 50 - GACGC TTTCCGCAGTGCCAACAGCCCCTACCTCGGG-30 and 50 - CCCGAGGTAGGGGCTGTTGGCACTGCGGAAAGCGTC-3’ (C282/285S). All constructs were confirmed by DNA sequencing. 2.3. Viability assay The rate of cell survival was determined by colorimetric measurement using 3-[4,5-dimethylthiazol-2-yl]-2,5diphenyltetrazolium bromide (MTT) reduction assay [29]. Values are expressed as a percentage of untreated control cells (100%). To assess apoptotic features, cells were subjected to fluorescenceactivated cell sorting (FACS) analysis for Annexin V binding and propidium iodide (PI) uptake using a FITC Annexin V Apoptosis Detection Kit 1 (BD Biosciences, Mountain View, CA, USA) and then analyzed with FACS Calibur (BD Biosciences). Calculations were performed with the CellQuest program (BD Biosciences).
2.4. Measurement of calcium (Ca2þ) and mitochondria permeability: After drug treatment, cytosolic Ca2þ was measured with 3 mM Fluo-3 mixed with pluronic acid for 30 min at 37 C. Mitochondrial permeability was measured by incubation with 250 mM Mitotracker for 20 min at 37 C. After incubation, cells were then washed with DMEM. All reagents were purchased from Thermo Fisher Scientific. Fluorescent images were taken under an Axiovert 100 microscope (Carl Zeiss, Zena, Germany). 2.5. ROS measurement Levels of intracellular ROS were determined with 20 -70 dichlorofluorscein diacetate (DCF-DA). After drug treatment, cells were stained with 3 mM DCF-DA for 20 min at 37 C followed by washes with chilled phosphate-buffered saline (PBS). Cells were analyzed with FACS Calibur followed by calculation with the CellQuest program. Fluorescent images were taken under an Axiovert 100 microscope. 2.6. Mini two-dimensional electrophoresis (2DE) Unless otherwise stated, all chemicals used for mini-2DE were purchased from Sigma. Mini-2DE experiments were performed as previously described [30]. After drug treatment, cells were solubilized in sample buffer containing 7 M urea/2 M thiourea/4% CHAPS/ 40 mM Tris-HCl/100 mM dithiothreitol/2 mM tributyl phosphine/ 2 mM phenylmethylsulfonyl fluoride/100 mg/ml leupeptin/150 units/ml endonuclease/1% IPG buffer. Whole-cell lysates (50 mg) were processed using a 7-cm Immobiline DryStrip (pH 3-10NL; GE Healthcare Life Sciences, Marlborough, MA, USA) for isoelectric focusing. After the equilibration step, SDS-PAGE was performed on a 12.5% gel in a Mini-Protean 3 Electrophoresis Cell (Bio-Rad, Hercules, CA, USA). Gels were subjected to immunoblot analysis. 2.7. Redox Western blot After drug treatment, cells were washed with 5 mM N-ethylmaleimide (NEM) in chilled PBS (Lonza, Basel, Switzerland), and cell lysates were prepared with 50 mM NEM in RIPA buffer containing 50 mM Tris-HCl pH 7.4, 1% NP-40, 0.25% Na-deoxycholate, 150 mM NaCl, 1 mM EDTA, 0.1% SDS, and complete protease inhibitor cocktail (Roche, Mannheim, Germany). For sample nonreducing conditions, protein (30 mg) was prepared with 3 nonreducing sample buffer. For sample-reducing conditions, protein was prepared with 5 sample buffer containing 500 mM DTT, separated by 11.5% SDS-PAGE, and subjected to immunoblot analyses using Flag-horseradish peroxidase (HRP)-conjugated antibodies. 2.8. Immunoblot analysis After drug treatment, cells were lysed on ice in RIPA buffer and homogenized using a 1-ml syringe with a 26-gauge needle. Cell lysates were centrifuged at 15,000g for 15 min at 4 C. Supernatant proteins were quantified using Bradford protein assay reagent (Bio-Rad), separated on SDS-PAGE gels, and blotted onto PVDF membranes (Pall Corp., Ann Arbor, MI, USA). Membranes were probed with the following primary antibodies: rat anti-anamorsin (1:20,000; gifted by Hirohiko Shibayama), HRP-conjugated antiHA antibody (1:2500; Sigma), mouse anti-glyceraldehyde 3phosphate dehydrogenase (GAPDH; 1:5000; Chemicon, Dundee, UK), rabbit anti-JNK1 (1:1000), rabbit anti-p-JNK1 (1:1000), rabbit anti-p38 (1:1000), or rabbit anti-p-p38 antibody (1:1000; all from
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Cell Signaling Technology, Boston, MA). After washes with Trisbuffered saline containing 0.1% Tween-20, cells were incubated with goat anti-rabbit HRP-conjugated antibody (1:4000), goat antimouse HRP-conjugated antibody (1:4000), or goat anti-rat HRPconjugated antibody (1:5000; all from Santa Cruz Biotechnology, Santa Cruz, CA). Specific bands were detected using enhanced chemiluminescence (Amersham Pharmacia Biotech, Piscataway, NJ, USA). 3. Results and discussion 3.1. Anamorsin attenuates copper-induced MN9D cell death Previous studies show that anamorsin has an anti-apoptotic function in non-neuronal cells [18,21,24,31]. We showed that expression of anamorsin is relatively high in the brain [23], raising the possibility of its anti-cell death role in the nervous system [24]. Based on these studies, we evaluated its neuroprotective role in cupric chloride-induced neuronal death. Immunoblot analyses demonstrated that MN9D cells transfected with vector containing FLAG-tagged anamorsin cDNA overexpressed anamorsin (Fig. 1A). MTT reduction assays showed that cell viability was higher in MN9D cells overexpressing anamorsin after treatment with cupric chloride for 24 h (Fig. 1B). To further confirm these results, MN9D cells were subjected to fluorogenic cell death assays using an Annexin V/PI staining kit followed by FACS analysis after drug treatment. The amount of Annexin V-positive cells was reduced by approximately 10% (29.27% vs. 20.59%; Fig. 1C). The amount of PIpositive cells was also reduced in anamorsin-overexpressing MN9D cells (20.37% vs. 15.47%; Fig. 1D). Taken together, these results indicate that anamorsin attenuated cupric chloride-induced neuronal death. 3.2. Anamorsin attenuates cupric chloride-induced ROS production To identify initial cell death triggers that are blocked by anamorsin, we measured cytosolic Ca2þ levels, mitochondria permeability, and ROS levels using three fluorescent dyes: Fluo-3, Mitotracker red, and DCF-DA, respectively. We found that levels of cytosolic Ca2þ were dramatically increased in blank vectortransfected MN9D cells after treatment with cupric chloride (Fig. 2A, upper panels). Cupric chloride-induced surge of cytosolic Ca2þ was not altered in anamorsin-overexpressing MN9D cells. We then compared the intensity of Mitotracker red fluorescent signals in two groups after cupric chloride treatment. Cupric chlorideinduced loss of mitochondrial permeability and a resulting decrease in red fluorescence was detected in both groups (Fig. 2A, middle panels), indicating that cytosolic Ca2þ levels and mitochondria permeability were not affected by anamorsin. To measure changes in intracellular ROS levels, MN9D cells were loaded with DCF-DA dyes after cupric chloride treatment. Compared with DCFDA-positive signal in blank vector-transfected MN9D cells, green fluorescence signals in anamorsin-overexpressing MN9D cells were significantly attenuated (Fig. 2A, bottom panels). To further clarify whether the drug-induced surge in intracellular ROS levels was attenuated in anamorsin-overexpressing cells, cells were transfected with red fluorescent protein (RFP)-tagged anamorsin were treated with cupric chloride and loaded with DCF-DA. Using FACS analyses, cells positive for RFP and DCF-DA signals were counted to calculate the number of DCF-DA-positive cells among RFP-positive cells in both groups. Compared with RFP vector-expressing MN9D cells, RFP-tagged anamorsin-overexpressing MN9D cells showed a dramatically reduced number of DCF-DA-positive cells after drug treatment (51.30% vs. 16.14%; Fig. 2B). Double immunofluorescence experiments demonstrated that the number of RFP and DCF-DA
double-positive yellow spots was significantly reduced anamorsin-overexpressing cells (Supplementary Fig. 1).
3
in
3.3. CXXC motifs of anamorsin are oxidized after treatment with cupric chloride As various proteins protect cell death by being oxidized [11e13], we tested whether ROS-mediated modification of anamorsin occurs during cupric chloride-induced cell death. To examine oxidative modification of anamorsin, we performed mini-2DE analyses using MN9D cells treated with or without cupric chloride. The mini-2DE technique can separate proteins by their own isoelectric point (pI). If the protein is oxidized, the protein spot will shift to the more acidic side than the original spot. In untreated control cells, two anamorsin spots were detected. The main spot was larger and more basic (black arrow #1) than the second spot (black arrow #2). The main spot was detected at the theoretical pI value of anamorsin. However, in cupric chloride-treated cells, the intensity of the second spot was higher (red arrow #2), and one additional spot was detected at a more acidic position (red arrow #3; Fig. 3B, right panels). However, the total amount of anamorsin in each sample was the same (Fig. 3B, left panel), indicating that cupric chloride specifically induced an acidic shift of anamorsin. To examine whether this acidic shift of anamorsin reflects its redox status after drug treatment, cell lysates were subject to immunoblot analyses in non-reducing or reducing conditions (Fig. 3C) as previously described [32]. In non-reduced samples, relatively faint upper size bands were detected in anamorsinoverexpressing cells after drug treatment (Fig. 3C, left panel, lane 4), whereas these bands were not detected in untreated control samples (Fig. 3C, left panel, lane 2). These upper size bands disappeared under reducing conditions (Fig. 3C, right panel). These results indicate that oxidative modification of anamorsin occurred during cupric chloride-induced neuronal death. Anamorsin has three conserved CXXC motifs (Fig. 3A). To determine the relationship between these CXXC motifs and the acidic shift of anamorsin, a triple CXXC mutant was constructed in which cysteine residues were mutated to serine. With this mutant, the same experiment was performed to determine whether the CXXC motifs are responsible for oxidative modification of anamorsin after treatment with cupric chloride (Fig. 3D). As expected, even under non-reducing conditions, triple CXXC mutant anamorsin did not show the upper size bands that were detected in wild-type anamorsin in non-reducing conditions (red arrows). These results show that cupric chloride-induced oxidative modification of anamorsin was mediated by cysteine residues in the CXXC motif. 3.4. Anamorsin attenuates cupric chloride-induced activation of JNK and p38 through interaction with thioredoxin 1 Thioredoxin is a small thiol disulfide oxidoreductase first identified in E. coli and is involved in a wide range of cellular redox processes [33]. Mammalian thioredoxin has two well-known isoforms: Trx1 and Trx2. Thioredoxin was identified as an ASK1 binding protein that negatively regulates ASK1 kinase activity [34]. ROS can dissociate ASK1 from thioredoxin, and liberated ASK1 becomes activated and in turn activates the downstream MAP kinase, leading to cell death [35e38]. Therefore, we tested whether the JNK1/p38 axis is activated during cupric chloride-induced cell death. Co-immunoprecipitation assay showed the dissociation of ASK1 from thioredoxin in cupric chloride-treated cells (Fig. 4A, right panel, lane 3 vs. lane 4). Under these conditions, phosphorylated forms of JNK and p38 increased in the cupric chloride-treated lane (Fig. 4B). We then tested whether anamorsin can attenuate
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
4
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 1. Anamorsin attenuates cupric chloride-induced cell death. (AeD) MN9D cells were transfected with pCI vector containing FLAG-tagged anamorsin (AM) cDNA sequences. (B) MTT assay and (C, D) FACS analysis of Annexin V/PI uptake was performed after 250 mM cupric chloride treatment. (B) MTT assay was performed upon exposure to cupric chloride for the indicated time periods. Cell viability was assessed by the percentage of viable cells in drug-treated groups over that in untreated control groups (100%). Data are expressed as the mean ± standard deviation for three independent experiments performed in triplicate. Student’s t-tests were used to determine significant differences between group. *p < 0.05; n.s., not significant. Values from FACS analysis of (C) Annexin V- or (D) PI-positive cells are expressed as a percentage of the total number of counted cells.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
5
Fig. 2. Anamorsin attenuates the cupric chloride-induced increase in ROS. (A) MN9D cells transfected with a vector containing anamorsin cDNA sequences were treated with 250 mM cupric chloride for 18 h. Cells were then loaded with Fluo-3, Mitotracker red, and DCF-DA to measure cytosolic Ca2þ, mitochondrial permeability, and ROS, respectively. Representative fluorescence microscopy and phase-contrast microscopy images are provided. Scale bar, 100 mm. (B) Cells were transfected with vector containing RFP-tagged anamorsin cDNA sequences. Cells were then treated with 250 mM cupric chloride and subjected to FACS analysis. DCF-DA-positive cells among RFP-tagged anamorsin-expressing cells were counted.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
6
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
Fig. 3. Cupric chloride-induced oxidative modification of anamorsin is attenuated in anamorsin-overexpressing cells. (A) CXXC motif alignment of human, mouse, and yeast anamorsin. (B) MN9D cells were treated with 250 mM cupric chloride for 10 h and subjected to immunoblot (left panel) and mini-2DE (two right panels) analyses. In mini-2DE, spot #1 had an estimated pI value of 5.11. Two acidic shift spots of anamorsin are indicated by #2 and #3. (C, D) MN9D cells transfected with vector containing FLAG-tagged anamorsin cDNA sequences (wild-type, W) or triple CXXC mutant (3 M) were treated with 250 mM cupric chloride for 10 h. Cell lysates were separated under non-reducing or reducing conditions and subjected to immunoblot analyses using anti-FLAG-HRP antibody. Anti-GAPDH antibody was used as a loading control. Asterisks refer to non-specific bands.
drug-induced phosphorylation of JNK and p38. In anamorsinoverexpressing cells, decreased levels of the phosphorylated forms of JNK1 and p38 appeared upon exposure to cupric chloride (Fig. 4C), indicating that anamorsin regulates the ASK-MAP kinase pathway. In a separate experiment, we found that anamorsin translocated into the nucleus after drug treatment (Supplementary Fig. 2). Interestingly, Trx1 also translocated into the nucleus upon exposure to cupric chloride (Supplementary Fig. 3). Binding between anamorsin and Trx1 was detected in both the cytosol and nucleus. Thioredoxin has two cysteine residues that can be oxidized from the reduced form Trx-(SH)2 to the oxidized form Trx-S2 by
ROS. Because only the reduced form Trx-(SH)2 binds to ASK1, the activity of ASK1 and its downstream MAP kinases depends on cellular ROS. In the present study, anamorsin overexpression attenuated the drug-induced increase in intracellular ROS. Consequently, anamorsin regulated thioredoxin oxidation and subsequently attenuated activation of JNK/p38. Although we did not examine the role of nuclearly translocated anamorsin and thioredoxin, our results demonstrate a novel anti-cell death mechanism in which anamorsin negatively regulates the ASK1-MAPK pathway by interacting with thioredoxin. The name “anamorsin” in Latin means anti-apoptotic molecule
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
7
Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.bbrc.2019.09.089. References
Fig. 4. Anamorsin negatively regulates JNK and P38 phosphorylation. (A) MN9D cells transfected with vector containing HA-tagged ASK1 cDNA sequences were treated with 250 mM cupric chloride for 10 h. Cell lysates were subjected to immunoprecipitation using anti-thioredoxin antibody followed by immunoblot analyses using antiHA antibody. (B) MN9D cells or (C) MN9D cells transfected with vector containing FLAG-tagged anamorsin cDNA sequences were treated with 250 mM cupric chloride for 10 h. Cell lysates were subjected to immunoblot analyses using the indicated antibodies.
[18]. However, its underlying molecular pathways are not understood. Here, we show that the oxidative modification of CXXC motifs comprises a critical step in the inhibition of neurodegeneration. This event is ROS-specific, as anamorsin did not affect dysregulation of mitochondria permeability or the surge of cytosolic Ca2þ. Accumulating evidence supports the notion that higher levels of ROS play a critical role in causing dopaminergic neurodegeneration in the substantia nigra. Oxidative modification of several disease-related proteins is responsible for dopaminergic neurodegeneration. Notably, oxidized a-synuclein exhibits a greater tendency to be misfolded and appears to be associated with neurodegeneration [39]. Dopamine directly binds to oxidatively modified parkin and inactivates its E3 ligase activity [40]. Oxidative modification downregulates functions of DJ-1 and ubiquitin carboxyl-terminal hydrolase L1 [41,42]. Taken together, these studies demonstrate a direct link between oxidative damage to these proteins and the pathogenesis of Parkinson’s disease. Our study extends these findings by reporting a novel mechanism by which oxidative modification of anamorsin attenuates MAPKmediated neurodegeneration, potentially via interacting with the redox protein thioredoxin. Acknowledgments This research was supported by the Small Grant for Exploratory Research Program (No.2018R1D1A1A02085731 to NY) through the National Research Foundation of Korea (NRF) grant funded by Ministry of Education and by the Brain Research Program (2017M37A1025369 to YJO) through the NRF grant funded by Ministry of Science and ICT.
[1] B.M. Morrison, P.R. Hof, J.H. Morrison, Determinants of neuronal vulnerability in neurodegenerative diseases, Ann. Neurol. 44 (1998) S32eS44. [2] C.A. Ross, M.A. Poirier, Protein aggregation and neurodegenerative disease, Nat. Med. 10 (Suppl) (2004) S10eS17. [3] K.J. Barnham, C.L. Masters, A.I. Bush, Neurodegenerative diseases and oxidative stress, Nat. Rev. Drug Discov. 3 (2004) 205e214. [4] W.H. Koppenol, The Haber-Weiss cycle–70 years later, Redox Rep. 6 (2001) 229e234. [5] M.A. Greenough, J. Camakaris, A.I. Bush, Metal dyshomeostasis and oxidative stress in Alzheimer’s disease, Neurochem. Int. 62 (2013) 540e555. [6] P. Ghezzi, Oxidoreduction of protein thiols in redox regulation, Biochem. Soc. Trans. 33 (2005) 1378e1381. [7] D.E. Fomenko, V.N. Gladyshev, Identity and functions of CxxC-derived motifs, Biochemistry 42 (2003) 11214e11225. [8] C. Jacob, A.L. Holme, F.H. Fry, The sulfinic acid switch in proteins, Org. Biomol. Chem. 2 (2004) 1953e1956. [9] L.B. Poole, P.A. Karplus, A. Claiborne, Protein sulfenic acids in redox signaling, Annu. Rev. Pharmacol. Toxicol. 44 (2004) 325e347. [10] S. Biswas, A.S. Chida, I. Rahman, Redox modifications of protein-thiols: emerging roles in cell signaling, Biochem. Pharmacol. 71 (2006) 551e564. [11] J. Wang, C.S. Sevier, formation and reversibility of BiP protein cysteine oxidation facilitate cell survival during and post oxidative stress, J. Biol. Chem. 291 (2016) 7541e7557. [12] M.A. Wilson, The role of cysteine oxidation in DJ-1 function and dysfunction, Antioxidants Redox Signal. 15 (2011) 111e122. [13] B. Carroll, E.G. Otten, D. Manni, R. Stefanatos, F.M. Menzies, G.R. Smith, D. Jurk, N. Kenneth, S. Wilkinson, J.F. Passos, J. Attems, E.A. Veal, E. Teyssou, D. Seilhean, S. Millecamps, E.L. Eskelinen, A.K. Bronowska, D.C. Rubinsztein, A. Sanz, V.I. Korolchuk, Oxidation of SQSTM1/p62 mediates the link between redox state and protein homeostasis, Nat. Commun. 9 (2018) 256. [14] A. Holmgren, Antioxidant function of thioredoxin and glutaredoxin systems, Antioxidants Redox Signal. 2 (2000) 811e820. [15] J.L. Martin, Thioredoxin–a fold for all reasons, Structure 3 (1995) 245e250. [16] S. Ollagnier-de-Choudens, T. Mattioli, Y. Takahashi, M. Fontecave, Iron-sulfur cluster assembly: characterization of IscA and evidence for a specific and functional complex with ferredoxin, J. Biol. Chem. 276 (2001) 22604e22607. [17] C. Krebs, J.N. Agar, A.D. Smith, J. Frazzon, D.R. Dean, B.H. Huynh, M.K. Johnson, IscA, an alternate scaffold for Fe-S cluster biosynthesis, Biochemistry 40 (2001) 14069e14080. [18] H. Shibayama, E. Takai, I. Matsumura, M. Kouno, E. Morii, Y. Kitamura, J. Takeda, Y. Kanakura, Identification of a cytokine-induced antiapoptotic molecule anamorsin essential for definitive hematopoiesis, J. Exp. Med. 199 (2004) 581e592. [19] Y. Zhang, E.R. Lyver, E. Nakamaru-Ogiso, H. Yoon, B. Amutha, D.W. Lee, E. Bi, T. Ohnishi, F. Daldal, D. Pain, A. Dancis, Dre2, a conserved eukaryotic Fe/S cluster protein, functions in cytosolic Fe/S protein biogenesis, Mol. Cell. Biol. 28 (2008) 5569e5582. [20] L. Vernis, C. Facca, E. Delagoutte, N. Soler, R. Chanet, B. Guiard, G. Faye, G. Baldacci, A newly identified essential complex, Dre2-Tah18, controls mitochondria integrity and cell death after oxidative stress in yeast, PLoS One 4 (2009) e4376. [21] Z. Yang, W.E. Wang, Q. Zhang, CIAPIN1 siRNA inhibits proliferation, migration and promotes apoptosis of VSMCs by regulating Bcl-2 and Bax, Curr. Neurovascular Res. 10 (2013) 4e10. [22] J. Wang, Q. Li, C. Wang, Q. Xiong, Y. Lin, Q. Sun, H. Jin, F. Yang, X. Ren, T. Pang, Knock-down of CIAPIN1 sensitizes K562 chronic myeloid leukemia cells to Imatinib by regulation of cell cycle and apoptosis-associated members via NFkappaB and ERK5 signaling pathway, Biochem. Pharmacol. 99 (2016) 132e145. [23] K.A. Park, N. Yun, D.I. Shin, S.Y. Choi, H. Kim, W.K. Kim, Y. Kanakura, H. Shibayama, Y.J. Oh, Nuclear translocation of anamorsin during druginduced dopaminergic neurodegeneration in culture and in rat brain, J. Neural Transm. 118 (2011) 433e444. [24] N. Yun, Y.M. Lee, C. Kim, H. Shibayama, A. Tanimura, Y. Hamanaka, Y. Kanakura, I.S. Park, A. Jo, J.H. Shin, C. Ju, W.K. Kim, Y.J. Oh, Anamorsin, a novel caspase-3 substrate in neurodegeneration, J. Biol. Chem. 289 (2014) 22183e22195. [25] H.J. Yeo, M.J. Shin, E.J. Yeo, Y.J. Choi, D.W. Kim, D.S. Kim, W.S. Eum, S.Y. Choi, Tat-CIAPIN1 inhibits hippocampal neuronal cell damage through the MAPK and apoptotic signaling pathways, Free Radic. Biol. Med. 135 (2019) 68e78. [26] H.K. Choi, L.A. Won, P.J. Kontur, D.N. Hammond, A.P. Fox, B.H. Wainer, P.C. Hoffmann, A. Heller, Immortalization of embryonic mesencephalic dopaminergic neurons by somatic cell fusion, Brain Res. 552 (1991) 67e76. [27] J. Lim, H.W. Kim, M.B. Youdim, I.J. Rhyu, K.M. Choe, Y.J. Oh, Binding preference of p62 towards LC3-ll during dopaminergic neurotoxin-induced impairment of autophagic flux, Autophagy 7 (2011) 51e60.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089
8
K.-A. Park et al. / Biochemical and Biophysical Research Communications xxx (xxxx) xxx
[28] J. Bottenstein, I. Hayashi, S. Hutchings, H. Masui, J. Mather, D.B. McClure, S. Ohasa, A. Rizzino, G. Sato, G. Serrero, R. Wolfe, R. Wu, The growth of cells in serum-free hormone-supplemented media, Methods Enzymol. 58 (1979) 94e109. [29] J.H. Oh, W.S. Choi, J.E. Kim, J.W. Seo, K.L. O’Malley, Y.J. Oh, Overexpression of HA-Bax but not Bcl-2 or Bcl-XL attenuates 6-hydroxydopamine-induced neuronal apoptosis, Exp. Neurol. 154 (1998) 193e198. [30] Y.M. Lee, S.H. Park, D.I. Shin, J.Y. Hwang, B. Park, Y.J. Park, T.H. Lee, H.Z. Chae, B.K. Jin, T.H. Oh, Y.J. Oh, Oxidative modification of peroxiredoxin is associated with drug-induced apoptotic signaling in experimental models of Parkinson disease, J. Biol. Chem. 283 (2008) 9986e9998. [31] Y. Saito, H. Shibayama, H. Tanaka, A. Tanimura, Y. Kanakura, A cell-deathdefying factor, anamorsin mediates cell growth through inactivation of PKC and p38MAPK, Biochem. Biophys. Res. Commun. 405 (2011) 303e307. [32] S. Fourquet, R. Guerois, D. Biard, M.B. Toledano, Activation of NRF2 by nitrosative agents and H2O2 involves KEAP1 disulfide formation, J. Biol. Chem. 285 (2010) 8463e8471. [33] Y.M. Go, D.P. Jones, Redox control systems in the nucleus: mechanisms and functions, Antioxidants Redox Signal. 13 (2010) 489e509. [34] M. Saitoh, H. Nishitoh, M. Fujii, K. Takeda, K. Tobiume, Y. Sawada, M. Kawabata, K. Miyazono, H. Ichijo, Mammalian thioredoxin is a direct inhibitor of apoptosis signal-regulating kinase (ASK) 1, EMBO J. 17 (1998) 2596e2606. [35] H. Ichijo, E. Nishida, K. Irie, P. ten Dijke, M. Saitoh, T. Moriguchi, M. Takagi, K. Matsumoto, K. Miyazono, Y. Gotoh, Induction of apoptosis by ASK1, a
[36] [37]
[38]
[39]
[40]
[41]
[42]
mammalian MAPKKK that activates SAPK/JNK and p38 signaling pathways, Science 275 (1997) 90e94. J. Matsukawa, A. Matsuzawa, K. Takeda, H. Ichijo, The ASK1-MAP kinase cascades in mammalian stress response, J. Biochem. 136 (2004) 261e265. J.A. McCubrey, M.M. Lahair, R.A. Franklin, Reactive oxygen species-induced activation of the MAP kinase signaling pathways, Antioxidants Redox Signal. 8 (2006) 1775e1789. K. Takeda, T. Noguchi, I. Naguro, H. Ichijo, Apoptosis signal-regulating kinase 1 in stress and immune response, Annu. Rev. Pharmacol. Toxicol. 48 (2008) 199e225. B.I. Giasson, J.E. Duda, I.V. Murray, Q. Chen, J.M. Souza, H.I. Hurtig, H. Ischiropoulos, J.Q. Trojanowski, V.M. Lee, Oxidative damage linked to neurodegeneration by selective alpha-synuclein nitration in synucleinopathy lesions, Science 290 (2000) 985e989. M.J. LaVoie, B.L. Ostaszewski, A. Weihofen, M.G. Schlossmacher, D.J. Selkoe, Dopamine covalently modifies and functionally inactivates parkin, Nat. Med. 11 (2005) 1214e1221. J. Choi, A.I. Levey, S.T. Weintraub, H.D. Rees, M. Gearing, L.S. Chin, L. Li, Oxidative modifications and down-regulation of ubiquitin carboxyl-terminal hydrolase L1 associated with idiopathic Parkinson’s and Alzheimer’s diseases, J. Biol. Chem. 279 (2004) 13256e13264. J. Choi, M.C. Sullards, J.A. Olzmann, H.D. Rees, S.T. Weintraub, D.E. Bostwick, M. Gearing, A.I. Levey, L.S. Chin, L. Li, Oxidative damage of DJ-1 is linked to sporadic Parkinson and Alzheimer diseases, J. Biol. Chem. 281 (2006) 10816e10824.
Please cite this article as: K.-A. Park et al., Anamorsin attenuates cupric chloride-induced dopaminergic neuronal cell death, Biochemical and Biophysical Research Communications, https://doi.org/10.1016/j.bbrc.2019.09.089