Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR-21 expression in diabetic nephropathy mice

Molecular and Cellular Endocrinology xxx (2017) 1e10

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR-21 expression in diabetic nephropathy mice Jinyang Wang a, **, 1, Lijun Duan b, *, 1, Yanbin Gao c, 1, Shuhong Zhou d, 1, Yongming Liu e, Suhong wei a, Siqin An a, Jing Liu a, Liming Tian a, Shaocheng Wang f a

Department of Endocrinology, Gansu Provincial People's Hospital, Gansu Key Laboratory of Endocrine and Metabolism, 204 Donggang West Road, Lanzhou, 730000, PR China Department of Gynecology and Obstetrics, Gansu Provincial People's Hospital, 204 Donggang West Road, Lanzhou 730000, PR China c Metabolic Disease Center, School of Traditional Chinese Medical, Capital Medical University, Beijing Key Laboratory of TCM Collateral Disease Theory Research, Beijing, 100069, PR China d Department of Rheumatology and Immunology, Gansu Provincial People's Hospital, 204 Donggang West Road, Lanzhou, 730000, PR China e Department of Geriatric Endocrinology, The First Hospital of Lanzhou University, 1 Donggang West Road, Lanzhou, 730000, PR China f Clinical College of Ophthalmology, Tianjin Medical University, Tianjin Eye Hospital, Tianjin, 300070, PR China b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 July 2017 Received in revised form 29 November 2017 Accepted 8 December 2017 Available online xxx

Cardiac fibrosis with diabetic nephropathy (DN) is one of major diabetic complications. miR-21 and MMP-9 were closely associated with fibrosis diseases. Angiotensin II receptor blockers (ARB) have cardioprotective effects. However, it remains unclear whether miR-21 was involved in the mechanism of cardiac fibrosis with DN by target MMP-9 and ARB ameliorates cardiac fibrosis partly by inhibiting miR21 expression. In this study, In Situ Hybridization(ISH), RT-PCR, cell transfection, western blotting and laser confocal telescope were used, respectively. ISH showed that miR-21, concentrated in cytoplasmic foci in the proximity of the nucleus, was mainly localized in cardiac fibroblasts and at relatively low levels in cardiomyocytes within cardiac tissue with DN. RT-PCR showed that miR-21 expression was significantly enhanced in cardiac tissue with DN, accompanied by the increase of col-IV, FN, CVF, PVCA, LVMI, HWI and NT-pro-BNP (p < 0.05). Bioinformatics analysis and Luciferase reporter gene assays showed that MMP-9 was a validated target of miR-21. Furthermore, cell transfection experiments showed that miR-21 overexpression directly decreased MMP-9 expression. Interestingly, miR-21 levels in cardiac tissue was positively correlated with ACR (r ¼ 0.870, P ¼ 0.003), whereas, uncorrelated with SBP, HbA1C and TCho (p > 0.05). More importantly, ARB can significantly decrease miR-21 expression in cardiac tissue, cardiac fibroblasts and serum. Overall, our results suggested that miR-21 may contribute to the pathogenesis of cardiac fibrosis with DN by target MMP-9, and that miR-21 may be a new possible therapeutic target for ARB in cardiac fibrosis with DN. © 2017 Published by Elsevier Ireland Ltd.

Keywords: Cardiac fibrosis miRNAs MMP-9 Diabetic nephropathy (DN) ARB

1. Introduction Abbreviations: ARB, Angiotensin II receptor blocker; MMP-9, Matrix metalloprotease-9; DN, diabetic nephropathy; ISH, In Situ Hybridization; CVF, Collagen volume fraction; PVCA, Perivascular collagen area; LVMI, Left ventricle mass index; HWI, Heart weigh index; miRNAs,miRs, MicroRNAs; ACR, Urinary albumin creatinine ratio; SBP, Systolic blood pressure; HbA1c, glycosylated hemoglobin A1c; ECM, extracellular matrix proteins; NT-pro-BNP, N-terminal pro-brain natriuretic peptide; T-Cho, total cholesterol. * Corresponding author. ** Corresponding author. E-mail addresses: [email protected] (J. Wang), [email protected] (L. Duan). 1 Jinyang Wang, Yanbin Gao, Lijun Duan and Shuhong Zhou all contributed equally to this study.

Diabetic cardiac fibrosis is one of the main causes of morbidity and mortality in patients with DN (Maya and Villarreal, 2010). One key feature of cardiac fibrosis is the accumulation of extracellular matrix proteins(ECM) such as collagens, elastins and fibronectins, synthesized by cardiac fibroblasts(CF), normal ECM turnover represents a physiological process to maintain cardiac structural backbone homeostasis (Maeda et al., 2012). Excessive ECM deposition, known as cardiac fibrosis, interferes with conduction and has been shown to increase myocardial stiffness and the decline of compliance, finally, lead to the cardiac dysfunction and heart failure

https://doi.org/10.1016/j.mce.2017.12.005 0303-7207/© 2017 Published by Elsevier Ireland Ltd.

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

2

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

(Kim et al., 2013). Matrix metalloprotease-9 (MMP-9) is a proteolytic enzyme responsible for ECM protein degradation, which are involved in the initiation and progression of cardiac fibrosis in DN (Li et al., 2015; Xiao et al., 2015). MicroRNAs (miRNAs) are small non-coding RNAs that regulate gene expression at the post-transcriptional level by either degradation or translational repression of a target mRNA (Wang et al., 2014). Recent studies have revealed that miR-21 is a highly expressed miRNA in cardiovascular system, which is deregulated in heart and vasculature under cardiovascular disease conditions such as proliferative vascular disease, cardiac hypertrophy and heart failure, and ischemic heart disease (Cheng and Zhang, 2010). With regard to cardiovascular disease, miR-21 enhances cardiac fibrotic remodeling and fibroblast proliferation via CADM1/STAT3 pathway (Cao et al., 2017). miR-21e3p regulates cardiac hypertrophic response by targeting histone deacetylase-8 (Yan et al., 2015). miR21 increases c-kit þ cardiac stem cell proliferation in vitro through PTEN/PI3K/Akt signaling (Shi et al., 2017). miR-21 promotes fibrosis in an acute cardiac allograft transplantation model (Gupta et al., 2016). miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue in murine myocardial infarction (Roy et al., 2009). P-smad2/3 and dicer promote pre-miR-21 processing during pressure overload-associated myocardial remodeling (Garcia et al., 2015). miR-21 exerts protective effects on endothelial injury through the PTEN/VEGF pathway after acute myocardial infarction (Yang et al., 2016). miR-21 leads to increase fibrosis combined with decreased levels of apoptosis by activating the ERK/MAP kinase signaling (Shen et al., 2013). Combination of miR-21 and miR-146a attenuates cardiac dysfunction and apoptosis during acute myocardial infarction in mice (Huang et al., 2016). miR-21 protects against ischemia-reperfusion and hypoxiareperfusion-induced cardiocyte apoptosis via the phosphatase and tensin homolog/Akt-dependent mechanism (Yang et al., 2014). With respect to miR-21 and MMP-9, miR-21 is associated with fibrosis in fibrotic liver disease by decreasing MMP-9 (TakeuchiYorimoto et al., 2016). miR-21 is a unique signature associated with coronary plaque instability in humans by regulating MMP-9 via reversion-inducing cysteine-rich protein with Kazal motifs. More importantly, our previous data demonstrated that miR-21 contributed to renal fibrosis by mediating MMP-9 expression (Wang et al., 2013). Above these findings strongly suggested that miR-21 not only participated in cardiovascular disease including fibrosis, but also was closely related to MMP-9. However, it remained elusive whether miR-21 was involved in the mechanism of cardiac fibrosis by target MMP-9 in the phase of micro-or macroalbumin stage of DN. Clinical studies have reported that angiotensin II(AngII) type-1 receptor(AT1R) blockers (ARB) have cardioprotective effects on diabetic patients by reversing ventricular hypertrophy and ameliorating cardiac function (Maeda et al., 2012). Recent reports have showed that AT1 receptor blocker azilsartan medoxomil normalizes plasma miR-146a and miR-342e3p in a murine heart failure model (Kaneko et al., 2016). Cardiac miR-133 is downregulated in thyroid hormone-mediated cardiac hypertrophy partially via AT1R (Diniz et al., 2015). The combined treatment with anti-miR-155 and losartan has a synergistic antiproliferative effect (Choi et al., 2012). AT1R antagonist antagonized ang-II increased miR-208a expression in HL-1 cells (Gul et al., 2015). ARB regulated circulating TLR-4-responsive miRNA panel in patients with coronary artery disease (Satoh et al., 2015). miR-155 plays a physiological role in regulating the expression of AT1R in human fibroblasts and VSMCs (Choi et al., 2012). miR-802 regulates AT1R expression in intestinal epithelial C2BBe1 cells (Sansom et al., 2010). Above these results strongly suggested that ARB was able to modulate miRNA expression and activity to control

cardiovascular diseases. However, it remained elusive whether ARB ameliorates cardiac fibrosis in proteinurina stage of DN by inhibiting miR-21 expression. In the present study, our aim was to determine whether miR-21 was involved in cardiac fibrosis with DN by regulating MMP-9 and ARB alleviated diabetic cardiac fibrosis partly by inhibiting miR-21 expression. This study demonstrated that miR-21 overexpression promoted cardiac fibrosis by target MMP-9 and ARB ameliorated cardiac structure and function by inhibiting miR-21 expression, and that miR-21 may be a new possible therapeutic target for ARB in cardiac fibrosis with DN. 2. Materials and methods 2.1. Animal model and experimental design C57BL/6J and KK-Ay mice were from Chinese Academy of Medical Sciences (12 weeks of age, Beijing, China). Normal control group (C57BL/6J mice) were fed by common forage, KK-Ay mice were fed by research diets(58% fat, 25.6% carbohydrate and 16.4% protein) for 4 weeks, when their random blood glucose (RBG) was16.7 mmol/l and ACR (urine albumin creatinine ratio) was300mg/mg were detected, KK-Ay mice were considered DN. To investigate the effect of ARB on miR-21-induced cardiac fibrosis in proteinurina stage of DN, KK-Ay DN mice were classified into the following groups: KK-Ay mice treated with vehicle (normal saline, NS, gavage) were utilized as the DN control group (n ¼ 10). KK-Ay DN mice treated with ARB (Valsartan, 10 mg/kg.day, Novartis, Beijing, China.) were utilized as DN with ARB treatment group (ARB group, n ¼ 10, gavage). KK-Ay DN mice treated with miR-21 overexpression[pre-miR-21, 4ul(109TU/ml)/day, 3 times/week, Shanghai Genechem Co., Ltd, China, in tail-vein injection] were utilized as pre-miR-21 group(n ¼ 10). KK-Ay DN mice were treated with miR-21 antagomir (antagonist) were utilized as miR-21 antagonist group (n ¼ 10). KK-Ay DN mice were treated with ARB plus pre-miR-21 lentivirus vector injection for 8 weeks were utilized as ARB þ pre-miR-21 group (n ¼ 10). Meantime, C57BL/6J mice treated with vehicle (normal saline, NS, gavage) was classified as the normal control group (NC group, n ¼ 10). At the end of 24 weeks, cardiac tissue from each mouse was also divided into two parts, one was immediately frozen in liquid nitrogen, and the other part was fixed with 4% paraformaldehyde and 2% glutaraldehyde for later experiments. The study protocol was approved by the Institutional Animal Care and Use Committee. 2.2. Histology and morphometric analysis by light and electron microscopy Tissue for light microscopy was fixed in 10% phosphate-buffered formalin and then embedded in paraffin. 4um thick sections were processed for Masson and Picrosirius red staining by light microscopy. Morphologic analyses were performed by an experienced pathologist who was blinded to the source of the tissue. Collagen volume fraction (CVF, %) ¼ myocardial collagen area/measured exposure area. Perivascular collagen area (PVCA, %) ¼ collagen area around small artery lumen area/small artery lumen area. Left ventricle mass index (LVMI, %) ¼ Left ventricular weight/body weight. Heart weigh index (HWI, %) ¼ Heart heavy weight/body weight. Tissues for electron microscope were fixed with 2% glutaraldehyde in 0.1 mol/L phosphate buffer at 4  C for 120min. Ultrathin sections were collected on 100-mesh copper grids and double stained with 4% uranyl acetate and lead citrate. The sections were examined with a Hitachi 7100 transmission electron microscope (Hitachi High Technologies, Tokyo, Japan).

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

2.3. Biochemical and routine markers assays Serum creatinine (SCr), Blood urea nitrogen (BUN), fasting plasma glucose (FPG), glycosylated hemoglobin A1c(HbA1c), total cholesterol (T-Cho), urine albumin and urine creatinine (DCA, 2000 system, Germany), Left ventricular weight (LVW), Heart weight(HW) and body weight (BW) were measured at 24 weeks of age. Systolic blood pressure (SBP) was measured by noninvasive tail arterial blood pressure measurement analysis system (PA-C20, Data Sciences International; St. Paul, MN). Urinary albumin creatinine ratio (ACR) was calculated as: ACR ¼ urinary albumin (mg)/urinary creatinine ratio (ug/mg) (Nishi et al., 2000). 2.4. In Situ hybridization 5 mm sections of FFPE cardiac tissue were used to assess the expression of miR-21 expression at 24 weeks of age. Doubledigoxigeninelabeled LNA-miR-21 specific probe sequence: 50 -dign/ tcaacatcagtctgataagcta/3'dig-n/(Exiqon) or Dig-conjugated control probes with scrambled sequence (50 -dign/gtgtaacacgtctatacgccca-/ 3'dig-n/, Exiqon). Briefly, 5-mm sections of FFPE cardiac biopsy tissue were deparaffinized by sequential washes with xylene, 100 to 25% ethanol and PBS. The sections were deproteinated with proteinase-K and fixed with 4% paraformaldehyde. Prehybridization was performed with hybridization buffer (50% formamide, 5  SSC, 0.1% Tween 20, 50ug/ml heparin, and 500ug/ml yeast tRNA [pH6]). Hybridization was performed with a probe concentration of 20 nM in hybridization buffer for 12 h at 52 C. The sections were washed with 2  SSC, then multiple washes in 50% Formamide, 2  SSC, and finally PBS and 0.1% Tween-20. The sections were blocked with blocking buffer (2% sheep serum, 2 mg/ml BSA in PBS, and 0.1% Tween 20) and then incubated with antiedigoxigeninalkaline phosphatase (Roche, Mannheim, Germany) in blocking buffer for 12 h. The sections were washed repeatedly in PBS and 0.1% Tween-20, and detection was performed using 1-Step NBT/ BCIP plus Suppressor (Pierce) according to manufacturer's instructions (Obernosterer et al., 2007). A scrambled probe was used as a negative control probe (Exiqon), with light blue cytoplasmic staining being positive; the sections were double stained with fast red to manifest nuclei. 2.5. Cell culture and grouping Normal mice cardiac fibroblasts (MCFs), obtained from Cell Biologics, Inc. MCFs were maintained in serum-free medium with 5 mmol/l glucose for 24 h, which was followed by incubation with fresh serum-free medium with 25 mmol/l glucose (high glucose) for different lengths of time(24,36,48,60 and 72 h). Control MCFs were incubated with 5 mmol/l glucose plus 20 mmol/l mannitol (low glucose) for different lengths of time (24, 36, 48, 60,72 h). Meantime, MCFs were treated with different concentrations of ARB (109, 108, 107, 106 and 105mmol/L) in serum-free medium with 25 mmol/l glucose. MCFs maintained in 5 mmol/l glucose were set as the Normal control group (NC group). MCFs in high glucose (25 mmol/l) were divided into two groups: high glucose group (HG group), cells were treated with ARB (valsartan, 108mmol/L) as the ARB group (ARB group). 2.6. Transfection of cultured MCFs To investigate the role of miR-21 in MCFs, we performed miR-21 transfection experiments in MCFs, MCFs were seeded at a density of 2  104 cells/cm2 in serum-free DMEM/F12. In this study, cells were divided into the following groups: cells without transfection were used as blank control group. Cells transfected with miR-control

3

lentivirus vector were used as miR-control group. Cells transfected with miR-21 overexpression (pre-miR-21) lentivirus vector were used as miR-21 overexpression group (pre-miR-21 group). Additionally, we observed the effect of ARB on the markers of miR21-induced fibrosis. Before the transfection, MCFs were treated with 108mmol/l ARB for 48 h, and then, pre-miR-21 lentivirus vector was transfected into MCFs as the ARB þ pre-miR-21 group. After the transfection of the pre-miR-21 lentivirus vector, cells were treated with 108mmol/l ARB for 48 h as the pre-miR-21 þ ARB group. After 12 h transfection, the medium was changed and the MCFs were incubated with fresh serum-containing medium for another 48 h. In our experiment, the most appropriate multiplicity of infection (MOI) for MCFs equals to 48, all the transfected cells were measured and sorted 48 h later according to the green fluorescent protein (GFP) intensity by flow cytometry, and the transfection efficiency was above 97%. The entire abovementioned lentivirus vector was custom-synthesized by Shanghai Genechem Co., Ltd, China. After 3 days of culturing, cells were harvested for RNA or protein isolation. 2.7. Real-time RT-PCR analysis For analysis of miR-21 expression in cardiac tissue, cardiac fibroblasts and serum, the stem-loop RT primer, real-time PCR primers were designed as described previously. Briefly, miRNAs were reverse transcribed into cDNAs by SuperScript II reverse transcriptase. Real-time PCR was performed using a standard Realtime RT-PCR protocol according to manufacturer's protocols (Applied Biosystems), and relative expression was calculated using the 2-DDCT method and normalized to the expression of U6 RNA. Primers for real-time PCR: miR-21: Forward primer (F): 50 gggtagcttatcagactgatgtt-30 , Reverse primer(R): 50 -cagtgcagggtccgaggt-3’. FN: F: 50 -tctgggaaatggaaaaggggaatgg30 , R: 50 -cactgaagcaggtttcctcggttgt-3’; and col-IV: F: 50 -tggtcttactgggaactttgctgc-3’; R: 50 -accctgtggtccaacgactcctctc-3’. MMP-9: F: 50 eggtctgggtgactccaaagcc-3’; R: 50 -ggtgagggtagtggtgtgtct-3’. All Real-time RT-PCRs were performed in triplicate. 2.8. Luciferase reporter gene assays To examine whether miR-21 regulates the expression of MMP-9, we transiently transfected miR-control plasmid (0.5ug), wild-type or mutant luciferase- MMP-9-30 UTR reporter (0.5ug) and miR-21 over-expressing plasmid (0.5ug) into 40e50% confluent cardiac fibroblasts (Genechem, Shanghai, China), which grown in a 24-well plate. The cells were harvested 48 h after transfection, and luciferase activity was measured with a dual luciferase reporter assay kit (Promega, Madison, WI, USA) on a luminometer (Lumat LB9507). 2.9. Immunocytochemistry (ICC) and immunohistochemistry (IHC) Cells were incubated on the coverglasses in six orifice plates, and then fixed with 4% paraformaldehyde. Antibodies and dilutions were as follows: rabbit polyclonal to MMP-9 (Abcam, 1:200), rabbit polyclonal to col-IV antibody (1:200; Abcam) and rabbit polyclonal to FN antibody (1:200; Abcam). The cells were then incubated with the secondary antibody for 2 h. DAPI was used to stain the cell nuclei (blue). Cells were observed under the confocal microscope (Leica TCS SP5 MP, Heidelberg GmbH, and German). For in vivo studies, cardiac tissue sections (4 mm) were subjected to immunohistochemical staining (IHC). Color was developed by incubating with diaminobenzidine and counterstaining with hematoxylin. The percentage of positively-stained area with 40 fields of view was analyzed by Image-pro plus 6.0 (Media cybernetics).

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

4

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

2.10. Western blot analysis Protein samples were subjected to 10% SDS-polyacrylamide gel electrophoresis and then transferred to PVDF membranes. The PVDF membranes were blocked with 50% skimmed milk, treated with primary antibody at 4  C overnight, washed and then incubated with the secondary horseradish for 2 h. Bands were detected with Enhanced chemiluminescence (ECL). Immunoblotting was performed with MMP-9 (Abcam, 1:500), col-IV antibody (1:500; Abcam) and FN antibody (1:500; Abcam). Then membranes were incubated with the secondary horseradish (1:5000) and exposed to X-ray. Densitometry was detected by Imagine J. Western blot analyses were performed at least in triplicate. 3. Statistical analysis All statistical tests were performed using SPSS software (SPSS, Chicago, IL). Comparisons between groups were carried out by ANOVA or KruskaleWallis tests, as appropriate, according to the Gaussian or non-Gaussian distribution of the data. Changes in each group were analyzed using one-way ANOVA or non-parametric tests. P-values<0.05 were considered statistically significant. All data are presented as means ± standard deviation (S.D.). 4. Results 4.1. Expression and location of miR-21 in cardiac tissue with DN and ARB intervention To identify the difference of miR-21 expression in cardiac tissue between NC group and DN control group, the expression of miR-21 was detected by real-time PCR at 24 weeks of age. The results showed that miR-21 expression of cardiac tissue was markedly increased in DN control group compared with NC group (Fig. 1A. P < 0.05). Next, to further determine the localization and distribution of miR-21 in the cardiac tissue by in situ hybridization(ISH), the results of ISH showed miR-21 was mainly localized in cardiac fibroblasts and at relatively low levels in cardiomyocytes at 24 weeks of age (Fig. 1B$P < 0.05), Double-labeled digoxigenin specific miR-21 probes showed strongly positive (blue cytoplasmic staining), whereas a scrambled probe serving as a negative control showed no signal. High-powered magnifications revealed that mature miR-21 is concentrated in cytoplasmic foci in the proximity of the nucleus, suggesting that miR-21 is actively involved in posttranscriptional regulation in cardiac fibroblasts (Fig. 1B, arrowhead indicated). In addition, to investigate the effect of ARB (Valsartan) on miR-21 expression in cardiac tissue and serum, DN mice were treated with ARB (10 mg/kg.day) for 8 weeks, Results of RT-PCR and ISH showed that ARB not only remarkably decreased miR-21 expression in cardiac tissue, but also decreased circulation serum miR-21(Fig. 1A,B,C$P < 0.05). Interestingly, the results of ISH were consistent with the results of RT-PCR. Taken together, our results showed that ARB suppressed miR-21 expression and that miR-21 may be involved in the mechanism of diabetic cardiomyopathy in DN mice. 4.2. Relationship between cardiac tissue miR-21 and diabetic related markers It was well known that many risk factors such as hyperglucose, hypertension, hyperlipidemia and proteinurina were associated with cardiac tissue (Maya and Villarreal, 2010). Therefore, to evaluate the relationship between cardiac miR-21 and diabetic related markers at 24 weeks of age, ACR, SBP, T-CHO, HbA1c were examined. The results showed that ACR, SBP, T-CHO and HbA1c were

significantly higher in DN control group than that in NC control group (P < 0.05), interestingly, cardiac miR-21 levels was positively correlated with ACR (r ¼ 0.875, P ¼ 0.005). Meantime, the levels of miR-21 in cardiac tissue was uncorrelated with SBP, HbA1C and TCho (data not shown). Next, to further evaluate the change of the above markers (ACR, SBP, T-CHO and HbA1c), we knockout endogenous miR-21 expression in cardiac tissue, DN mice were injected with miR-21 antagonist by tail-vein for 8 weeks, the results showed that ACR and miR-21 levels in cardiac tissue was markedly decreased (P < 0.05), in contrast, SBP, HbA1C and T-Cho was unchanged (p > 0.05). Taken together, our results demonstrated that the alteration of ACR indirectly reflected the levels of cardiac miR21 in the onset of micro-or macro-albumin stage of DN(See Fig. 2). 4.3. miR-21 directly down-regulated MMP-9 expression As described previously, miR-21 is ubiquitously involved in many organ and tissues fibrosis events such as kidney, liver, lung. MMP-9 is involved in the initiation and progression of fibrosis in DN (Wang et al., 2013). Therefore, to identify the relationship between miR-21 and MMP-9, firstly, the target of miR-21 was predicated by the bioinformatics analysis, the results showed that MMP9 was a potential target of miR-21, but not ECM proteins(FN and Col-IV)(Fig. 3A). Secondly, to further confirm whether MMP-9 was a validated target of miR-21, we performed the luciferase report gene assays. The results exhibited that wild-type luciferase(WT-luci)MMP-9-30 UTR reporter gene for luciferase activity was remarkably decreased compared with mutant type-luciferase(MT-luci)-MMP9-30 UTR reporter and control plasmid, suggested that MMP-9 was a validated miR-21 target (Fig. 3B, p < 0.05). Next, to testify the effect of miR-21 on MMP-9 protein, MCFs were transfected with miRcontrol, miR-21 over-expression (pre-miR-21) and miR-21 inhibitor lentivirus vector, the results of western blotting (WB) demonstrated that miR-21 over-expression significantly decreased MMP-9 protein expression compared with miR-control group and blank group. Conversely, miR-21 inhibitor can enhance MMP-9 expression (Fig. 3C. D. p < 0.05). Furthermore, MMP-9 protein was detected by Immunocytochemistry (ICC); the fluorescence intensity of MMP-9 protein was consistent with the results of WB. Taken together, the results demonstrated that MMP-9 was a validated miR-21 target, which directly down-regulated MMP-9 expression (Fig. 3E. F.p < 0.05). Thus, we concluded that miR-21 contributed to cardiac fibrosis by directly down-regulating MMP9 expression in micro-or macro-albumin stage of DN. 4.4. ARB (valsartan) reduced miR-21 expression in time and concentration in MCFs As described above, in vivo, ARB can inhibit cardiac tissue and serum miR-21 expression in DN mice, then, whether ARB affects miR-21 expression in mice cardiac fibroblasts (MCFs). Therefore, MCFs were treated with different concentration of ARB (109106mmol/l) for 48 h later, miR-21 expression was examined by RTPCR. Our results showed that ARB (valsartan) obviously inhibited miR-21 expression in the concentration-dependent manner (107105mmol/l), being significant at 107mmol/l (Fig. 1A p < 0.05), whereas, miR-21 expression was unchanged at the concentration of 109-108mmol/l (p > 0.05). Furthermore, MCFs were treated with ARB (107mmol/l) at different length of time (24, 36, 48, 60,72 h), the results showed that miR-21 expression was significantly decreased in ARB group compared with HG group at the time of 48 h (Fig. 1B p < 0.05). These results strongly suggested ARB can inhibit miR-21 expression in the time-and-concentrationdependent manner under hyperglycemic condition(See Fig. 4).

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

5

Fig. 1. Expression and location of miR-21 in cardiac tissue with DN. A. compared with NC group, RT-PCR results showed that miR-21 expression was markedly increased in DN control group at 24 weeks of age, after treatment of ARB, miR-21 expression was significantly decreased (P < 0.05). B. ISH results showed miR-21 was mainly localized in cardiac fibroblasts and at relatively low levels in cardiomyocytes at 24 weeks of age, miR-21 specific probes showed strongly positive (blue cytoplasmic staining), whereas a scrambled probe serving as a negative control showed no signal(no blue cytoplasmic staining). High-powered magnifications revealed that mature miR-21 is concentrated in cytoplasmic foci in the proximity of the nucleus (arrowhead indicated), suggesting that miR-21 is actively involved in posttranscriptional regulation in cardiac fibroblasts. C. serum miR-21 was markedly increased in DN control group compared with NC group at 24 weeks of age, after treatment of ARB, miR-21 expression was significantly decreased(P < 0.05).

4.5. ARB inhibited miR-21-induced ECM proteins (col-IV and FN) expression

4.6. ARB could ameliorate cardiac morphology and function by regulating miR-21 expression

As we described previously, miR-21 was mainly localized in cardiac fibroblasts in DN. MMP-9 was a validate target of miR-21, but not FN and Col-IV. to identify the effect of miR-21 expression on ECM proteins (col-IV and FN), firstly, MCFs were transfected with miR-control and miR-21 over-expression (pre-miR-21) lentivirus vector, the results that miR-21 over-expression increased colIV and FN mRNA and protein expression in vitro (Fig. 5A. B$P < 0.05). Furthermore, we testified the effect of ARB (107mmoll) on miR-21-induced col-IV and FN expression, before the transfection, MCFs were treated with 107mmol/l ARB for 48 h, and then the pre-miR-21 lentivirus vector was transfected into MCFs as the ARB þ pre-miR-21 group. After the transfection of the pre-miR-21 lentivirus vector, MCFs were treated with 107mmol/l ARB for 48 h as the pre-miR-21 þ ARB group. The results showed ARB could inhibit miR-21-induced col-IV and FN mRNA and protein expression before and after transfection in vitro (Fig. 5A. B. P < 0.05). Next, to identify whether ARB affected miR-21-induced col-IV and FN mRNA and protein in cardiac tissue, firstly, KK-Ay DN mice were injected with pre-miR-21 for 8 weeks later, col-IV and FN mRNA and protein were significantly increased in premiR-21 group compared with DN control group. Secondly, KK-Ay DN mice were treated with ARB plus pre-miR-21 lentivirus vector injection for 8 weeks, we found that ARB could inhibit miR-21induced col-IV and FN mRNA and protein expression in vivo. Taken together, our results showed that ARB inhibited col-IV and FN expression by inhibiting miR-21 expression by target MMP-9.

Excessive ECM deposition has been shown to increase myocardial stiffness and cardiac dysfunction (Kim et al., 2013). Collagen volume fraction (CVF) and Per-vascular collagen area (PVCA) were the sensitive morphological markers of cardiac fibrosis (Ide et al., 2017). Therefore, to evaluate whether ARB affected miR-21induced cardiac fibrosis in the proteinurina stage of DN, Firstly, miR-21 overexpression lentivirus vectors were injected by tail vein for 4 weeks, we found that miR-21 overexpression lentivirus vectors were mainly distributed in the heart and renal cortex and liver (at 24 weeks of age). Moreover, miR-21 expression was significantly decreased in the left ventricular tissue in ARB þ premiR-21 group compared with DN control group and pre-miR-21 group (Fiugue5. A, p < 0.05), suggested that ARB can inhibit mature miR-21 expression in vivo. Next, cardiac tissue morphology was observed by light microscopy and transmission electron microscope (TEM) at 24 weeks of age. Masson (blue) and Picro-sirius red (Yellow or orange) staining showed that the amount of collagen fibers were increased in DN control group and pre-miR-21 group (Fig. 6A. B.p < 0.05), the deposition of collagen fibers were significantly lower than in ARB þ premiR-21 group, compared with DN control group (Fig. 6C p < 0.05). In addition, Left ventricle mass index (LVMI) and heart weigh index (HWI), which were generally considered as markers of cardiac morphology, reflects cardiac hypertrophy. The alteration of LVMI and HWI were detected, LVMI and HWI were significantly higher in DN group than in NC group. In contrast, LVMI and HWI were markedly decreased in ARB þ premiR-21 group. Finally, N-terminal pro-brain natriuretic peptide (NT-pro-BNP) has been demonstrated to be a good clinical

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

6

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

Fig. 2. Relationship between cardiac tissue miR-21 and diabetic related markers at 24 weeks of age. A. cardiac miR-21 levels was positively correlated with ACR (r ¼ 0.875, P ¼ 0.005). B. compared with NC group, cardiac miR-21 was markedly increased in DN control group, and miR-21 antagonist can significantly reduce miR-21 levels in cardiac tissue. C. compared with NC group, ACR was markedly increased in DN control group, and miR-21 antagonist can significantly reduce ACR. D. HbA1C and T-Cho was markedly increased in DN control group compared with NC group, and miR-21 antagonist can't significantly reduce HbA1C and T-Cho levels.

predictor of cardiac function in patients with heart failure, to identify the cardiac function, we examined plasma concentration of NT-pro-BNP in each group, compared with NC group, plasma NTpro-BNP concentration is approximately 2e3 times higher in DN group and pre-miR-21 group (110 ± 12 ng/l.vs.49 ± 13 ng/l), in contrast, NT-pro-BNP was remarkably decreased in pre-miR-21 plus ARB group. Thus, we speculated that ARB can alleviate cardiac fibrosis and further ameliorate cardiac structure and function by partly inhibiting miR-21 expression in the proteinuria stage of DN. 5. Discussion Cardiac fibrosis with diabetic nephropathy is the final end point in diabetic cardiomyopathy (DCM). Patients with DCM show symptoms and signs of heart failure with no specific cause, such as coronary disease, hypertension, alcohol consumption, or other structural heart diseases has been identified (Chong et al., 2017). Although, it is becoming clear that cardiovascular complications in diabetic nephropathy result from multiple parameters including glucotoxicity, lipotoxicity, fibrosis, mitochondrial uncoupling, as well as enhanced oxidative stress (Mizamtsidi et al., 2016), the pathogenesis of cardiac fibrosis is complex and has not been well understood until recently. Recent studies have demonstrated an association between miR-21 and cardiac fibrosis, which is ubiquitously involved in the pathophysiological processes of cardiac fibrosis lead to cardiomyocyte hypertrophy and myocardial remodeling (Cavarretta and Condorelli, 2015). However, in the onset of micro-or macro-albumin stage of DN, whether miR-21 was involved in the mechanism of cardiac fibrosis with DN and ARB

ameliorates cardiac fibrosis by inhibiting miR-21 expression remains unclear. We found that miR-21 expression was markedly increased in DN. ISH showed miR-21 was mainly localized and distributed in cardiac fibroblasts and at relatively low levels in cardiomyocytes, which is concentrated in cytoplasmic foci in the proximity of the nucleus, suggesting that miR-21 is actively involved in posttranscriptional regulation in cardiac fibroblasts. In addition, ARB not only remarkably decreased miR-21 expression in cardiac tissue and circulation serum, but also inhibited miR-21 expression in time-and-concentration-dependent manner in vitro. More importantly, miR-21 over-expression increased col-IV and FN mRNA and protein expression in vitro, and ARB could inhibit miR-21-induced col-IV and FN mRNA and protein expression in vivo. Taken together, our results showed that ARB inhibited colIV and FN expression by inhibiting miR-21 expression. Thereby, we speculated that miR-21 may be involved in the mechanism of cardiac fibrosis with DN mice. Matrix metalloproteinases (MMPs) comprise a large multigene family of structurally and functionally homologous neutral proteinases that play a critically important role in extracellular matrix(ECM) turnover and are implicated in the pathogenesis of a variety of cardiovascular disease (Goffin et al., 2016). Recent studies have demonstrated a closely association between many miRs and MMP-9 (Asuthkar et al., 2012). For example, hyperoside can ameliorate glomerulosclerosis in DN by downregulating miR-21 to increase expression of MMP-9 (Zhang et al., 2016). The role of serum levels of microRNA-21 and matrix metalloproteinase-9 in patients with acute coronary syndrome (Darabi et al., 2016). Our previous research showed that MMP-9 is involved in the initiation and progression of renal fibrosis in DN (Wang et al., 2013). All these

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

7

Fig. 3. miR-21 directly down-regulated MMP-9 expression. A. Alignment of mmu-miR-21 with mouse MMP-9 30 -UTR based on targetScan software from (http://www.targetscan. org/) and (http://pictar.mdcberlin.de/), several nucleotides in the 50 -region of miR-21 contain a perfect match with the 30 -UTR sequence of the mouse MMP-9 genes. B. The results of luciferase report gene assays exhibited that wild-type luciferase(WT-luci)-MMP-9-30 UTR reporter gene for luciferase activity was remarkably decreased compared with mutant type-luciferase(MT-luci)-MMP-9-30 UTR reporter and control plasmid, suggested that MMP-9 was a validated miR-21 target. C. Representative Photograph band of MMP-9 by western blot demonstrated that miR-21 over-expression significantly decreased MMP-9 protein expression compared with miR-control group and blank group. Conversely, miR-21 inhibitor can enhance MMP-9 expression. D. The grey value of MMP-9 protein (P < 0.05). E. Representative photograph of MMP-9 protein by ICC. F. The fluorescence intensity of MMP-9 protein (p < 0.05).

Fig. 4. Effect of ARB on miR-21 expression in mice cardiac fibroblasts (MCFs). A. ARB (valsartan) could inhibit miR-21 expression in the concentration-dependent manner (107105mmol/l), being significant at 107mmol/l (p < 0.05), whereas, miR-21 expression was unchanged at the concentration of 109-108mmol/l (p > 0.05). B. ARB obviously inhibited miR-21 expression in time-dependent manner, peaking at 48 h (P < 0.05), whereas, miR-21 expression was unchanged at 24e36 h (p > 0.05).

researches showed that miR-21 and MMP-9 existed in a complex regulation relationship. However, miR-21 was how to regulate MMP-9 expression remain unclear in MCFs. In our experiment, to identify the relationship between miR-21 and MMP-9, bioinformatics analysis and luciferase report gene assays showed that

MMP-9 was a validated target of miR-21. Meantime, miR-21 overexpression significantly decreased MMP-9 expression in vitro. Conversely, miR-21 inhibitor can enhance MMP-9 expression. Taken together, our results demonstrated that MMP-9 was a validated miR-21 target, which directly down-regulated MMP-9

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

8

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

Fig. 5. ARB inhibited miR-21-induced col-IV and FN expression. A. miR-21 overexpression increased col-IV and FN mRNA expression, ARB could decrease col-IV and FN mRNA expression. B. Representative band of col-IV and FN by western blotting. C. Comparison of the grey value of col-IV and FN protein. D. Representative photograph of col-IV and FN protein in MCFs by ICC. E. The fluorescence intensity of col-IV and FN protein (p < 0.05). F. Representative immunohistochemical photograph for col-IV and FN. E. Quantitative analysis of col-IV and FN.

expression. Thus, we concluded that miR-21 contributed to cardiac fibrosis by directly down-regulating MMP-9 expression. Well-organized ECM proteins are necessary to maintain cardiac structural integrity. Excessive ECM deposition lead to the increase of myocardial stiffness, the decline of compliance, the cardiac dysfunction and heart failure (Kim et al., 2013). CVF and PVCA were the sensitive morphological markers of cardiac fibrosis (Ide et al., 2017). Left ventricle mass index (LVMI) and heart weigh index (HWI), which were generally considered as markers of cardiac morphology, reflects cardiac hypertrophy (Alfakih et al., 2004). However, it remained unclear whether ARB ameliorated cardiac structure by inhibiting miR-21 expression. In our experiment, to evaluate whether ARB affected miR-21-induced cardiac fibrosis in the proteinurina stage of DN, we found miR-21 expression was significantly decreased in the left ventricular tissue in DN and premiR-21 group, accompanied by the increase of col-IV, FN, the amount of collagen fibers, CVF, PVCA, LVM and HWI. More importantly, In contrast, LVMI and HWI were markedly decreased in ARB plus pre-miR-21 group in vivo. All these above results suggested that miR-21 overexpression increased amount of collagen fibers by

degrading MMP-9, and contributed to cardiac fibrosis and cardiac structural change. Thereby, limiting excessive ECM deposition represents an interesting therapeutic strategy to prevent fibrosis and maintain cardiac function in heart disease. Heart function depends on cardiac contraction and relaxation, which is determined both by systolic and diastolic cardiomyocyte function and by extracellular matrix (ECM) elasticity (Unsal et al., 2012). N-terminal pro-brain natriuretic peptide (NT-pro-BNP) has been demonstrated to be a good clinical predictor of cardiac function in patients with heart failure (Tesic et al., 2017). To identify the change of cardiac function with DN, we examined plasma concentration of NT-pro-BNP in each group, compared with NC group, plasma NT-pro-BNP concentration is approximately 2e3 times higher in DN group and pre-miR-21 group, in contrast, NT-pro-BNP was remarkably decreased in pre-miR-21 plus ARB group. In additional, cardiac miR-21 levels was positively correlated with ACR, at this time, we knockout endogenous miR-21 expression in cardiac tissue, the results showed that ACR and miR-21 levels in cardiac tissue was markedly decreased, suggesting that the alteration of ACR indirectly reflected the levels of cardiac miR-21 in the

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

9

Fig. 6. Effect of ARB on cardiac morphology and function by regulating miR-21 expression in vivo. A. miR-21 expression was significantly decreased in the left ventricular tissue in ARB þ premiR-21 group compared with DN control group and pre-miR-21 group. B. the change of left ventricle mass index (LVMI ¼ Left ventricular weight/body weight) and heart weigh index (HWI¼Heart heavy weight/body weigh).C. Representative photograph for Masson's trichrome staining (blue), Picro-sirius red staining (Yellow or orange) and transmission electron microscope (TEM), the deposition of collagen fibers (blue staining for Masson, Yellow or orange staining for Picro-sirius red staining) in each group (  400). D. Quantitative analysis of collagen fibers by Picro-sirius red and Masson staining. Collagen volume fraction (CVF ¼ myocardial collagen area/measured exposure area) and pervascular collagen area (PVCA ¼ collagen area around small artery lumen area/small artery lumen area). E. Plasma concentration of NT-pro-BNP in each group.

micro-or macro-albumin stage of DN. The result of ACR was consistent with the previous renal tissue miR-21 alteration (Wang et al., 2016). More interestingly, Albuminuria is independently associated with cardiac remodeling, abnormal left ventricular function, and worse outcomes in heart failure with preserved ejection fraction (Katz et al., 2014). Thus, we speculated that miR-21 levels in cardiac tissue can indirectly reflect cardiac function and ARB can alleviate cardiac fibrosis and further ameliorate cardiac structure and function by partly inhibiting miR-21 expression in the proteinuria stage of DN. 6. Conclusion In summary, our data demonstrated that miR-21 overexpression promoted cardiac fibrosis by target MMP-9 and ARB ameliorated cardiac structure and function by inhibiting miR-21 expression, and that miR-21 may be a new possible therapeutic target for ARB in cardiac fibrosis with DN. This study may provide novel insights into targets for prevention and treatment of cardiac fibrosis. Disclosures No conflicts of interest, financial or otherwise, are declared by the authors. Author contributions Author contributions: Jinyang Wang, Yanbin Gao and Lijun Duan

provided conception and design of research; Suhong wei, Siqin An and Shuhong Zhou performed experiments; Jing Liu and Liming Tian interpreted results of experiments; J.W. drafted manuscript; Yongming Liu, Shuhong Zhou and Yanbin Gao analyzed data; Lijun Duan and Shaocheng Wang edited and revised manuscript; Jinyang Wang approved final version of manuscript. Acknowledgments This study was supported by Grants from the National Natural Science Foundation of China (No.81560143, No. 81760147 and No. 81560254), Gansu Provincial Natural Science Foundation (17JR5RA038), Beijing Key Laboratory of TCM Collateral Disease Theory Research (2015ZYLB01) and Major National Basic Research Program of China (973 Program, No. 2012CB518602). References Alfakih, K., et al., 2004. Left ventricle mass index and the common, functional, Xlinked angiotensin II type-2 receptor gene polymorphism (-1332 G/A) in patients with systemic hypertension. Hypertension 43 (6), 1189e1194. Asuthkar, S., et al., 2012. Epigenetic regulation of miRNA-211 by MMP-9 governs glioma cell apoptosis, chemosensitivity and radiosensitivity. Oncotarget 3 (11), 1439e1454. Cao, W., Shi, P., Ge, J.J., 2017. miR-21 enhances cardiac fibrotic remodeling and fibroblast proliferation via CADM1/STAT3 pathway. BMC Cardiovasc Disord. 17 (1), 88. Cavarretta, E., Condorelli, G., 2015. miR-21 and cardiac fibrosis: another brick in the wall? Eur. Heart J. 36 (32), 2139e2141. Cheng, Y., Zhang, C., 2010. MicroRNA-21 in cardiovascular disease. J. Cardiovasc Transl. Res. 3 (3), 251e255.

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005

10

J. Wang et al. / Molecular and Cellular Endocrinology xxx (2017) 1e10

Choi, C.H., et al., 2012. Angiotensin II type I receptor and miR-155 in endometrial cancers: synergistic antiproliferative effects of anti-miR-155 and losartan on endometrial cancer cells. Gynecol. Oncol. 126 (1), 124e131. Chong, C.R., Clarke, K., Levelt, E., 2017 Feb 8. Metabolic remodeling in diabetic cardiomyopathy. Cardiovasc Res. https://doi.org/10.1093/cvr/cvx018 pii: 2977343. Darabi, F., et al., 2016. The role of serum levels of microRNA-21 and matrix metalloproteinase-9 in patients with acute coronary syndrome. Mol. Cell Biochem. 422 (1e2), 51e60. Diniz, G.P., et al., 2015. Cardiac microRNA-133 is down-regulated in thyroid hormone-mediated cardiac hypertrophy partially via Type 1 Angiotensin II receptor. Basic Res. Cardiol. 110 (5), 49. Garcia, R., et al., 2015. p-SMAD2/3 and DICER promote pre-miR-21 processing during pressure overload-associated myocardial remodeling. Biochim. Biophys. Acta 1852 (7), 1520e1530. Goffin, L., et al., 2016. Anti-MMP-9 antibody: a promising therapeutic strategy for treatment of inflammatory bowel disease complications with fibrosis. Inflamm. Bowel Dis. 22 (9), 2041e2057. Gul, R., et al., 2015. Regulation of cardiac miR-208a, an inducer of obesity, by rapamycin and nebivolol. Obes. (Silver Spring) 23 (11), 2251e2259. Gupta, S.K., et al., 2016. miR-21 promotes fibrosis in an acute cardiac allograft transplantation model. Cardiovasc Res. 110 (2), 215e226. Huang, W., et al., 2016. Combination of microRNA-21 and microRNA-146a attenuates cardiac dysfunction and apoptosis during acute myocardial infarction in mice. Mol. Ther. Nucleic Acids 5, e296. Ide, S., et al., 2017. Histological validation of cardiovascular magnetic resonance T1 mapping markers of myocardial fibrosis in paediatric heart transplant recipients. J. Cardiovasc Magn. Reson 19 (1), 10. Kaneko, M., et al., 2016. AT1 receptor blocker azilsartan medoxomil normalizes plasma miR-146a and miR-342-3p in a murine heart failure model. Biomarkers 1e8. Katz, D.H., et al., 2014. Albuminuria is independently associated with cardiac remodeling, abnormal right and left ventricular function, and worse outcomes in heart failure with preserved ejection fraction. JACC Heart Fail 2 (6), 586e596. Kim, J., et al., 2013. Effect of KIOM-79 on diabetes-induced myocardial fibrosis in zucker diabetic fatty rats. Evid. Based Complement. Altern. Med. 2013, 547653. Li, F., et al., 2015. Effects of hydrogen sulfide on myocardial fibrosis and MAPK1/3 and MMP-8 expression in diabetic rats. Nan Fang. Yi Ke Da Xue Xue Bao 35 (4), 549e552. Maeda, Y., et al., 2012. Chymase inhibition prevents myocardial fibrosis through the attenuation of NOX4-associated oxidative stress in diabetic hamsters. J. Diabetes Investig. 3 (4), 354e361. Maya, L., Villarreal, F.J., 2010. Diagnostic approaches for diabetic cardiomyopathy and myocardial fibrosis. J. Mol. Cell Cardiol. 48 (3), 524e529. Mizamtsidi, M., et al., 2016. Diabetic cardiomyopathy: a clinical entity or a cluster of molecular heart changes? Eur. J. Clin. Invest. 46 (11), 947e953. Nishi, S., et al., 2000. Ultrastructural characteristics of diabetic nephropathy. Med. Electron Microsc. 33 (2), 65e73. Obernosterer, G., Martinez, J., Alenius, M., 2007. Locked nucleic acid-based in situ

detection of microRNAs in mouse tissue sections. Nat. Protoc. 2 (6), 1508e1514. Roy, S., et al., 2009. MicroRNA expression in response to murine myocardial infarction: miR-21 regulates fibroblast metalloprotease-2 via phosphatase and tensin homologue. Cardiovasc Res. 82 (1), 21e29. Sansom, S.E., et al., 2010. miR-802 regulates human angiotensin II type 1 receptor expression in intestinal epithelial C2BBe1 cells. Am. J. Physiol. Gastrointest. Liver Physiol. 299 (3), G632eG642. Satoh, M., et al., 2015. Circulating Toll-like receptor 4-responsive microRNA panel in patients with coronary artery disease: results from prospective and randomized study of treatment with renin-angiotensin system blockade. Clin. Sci. (Lond) 128 (8), 483e491. Shen, L., et al., 2013. Feedback regulations of miR-21 and MAPKs via Pdcd4 and Spry1 are involved in arsenite-induced cell malignant transformation. PLoS One 8 (3), e57652. Shi, B., et al., 2017. miR-21 increases c-kitþ cardiac stem cell proliferation in vitro through PTEN/PI3K/Akt signaling. PeerJ 5, e2859. Takeuchi-Yorimoto, A., et al., 2016. MicroRNA-21 is associated with fibrosis in a rat model of nonalcoholic steatohepatitis and serves as a plasma biomarker for fibrotic liver disease. Toxicol. Lett. 258, 159e167. Tesic, M., et al., 2017. N-terminal pro-brain natriuretic peptide is related with coronary flow velocity reserve and diastolic dysfunction in patients with asymmetric hypertrophic cardiomyopathy. J. Cardiol. Unsal, A., et al., 2012. Relationship of fibroblast growth factor 23 with left ventricle mass index and coronary calcificaton in chronic renal disease. Kidney Blood Press Res. 36 (1), 55e64. Wang, J., et al., 2013. Effect of miR-21 on renal fibrosis by regulating MMP-9 and TIMP1 in kk-ay diabetic nephropathy mice. Cell Biochem. Biophys. 67 (2), 537e546. Wang, J.Y., et al., 2014. miR-21 overexpression enhances TGF-beta1-induced epithelial-to-mesenchymal transition by target smad7 and aggravates renal damage in diabetic nephropathy. Mol. Cell Endocrinol. 392 (1e2), 163e172. Wang, J., et al., 2016. Serum miR-21 may be a potential diagnostic biomarker for diabetic nephropathy. Exp. Clin. Endocrinol. Diabetes 124 (7), 417e423. Xiao, T., et al., 2015. Effects of hydrogen sulfide on myocardial fibrosis in diabetic rats: changes in matrix metalloproteinases parameters. Biomed. Mater Eng. 26 (1), S2033eS2039. Yan, M., et al., 2015. miR-21-3p regulates cardiac hypertrophic response by targeting histone deacetylase-8. Cardiovasc Res. 105 (3), 340e352. Yang, Q., Yang, K., Li, A., 2014. microRNA-21 protects against ischemia-reperfusion and hypoxia-reperfusion-induced cardiocyte apoptosis via the phosphatase and tensin homolog/Akt-dependent mechanism. Mol. Med. Rep. 9 (6), 2213e2220. Yang, F., et al., 2016. Effects of mir-21 on cardiac microvascular endothelial cells after acute myocardial infarction in rats: role of phosphatase and tensin homolog (PTEN)/Vascular endothelial growth factor (VEGF) signal pathway. Med. Sci. Monit. 22, 3562e3575. Zhang, L., et al., 2016. Hyperoside ameliorates glomerulosclerosis in diabetic nephropathy by downregulating miR-21. Can. J. Physiol. Pharmacol. 94 (12), 1249e1256.

Please cite this article in press as: Wang, J., et al., Angiotensin II receptor blocker valsartan ameliorates cardiac fibrosis partly by inhibiting miR21 expression in diabetic nephropathy mice, Molecular and Cellular Endocrinology (2017), https://doi.org/10.1016/j.mce.2017.12.005