- Email: [email protected]
Antibody Expression from the Core Region of the Human IgH Locus Reconstructed in Transgenic Mice Using Bacteriophage P1 Clones
GENOMICS
35, 405–414 (1996) 0379
ARTICLE NO.
Antibody Expression from the Core Region of the Human IgH Locus Reconstructed in Transgenic Mice Using Bacteriophage P1 Clones SIMON D. WAGNER, GIDEON GROSS,1 GRAHAM P. COOK, SARAH L. DAVIES, AND MICHAEL S. NEUBERGER2 MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, United Kingdom Received February 14, 1996; accepted May 7, 1996
Mice carrying transgenic human immunoglobulin gene miniloci can be used for the production of human monoclonal antibodies. The human variable region (V) gene segments in these miniloci undergo productive rearrangement in mouse lymphoid tissue to yield a population of B lymphocytes expressing a repertoire of antibodies. Many of the miniloci studied to date have included only a small number of germline gene segments in an artificially compact configuration. Here we describe the use of the bacteriophage P1 cloning system to create mice carrying the core region of the human immunoglobulin heavy chain (IgH) locus. Three P1 clones carrying overlapping regions of the human IgH locus (spanning the five JH-proximal VH segments, the entire DH and JH clusters, and the Cm and Cd constant regions) were injected into mouse eggs and appear to have reconstituted the core region of the locus (ú180 kb) following homologous recombination with each other. While this translocus yielded a titer of serum immunoglobulin similar to that obtained with a smaller plasmid-based minilocus, the P1-based locus gave rise to substantially greater diversification by somatic hypermutation. Such diversification is important for obtaining high-affinity antibodies. The results show the usefulness of the P1 system in facilitating the manipulation and recreation of large transgenes. q 1996 Academic Press, Inc.
INTRODUCTION
The introduction of large DNA molecules into the mouse germline forms the basis of a major approach to the production of human monoclonal antibodies (Bru¨ggemann et al., 1989, 1991; Bru¨ggemann and Neuberger, 1991; Davies et al., 1993; Green et al., 1994; Lonberg et al., 1994; Taylor et al., 1992, 1993; Wagner 1 Present address: Migal, Galilee Technological Center, Kiryat Shmona, Israel. 2 To whom correspondence should be addressed. Telephone: 44 1223 402245. Fax: 44 1223 412178.
et al., 1994a,b). Mouse lines that carry transgenic human immunoglobulin gene miniloci have been created; the immunoglobulin V, D, and J segments in these miniloci undergo productive rearrangement, yielding a repertoire of lymphocytes making antibodies with human polypeptide chains. Most such mice carry miniloci put together using bacterial plasmid vectors. This obviously limits the size of the miniloci that can be introduced into the mouse germline and may affect both the antibody repertoire that can be produced and its proper expression. Given that the human immunoglobulin heavy chain (IgH) locus is 1.5 Mb long (Hofker et al., 1989; Cook et al., 1994), other approaches need to be followed to create near locus-sized transgenes. We and others have previously described antibody expression from human immunoglobulin YACs introduced into the mouse genome. Thus, YACs were introduced into the mouse germline by the embryonic stem (ES) cell route, in which the DNA is introduced into the ES cells by lipofection (Choi et al., 1993; Strauss et al., 1993) or spheroplast fusion (Davies et al., 1993; Jakobovits et al., 1993). The transfected ES cells were then used to make blastocyst chimeras, and the chimeras were bred to obtain transmission through the mouse germline. An alternative, more direct strategy is the direct microinjection of purified YAC DNA into zygotes (Schedl et al., 1992, 1993), although technical difficulties have been encountered in obtaining purified, intact DNA from large YACs in concentrations sufficient for microinjection as well as in avoiding subsequent shearing (Gnirke et al., 1993; and our own experience). Here, we have examined the possibility of using bacteriophage P1 clones to reconstitute a core human IgH locus in transgenic mice. Phage P1 clones contain about 100 kb of inserted DNA and are propagated in Escherichia coli (Sternberg, 1990, 1994). DNA from these clones can be obtained in good yield and therefore in a high concentration suitable for direct microinjection. DNA from P1 clones is therefore more
405
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
gnma
AP: Genomics
406
WAGNER ET AL.
FIG. 1. Characterization of the YAC IgH1 bacteriophage P1 subclones. (a) Map of IgH1 YAC and three of the P1 clones derived from it. The EcoRI restriction map is taken from Shin et al. (1991). The end probes derived from the NotI and SalI sides of P128 are shown as gray bars. The degree of overlap was estimated by restriction mapping and Southern blotting using end probes. (b) PCR mapping of the three P1 clones for the presence of the four of the VH genes (VH4-4, VH1-3, VH1-2, and VH6-1), Cm (from the Cm1 to Cm3 exons), and Cd (the Cd1 exon and the most downstream Cd membrane exon, dM2) . The germline (i.e., unrearranged) V genes were amplified using primers within the V-intron and downstream of the heptamer and nonamer recombination signal sequences. The following primers were used: VH44BACK, 5*cccaagcttggtgcctctgatcccagggct and VH4-4FOR, 5*gctctagatctgggctcacactcacct; VH1-3BACK, 5*cccaagcttgaagccagtcaagggggcttc; VH1-2BACK, 5*cccaagcttgagtccagtccagggagatct; and a common primer VH1-2/3FOR, 5*gctctagaggggttttcacactgtgtc; VH6-1BACK, 5*cccaagctttcacagcagcattcacaga and VH6-1FOR, 5*ggaattcctgacttcccctcactgtg. Four exons of Cm were PCR amplified using CmBACK, 5*acctctgactcccttctcttga and CmFOR, 5*tgtgaacagagatggtg. Primers used to amplify the first exon of Cd were Cd1BACK, 5*cttgtcctcagagtttccagc and Cd1FOR, 5*gatctccggtgcgaccta. Primers used to amplify dM2 were dM2BACK, 5*tgtcactttcatcaaggtcag and dM2FOR, 5*cccttctctgcaggtaca. (c) Southern blot analysis to show overlap between P1 bacteriophage clones. End probes were derived from the central P1 clone (P128) and hybridized to P100, P128, and P195 DNA that had been digested with EcoRI.
readily prepared than that from YACs and is less prone to shearing. The fact that P1 clones are smaller than YACs is also, of course, one of their limitations, since they are less obviously suitable for the creation of large transgenic loci. However, we show that the core region of the human IgH locus can be reconstructed in mice by co-injecting three overlapping P1 clones. Analogous to what has been noted by others on injecting overlapping DNA fragments from plasmid-based vectors into mouse zygotes (Pieper et al., 1992; Lonberg and Huszar, 1995), the P1 clones appear to have recombined homologously with each. They have incorporated into the mouse genome, yielding a mouse strain that carries a minimum of 180 kb of the core region of the human IgH locus (including five VH genes, the DH locus, and the JH cluster linked to the m and d C-regions). The VH gene segments in this reconstituted ‘‘translocus’’ undergo productive rearrangement and somatic hypermuta-
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
tion in mouse lymphoid tissue, yielding animals that indeed produce repertoires of antigen-specific antibodies on antigen challenge. MATERIALS AND METHODS Subcloning into P1 bacteriophage. A YAC containing fiveVH genes (VH2-5, VH4-4, VH1-3, VH1-2, and VH6-1), D segments, J segments, Cm and Cd, all on a contiguous section of 250 kb of DNA, was isolated from the St. Louis YAC human genomic library using a PCR screening strategy described previously (Walter et al., 1993). Total DNA from the yeast cells containing the IgH YAC was partially digested by Sau3AI and cloned into the BamHI site of P1 bacteriophage vector pAd10sacBII (Pierce et al., 1992). Screening of the P1 library was carried out with probes for Cm, Cd, J segments, D segments, and the VH genes. A total of 10 YAC-derived P1 clones were obtained, of which 3 were used for subsequent work. These 3 overlapping clones (P100, P128, P195) span the entire original YAC as shown by restriction mapping and Southern blot analysis using end probes derived from the SP6 and T7 promoters flanking the BamHI site of pAD10sacBII.
gnma
AP: Genomics
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES Purification, analysis, and microinjection of DNA. One hundred milliliters of bacterial culture was grown overnight with 50 mg/ml kanamycin and DNA extracted by alkaline lysis following IPTG induction (Pierce and Sternberg, 1992). To obtain the insert, clone P100 was digested with NotI / SalI, clone P128 with BsiWI / NotI, and clone P195 with NruI. The digested DNA was embedded in agarose and run on a pulse-field gel at 160 V with a 30-s pulse time overnight. The insert was cut out, digested with agarase, and concentrated. Purified insert DNA from all three clones was mixed together at a concentration of 2 ng/ml each and used directly for microinjection. Mice were screened for integration of P1 clones by Southern blotting using a human Cm probe as well as by ELISA for expression of human m chains in serum. Analysis of P1 clone integration. End probes were derived from the central P1 clone (P128) using a PCR-based method. Thus, DNA from P128 was restricted with either AluI or RsaI, and a double-stranded linker (Riley et al., 1990) was ligated. PCR was carried out using a linker-specific primer and a primer specific for either the NotI side (5*gaaaatgacccagagcgctgc) or the SalI side (5*ctgccagaagtgcagtcg) of pAD10sacBII. The fragments obtained were about 1 kb (NotI end) and 0.5 kb (SalI end) and were used for probing Southern blots. Isolation and analysis of Peyer’s patch B cells. Peyer’s patches were dissected from the mouse ileum and pressed through a cell strainer, and the cells were washed in PBS/1% BSA (Gonza´lez-Ferna´ndez and Milstein, 1993). The pellet was resuspended in 120 ml of the same solution and incubated with a phycoerythrin-conjugated antiCD45R antibody (RA3-6B2; Immunoselect) and FITC-conjugated peanut agglutinin (PNA; Sigma) for 30 min at 47C. After washing in PBS, the cells were again passed through a cell strainer, and the CD45(B220)/ PNAhigh (germinal center B cell) population was sorted using a FACStarPlus (Becton–Dickinson, Mountain View, CA). DNA was extracted from the sorted cells by proteinase K digestion, and PCR was carried out using a JH consensus primer (Marks et al., 1991) and a primer specific for the leader V-intron of VH6-1 (5*cccaagctttcacagcagcattcacaga), VH4-4 (5*cccaagcttggtgcctctgatccc-agggct), or VH1-2 (5*cccaagcttgagtccagtccagggagatct). Immunization and ELISA. Animals (3–4 months old) were primed intraperitoneally with 2-phenyl-oxazol-5-one (phOx) coupled to chicken serum albumin (100 mg of alum-precipitated phOx14 –CSA / 109 heat-inactivated Bordetella pertussis). Boosting was carried out 6 weeks later. Antigen-specific titers were measured on plates coated with phOx14 –CSA (5 mg/ml), detecting with biotinylated rabbit anti-human m (Jackson).
RESULTS
P1 clones. A YAC containing the core region of the human IgH locus was isolated from a human peripheral blood cell library using PCR to screen pools of yeast transformants. This YAC, which we designate IgH1, was characterized by pulsed-field gel electrophoresis, restriction fragmentation, and Southern blotting with a variety of probes. The resultant map is depicted in Fig. 1a. Following partial Sau3A digestion, this YAC was subcloned into a bacteriophage P1 vector (Fig. 1a). As expected from the restriction mapping, PCR analysis (Fig. 1b) confirmed that clone P100 contains the Cm and Cd constant region including the d membrane exons, clone P128 contains VH6-1, and clone P195 contains VH4-4, VH1-3, and VH1-2. [Clone P195 also includes the most 5* VH gene present on IgH1 YAC, VH25 (see below).] End probes were derived from the central P1 clone (P128) and used to show that there is overlap between it and both the upstream (P195) and downstream (P100) P1 clones (Fig. 1c). Thus, the three P1 clones span the starting IgH1 YAC.
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
407
Mice with P1-derived IgH transgenes. The DNA from the individual P1 clones was purified from a pulsed-field gel (Fig. 2a) and used for microinjection. Mice were screened by Southern blot analysis of tail DNA with a human Cm probe and by testing for human m chains in serum by ELISA. Two founder mice were obtained (HuIgHP-1 and HuIgHP-2) from the 16 screened. PCR analysis of tail DNA revealed that HuIgHP-1 contains none of the VH segments found on P195, but it does have VH6-1, Cm, and Cd. In contrast, HuIgHP1-2 contained sequences from all three P1 clones (Fig. 2b) and indeed is positive for all the probes derived from the three P1 clones for which we have screened. In subsequent breeding of the HuIgHP-2 animals, we have not observed segregation of the P1 clones, suggesting that they have co-integrated. To assess whether this co-integration had occurred following homologous recombination between the sequence overlaps of the three P1s, tail DNA from HuIgHP-2 mice was digested with restriction enzymes and blotted with probes derived from the 5* and 3* ends of the central P1 clone, P128. The fragment sizes detected in the HuIgHP-2 tail DNA are similar to those obtained from the IgH1 YAC (and not from the isolated P128 DNA itself; Fig. 2c), suggesting that the P1 clones in HuIgHP-2 have undergone homologous recombination, presumably prior to integration. The transgene integration was also analyzed by pulse-field gel electrophoresis as well as by Southern blotting to determine the copy number of human Cm sequences integrated. The results (Figs. 2d and 2e) suggest that a single copy of a contiguous stretch of about 200 kb of human IgH locus DNA has been reconstructed in the mouse germline. Rearrangement. We screened for DH –JH rearrangements in the transgenic loci using a PCR assay asking whether the JH-proximal D segment (DQ52) rearranged to a member of the JH cluster. Despite this proximity to the JH cluster, no such rearrangements were found in HuIgHP-1 mice. However, HuIgHP-2 animals showed DQ52–JH rearrangements in both spleen and thymus (Fig. 3a); this is similar to what occurs with D–JH rearrangements of the endogenous mouse IgH locus (Forster et al., 1980; Kemp et al., 1980; Kurosawa et al., 1981; Mizutani et al., 1986). For further work, we focused on HuIgHP-2 animals and used PCR to demonstrate that all five VH genes could rearrange to the JH cluster in their lymphoid tissue (Fig. 3b). Expression. Antibody containing human m chains was detectable by ELISA in the serum of HuIgHP-2 but not HuIgHP-1 animals. The titer, however, is relatively low (Table 1). We suspected that this was because most B cells in the HuIgHP-2 mice would be expressing mouse rather than human m chains. This prediction was confirmed by immunofluorescence analysis (Fig. 4a). Indeed, only 1–2% of the LPS-blasted splenic B cells make human m chains, and most of these cells coexpress mouse m since nearly all the B cell blasts are mouse m/. A similar result was obtained by analyzing
gnma
AP: Genomics
408
WAGNER ET AL.
FIG. 2. The human IgH DNA integration in the transgenic mice. (a) Ethidium bromide-stained pulse-field gel showing the inserts of the three P1 bacteriophage clones used for microinjection. (b) PCR to show the extent of microinjected DNA present in the two transgenic mouse lines. PCR using primers as in Fig. 1b was carried out on tail DNA. (c) Southern blot analysis probing EcoRI-digested DNA with the 5* and 3* probes described in Fig. 1b, indicating homologous recombination between the microinjected P1 clones. (d) Southern blot analysis probing EcoRI-digested DNA with a human Cm probe. The samples (10 mg total DNA) are either HuIgHP-2 tail DNA or normal mouse tail DNA spiked with various amounts of P1-100 DNA so as to give the equivalent of 8, 4, 2, 1, or 0.5 human m genes per haploid mouse genome. (e) Pulse-field gel analysis of spleen DNA from HuIgHP-2 mice, digested with BssHII and SfiI and probed with a JH probe. Size markers were provided by a l ladder.
AID
Genom 4210
/
6r19$$4210
07-12-96 12:02:35
gnma
AP: Genomics
409
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES
FIG. 3. Rearrangement of the human VH , D, and JH segments. (a) Southern blot analysis for DQ52/JH rearrangements. Spleen (S) and thymus (T) DNA from founder transgenic animals (HuIgHP-1 and HuIgHP-2) was used as template for the PCR amplification of DQ52/JH rearrangements. DNA from wildtype mice (WT) and from human tonsil (Ton) provided controls. Primers were DQ52BACK, 5*tataggatccagccccacaggccccctaccagccgc and a JH consensus (Marks et al., 1991). The Southern blot was hybridized with a DQ52 oligonucleotide probe. (b) Southern blot analysis showing that all five VH genes are capable of rearrangement to JH . Spleen DNA from HuIgHP-2 and wildtype animals was compared with human tonsil. VH-specific DNA primers (as described in Fig. 1b) were used in separate reactions in combination with a JH consensus (Marks et al., 1991). Probes were derived by PCR amplification of the unrearranged VH genes from the DNA of the IgH1 YAC P1 subclones.
hybridomas, where two of three human m-expressing hybrids coexpressed mouse m. Thus, either (i) productive rearrangement of the HuIgHP-2 translocus does not yield a sufficiently high abundance of human mm to feedback inhibit rearrangement of the endogenous mouse IgH locus or (ii) productive rearrangement of the HuIgHP-2 translocus occurs after the endogenous locus has been rearranged and is insensitive to feedback regulation from it. The HuIgHP-2 translocus rescues B cell development in mMT mice. To assess the performance of the Hu-
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
IgHP-2 translocus in the absence of a functional mouse IgH locus, we crossed the HuIgHP-2 animals with mMT/ mMT mice. The mMT mutation is a targeted disruption in the membrane exon of mouse Cm that leads to a block in B cell development (Kitamura et al., 1991) that can, however, be overcome by providing an exogenous, transgenic IgH locus (Wagner et al., 1994b). HuIgHP-2 animals were crossed with mMT/mMT mice and then backcrossed to achieve homozygosity at the mMT locus. Provision of the HuIgHP-2 locus indeed rescues B cell development, as judged by the restoration of serum immunoglobulin (Table 1). Essentially all the B cells then expressed human m chains on their surface (Fig. 4b), although the total number of B cells was restored to only about one-third of wildtype levels and indeed the spleen sizes of the HuIgHP-2 mMT/mMT mice were about half of normal. It is interesting to compare this dramatic but nevertheless incomplete restoration of B cell development and serum immunoglobulin production to what we and others previously obtained with smaller plasmid-based human IgH (HuIgH) miniloci (Table 1; and Lonberg et al., 1994; Wagner et al., 1994b). The results are essentially similar, although it is notable that, regarding the criteria of expression analyzed here, the HuIgHP-2 translocus shows no advantage over the more compact miniloci. Antibody response. Clearly, to be useful, it is not sufficient for the translocus simply to give rise to serum IgM; it must be able to yield a sufficient diversity of antibodies in response to antigen challenge. Immunization of HuIgHP-2 mMT/mMT mice with the hapten phOx coupled to chicken serum albumin elicited a significant antigen-specific response, although its magnitude was somewhat less than that from normal mice (Fig. 5). Antibody diversity. To study the antibody heavychain diversity that could be generated from the HuIgHP-2 translocus, we sequenced VH rearrangements that had been PCR amplified from sorted germinal center B cells from Peyer’s patches. The rearrangements were amplified using a VH-specific primer together with a JH-consensus oligonucleotide, since this would allow us to analyze the contribution of both junctional/combiTABLE 1 Concentration of Serum Antibody with Human m Chains Background
mMT / mMT mMT
HuIgHP-2 mice (P1-based) 5 { 33 180 { 80
HuIgH mice (Plasmid-based) 7{
Normal mice
4
õ0.01
330 { 150
õ0.01
Note. Titers (mg/ml) are given as the means with the range determined from 10 animals for each group. The results for HuIgH mice are from Wagner et al. (1994b). Normal adult human serum IgM concentration is 0.5–1.9 mg/ml.
gnma
AP: Genomics
410
WAGNER ET AL.
natorial diversity and somatic hypermutation. The results (Figs. 6 and 7) show that the translocus gives rise to appreciable diversity by both gene rearrangement and somatic hypermutation. Thus, with regard to rearrangement, substantial diversity is achieved by the use of multiple D (as well as VH and JH) segments, and there is extensive junctional variation caused by Nregion/P-nucleotide insertion. Further diversification has been achieved by somatic hypermutation (Fig. 7), which is clearly making a substantial contribution to the antibody repertoire. This contrasts with results that we previously obtained with a plasmid-based minilocus where hypermutation, although detectable folFIG. 5. Antibody responses from HuIgHP-2 mMT/mMT mice. Serum responses to immunization with a hapten. Mice [three HuIgHP-2 mMT/mMT (shaded columns) and three wildtype (open columns) animals] were immunized with 100 mg of alum-precipitated phOx–CSA on Day 0 (arrow). Specific serum responses were measured by ELISA, and the titers are given as the negative log10 of the serum dilution that gave half-maximal reading in the ELISA.
lowing extensive antigen challenge, made a far smaller contribution to antibody diversity, as judged by PCR sequence analysis of germinal center B cells from Peyer’s patches (Wagner et al., 1994a). DISCUSSION
FIG. 4. Expression of human m chains in HuIgHP-2 mMT/mMT B cells. (a) Flow cytometry profiles of splenic B cell surfaces stained for human m chains. Spleen cells from HuIgHP-2 mMT/mMT (thick line), HuIgH mMT/mMT (thin line), and a normal (C57BL/6 1 CBA)F1 mouse (thin line showing a negative population) were stained with FITC-conjugated anti-human m antiserum (Jackson) and phycoerythrin-conjugated anti-CD45RO(B220) (Immunoselect; to identify B cells); the profiles show the anti-human m staining on those cells gated as CD45RO/. (b) Immunofluorescence analysis of HuIgHP-2 mMT// spleen cells that have been cultured in the presence of bacterial lipopolysaccharide for 3 days prior to staining with FITC-conjugated anti-human m antiserum (Jackson) and or biotinylated antimouse m antiserum (Southern Biotech) and Streptavidin–Texas red (Jackson).
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
The results presented here show that it is possible to reconstruct the core part of the human IgH locus (a region of some 200 kb) by co-injecting three P1 clones that appear to have recombined homologously—presumably prior to integration. While the HuIgHP-2 translocus does not yield higher levels of serum immunoglobulin than we have previously obtained from plasmid-based miniloci (Bru¨ggemann et al., 1989, 1991; Bru¨ggemann and Neuberger, 1991), it does give rise to a much greater antibody diversity. Part of this is due to much increased germline diversity: the translocus contains five VH segments and essentially the whole human DH repertoire (currently estimated as some 25 to 30 segments; Buluwela et al., 1988; Ichihara et al., 1988a,b; Siebenlist et al., 1981) compared to the two VH segments (one of which was used preferentially) and only four DH segments on our plasmid-based minilocus (Wagner et al., 1994a,b). However, a further, possibly more important, difference is the contribution of somatic hypermutation. Whereas we and others have detected somatic hypermutation of plasmid-based miniloci (Taylor et al., 1993; Wagner et al., 1994a), the contribution of hypermutation to diversification of the P1-based locus is considerably greater than was observed for our plasmid-based minilocus, as judged by an analysis of V gene sequences from germinal centers. It will therefore be of interest to dissect the HuIgHP-2 translocus to ascertain whether it contains cis-acting sequences that enhance hypermutation. This strategy could be used for the reconstitution of other gene loci in transgenic mice, the particular
gnma
AP: Genomics
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES
411
FIG. 6. Junctional and combinatorial diversity of IgH chains from HuIgHP-2 mice. The junctional sequences (VH –D–JH border) of translocus-derived VH rearrangements cloned following PCR amplification from the Peyer’s patch germinal center cells of HuIgHP-2 mMT/ mMT mice. In cases in which they can be identified, sequences derived from germline D segments (identified on the right side) are underlined. Germline D segment sequences were obtained from (Forster et al., 1980; Ichihara et al., 1988a,b; Siebenlist et al., 1981) and S. Corbett (Cambridge, UK, pers. comm.). The amplification was carried out using VH-specific primers and a JH consensus (legend to Fig. 3b).
07-12-96 12:02:35
gnma
AP: Genomics
412
WAGNER ET AL.
FIG. 7. Contribution of somatic hypermutation to IgH chain diversity in HuIgHP-2 mice. (a) The proportions of VH1-2, VH4-4, and VH61 sequences with 0, 1, 2, 3, etc., mutations are shown as pie charts. The VH1-2 and VH4-4 sequences (13 and 19 sequences, respectively) all derive from clonally unrelated B cells as witnessed by the fact that all the sequences differ at the VH –D–JH border. In contrast, analysis of the VH –D–JH border suggests that the 30 VH6-1 sequences may derive from only 14 distinct clonally expanded B cell dynasties (see b). (b) The sequences of the mutated VH1-2, VH4-4, and VH6-1 segments amplified from the germinal center B cells. Only those codon positions harboring mutations are indicated.
attraction being that P1 DNA is easily purified in good yield and can be microinjected without severe problems of DNA shearing. ACKNOWLEDGMENTS We thank David Gilmore and Andrew Riddell for flow cytometry, Theresa Langford and Gareth King for help with animal breedings, Simon Corbett and Ian Tomlinson for providing unpublished data on IgH gene maps, and Daisuke Kitamura and Klaus Rajewsky for
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
the mMT mice. This work was supported in part by a grant from the Leukaemia Research Fund (M.S.N. and S.D.W.). G.P.C. and G.G. were supported by fellowships from the Beit Memorial Trust and EMBO, respectively. S.L.D. was supported by an International Research Scholar’s award from the Howard Hughes Medical Institute to M.S.N.
REFERENCES Bru¨ggemann, M., Caskey, H. M., Teale, C., Waldmann, H., Williams, G. T., Surani, A., and Neuberger, M. S. (1989). A repertoire of
gnma
AP: Genomics
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES monoclonal antibodies with human heavy chains from transgenic mice. Proc. Natl. Acad. Sci. USA 86: 6709–6713. Bru¨ggemann, M., and Neuberger, M. S. (1991). Generation of antibody repertoires in transgenic mice. Methods 2: 159–165. Bru¨ggemann, M., Spicer, C., Buluwela, L., Rosewell, I., Barton, S., Surani, M. A., and Rabbitts, T. H. (1991). Human antibody production in transgenic mice: Expression from 100 kb of the human IgH locus. Eur. J. Immunol. 21: 1323–1326. Buluwela, L., Albertson, D. G., Sherrington, P., Rabbitts, P. H., Spurr, N., and Rabbitts, T. H. (1988). The use of chromosomal translocations to study human immunoglobulin gene organization: Mapping DH segments within 35 kb of the Cm gene and identification of a new DH locus. EMBO J. 7: 2003–2010. Choi, T. K., Hollenbacj, P. W., Pearson, B. E., Ueda, R. M., Weddell, G. N., Kurahara, C. G., Woodhouse, C. S., Kay, R. M., and Loring, J. F. (1993). Transgenic mice containing a human heavy chain immunoglobulin gene fragment cloned in a yeast artificial chromosome. Nature Genet. 4: 117–123. Cook, G. P., Tomlinson, I. M., Walter, G., Riethman, H., Carter, N. P., Buluwela, L., Winter, G., and Rabbitts, T. H. (1994). A map of the human immunoglobulin VH locus completed by analysis of the telomeric region of chromosome 14q. Nature Genet. 7: 162– 168. Davies, N. P., Rosewell, I. R., Richardson, J. C., Cook, G. P., Neuberger, M. S., Brownstein, B. H., Norris, M. L., and Bru¨ggemann, M. (1993). Creation of mice expressing human antibody light chains by introduction of a yeast artificial chromosome containing the core region of the human immunoglobulin k locus. BioTechnology 11: 911–914. Forster, A., Hobart, M., Hengartner, H., and Rabbitts, T. H. (1980). An immunoglobulin heavy-chain gene is altered in two T-cell clones. Nature 286: 897–899. Gnirke, A., Huxley, C., Peterson, K., and Olson, M. V. (1993). Microinjection of intact 200 to 500 kb fragments of YAC DNA into mammalian cells. Genomics 15: 659–667. Gonza´lez-Ferna´ndez, A., and Milstein, C. (1993). Analysis of somatic hypermutation in mouse Peyer’s patches using immunoglobulin k light chain transgene. Proc. Natl. Acad. Sci. USA 90: 9862–9866. Green, L. L., Hardy, M. C., Maynard-Currie, C. E., Tsuda, H., Louie, D. M., Mendez, M. J., Abderrahim, H., Noguchi, M., Smith, D. H., Zeng, Y., David, N. E., Sasai, H., Garza, D., Brenner, D. G., Hales, J. F., McGuinness, R. P., Capon, D. J., Klapholz, S., and Jakobovits, A. (1994). Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs. Nature Genet. 7: 13–21. Hofker, M. H., Walter, M. A., and Cox, D. W. (1989). Complete physical map of the human immunoglobulin heavy chain constant region gene complex. Proc. Natl. Acad. Sci. USA 86: 5567–5571. Ichihara, Y., Abe, M., Yasui, H., Matsuoka, H., and Kurosawa, Y. (1988a). At least five DH genes of human immunoglobulin heavy chains are encoded in 9-kilobase DNA fragments. Eur. J. Immunol. 18: 649–652. Ichihara, Y., Matsuoka, H., and Kurosawa, Y. (1988b). Organization of human immunoglobulin heavy chain diversity gene loci. EMBO J. 7: 4141–4150. Jakobovits, A., Moore, A. L., Green, L. L., Vergara, G. J., MaynardCurrie, C. E., Austin, H. A., and Klapholz, S. (1993). Germ-line transmission and expression of a human-derived yeast artificial chromosome. Nature 362: 255–258. Kemp, D. J., Harris, A. W., Cory, S., and Adams, J. W. (1980). Expression of the immunoglobulin Cm gene in mouse T and B lymphoid and myeloid cell lines. Proc. Natl. Acad. Sci. USA 77: 2876–2880. Kitamura, D., Roes, J., Ku¨hn, R., and Rajewsky, K. (1991). A B cell deficient mouse by targeted disruption of the membrane exon of the immunoglobulin m chain. Nature 350: 423–426. Kurosawa, Y., von Boehmer, H., Haas, W., Sakano, H., Trauneker, A., and Tonegawa, S. (1981). Identification of D segments of immu-
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
413
noglobulin heavy-chain genes and their rearrangement in T lymphocytes. Nature 290: 565–570. Lonberg, N., and Huszar, D. (1995). Human antibodies from transgenic mice. Int. Rev. Immunol. 13: 65–93. Lonberg, N., Taylor, L. D., Harding, F. A., Trounstine, M., Higgins, K. M., Schramm, S. R., Kuo, C.-C., Mashayekh, R., Wymore, K., McCabe, J. G., Munoz-O’Regan, D., O’Donnell, S. L., Lapachet, E. S. G., Bengoechea, T., Fishwild, D. M., Carmack, C. E., Kay, R. M., and Huszar, D. (1994). Antigen-specific human antibodies from mice comprising four distinct genetic modifications. Nature 368: 856–859. Marks, J. D., Hoogenboom, H. R., Bonnert, T. P., McCafferty, J., Griffiths, A. D., and Winter, G. (1991). By-passing immunization: Human antibodies from V-gene libraries displayed on phage. J. Mol. Biol. 222: 581–597. Mizutani, S., Ford, A. M., Wiedemann, L. M., Chan, L. C., Furley, A. J. W., Greaves, M. F., and Molgaard, H. V. (1986). Rearrangement of immunoglobulin heavy chain genes in human T leukaemic cells shows preferential utilization of the D segment (DQ52) nearest to the J region. EMBO J. 5: 3467–3473. Pieper, F. R., de Wit, I. C. M., Pronk, A. C. J., Kooiman, P. M., Strijker, R., Krimpenfort, P. J. A, Nuyens, J. H., and de Boer, H. A. (1992). Efficient generation of functional transgenes by homologous recombination in murine zygotes. Nucleic Acids Res. 20: 1259–1264. Pierce, J. C., and Sternberg, N. L. (1992). Using bacteriophage P1 system to clone high molecular weight genomic DNA. Methods Enzymol. 216: 549–574. Pierce, J. C., Sauer, B., and Sternberg, N. (1992). A positive selection vector for cloning high molecular weight DNA by the bacteriophage P1 system: Improved cloning efficiency. Proc. Natl. Acad. Sci. USA 89: 2056–2060. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887–2890. Schedl, A., Beerman, F., Thies, E., Montoliu, L., Kelsey, G., and Schutz, G. (1992). Transgenic mice generated by pronuclear injection of a yeast artificial chromosome. Nucleic Acids Res. 20: 3073– 3077. Schedl, A., Montoliu, L., Kelsey, G., and Schu¨tz, G. (1993). A yeast artificial chromosome covering the tyrosinase gene confers copy number-dependent expression in transgenic mice. Nature 362: 258–261. Shin, E. K., Matsuda, F., Nagaoka, H., Fukita, Y., Imai, T., Yokoyama, K., Soeda, E., and Honjo, T. (1991). Physical map of the 3* region of the human immunoglobulin heavy chain locus: Clustering of autoantibody-related variable segments in one haplotype. EMBO J. 10: 3641–3645. Siebenlist, U., Ravetch, J. V., Korsmeyer, S., Waldmann, T., and Leder, P. (1981). Human immunoglobulin D segments encoded in tandem multigenic families. Nature 294: 631–635. Sternberg, N. (1990). Bacteriophage P1 cloning system for the isolation, amplification, and recovery of DNA fragments as large as 100 kilobase pairs. Proc. Natl. Acad. Sci. USA 87: 103–107. Sternberg, N. (1994). The P1 cloning system: Past and future. Mamm. Genome 5: 397–404. Strauss, W. M., Dausman, J., Beard, C., Johnson, C., Lawrence, J. B., and Jaenisch, R. (1993). Germline transmission of a yeast artificial chromosome spanning the murine a1(I) collagen locus. Science 259: 1904–1907. Taylor, L. D., Carmack, C. E., Huszar, D., Higgins, K. M., Mashayekh, R., Sequar, G., Schramm, S. R., Kuo, C.-C., S.L., O., Kay, R. M., Woodhouse, C. S., and Lonberg, N. (1993). Human immunoglobulin transgenes undergo rearrangement, somatic mutation and class switching in mice that lack endogeneous IgM. Int. Immunol. 6: 579–591.
gnma
AP: Genomics
414
WAGNER ET AL.
Taylor, L. D., Carmack, C. E., Schramm, S. R., Mashayekh, R., Higgins, K. M., Kuo, C.-C., Woodhouse, C., Kay, R. M., and Lonberg, N. (1992). A transgenic mouse that expresses a diversity of human sequence heavy and light chain immunoglobulins. Nucleic Acids Res. 20: 6287–6295. Wagner, S. D., Popov, A. V., Davies, S. L., Xian, J., Neuberger, M. S., and Bru¨ggemann, M. (1994a). The diversity of antigen specific monoclonal antibodies from transgenic mice bearing human immunoglobulin gene miniloci. Eur. J. Immunol. 24: 2672–2681.
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
Wagner, S. D., Williams, G. T., Larson, T., Neuberger, M. S., Kitamura, D., Rajewsky, K., Xian, J., and Bru¨ggemann, M. (1994b). Antibodies generated from human immunoglobulin miniloci in transgenic mice. Nucleic Acids Res. 22: 1389–1393. Walter, G., Tomlinson, I. M., Cook, G. P., Winter, G., Rabbitts, T. H., and Dtar, P. H. (1993). HAPPY mapping of a YAC reveals alternative haplotypes in the human immunoglobulin VH locus. Nucleic Acids Res. 21: 4524–4529.
gnma
AP: Genomics
35, 405–414 (1996) 0379
ARTICLE NO.
Antibody Expression from the Core Region of the Human IgH Locus Reconstructed in Transgenic Mice Using Bacteriophage P1 Clones SIMON D. WAGNER, GIDEON GROSS,1 GRAHAM P. COOK, SARAH L. DAVIES, AND MICHAEL S. NEUBERGER2 MRC Laboratory of Molecular Biology, Hills Road, Cambridge CB2 2QH, United Kingdom Received February 14, 1996; accepted May 7, 1996
Mice carrying transgenic human immunoglobulin gene miniloci can be used for the production of human monoclonal antibodies. The human variable region (V) gene segments in these miniloci undergo productive rearrangement in mouse lymphoid tissue to yield a population of B lymphocytes expressing a repertoire of antibodies. Many of the miniloci studied to date have included only a small number of germline gene segments in an artificially compact configuration. Here we describe the use of the bacteriophage P1 cloning system to create mice carrying the core region of the human immunoglobulin heavy chain (IgH) locus. Three P1 clones carrying overlapping regions of the human IgH locus (spanning the five JH-proximal VH segments, the entire DH and JH clusters, and the Cm and Cd constant regions) were injected into mouse eggs and appear to have reconstituted the core region of the locus (ú180 kb) following homologous recombination with each other. While this translocus yielded a titer of serum immunoglobulin similar to that obtained with a smaller plasmid-based minilocus, the P1-based locus gave rise to substantially greater diversification by somatic hypermutation. Such diversification is important for obtaining high-affinity antibodies. The results show the usefulness of the P1 system in facilitating the manipulation and recreation of large transgenes. q 1996 Academic Press, Inc.
INTRODUCTION
The introduction of large DNA molecules into the mouse germline forms the basis of a major approach to the production of human monoclonal antibodies (Bru¨ggemann et al., 1989, 1991; Bru¨ggemann and Neuberger, 1991; Davies et al., 1993; Green et al., 1994; Lonberg et al., 1994; Taylor et al., 1992, 1993; Wagner 1 Present address: Migal, Galilee Technological Center, Kiryat Shmona, Israel. 2 To whom correspondence should be addressed. Telephone: 44 1223 402245. Fax: 44 1223 412178.
et al., 1994a,b). Mouse lines that carry transgenic human immunoglobulin gene miniloci have been created; the immunoglobulin V, D, and J segments in these miniloci undergo productive rearrangement, yielding a repertoire of lymphocytes making antibodies with human polypeptide chains. Most such mice carry miniloci put together using bacterial plasmid vectors. This obviously limits the size of the miniloci that can be introduced into the mouse germline and may affect both the antibody repertoire that can be produced and its proper expression. Given that the human immunoglobulin heavy chain (IgH) locus is 1.5 Mb long (Hofker et al., 1989; Cook et al., 1994), other approaches need to be followed to create near locus-sized transgenes. We and others have previously described antibody expression from human immunoglobulin YACs introduced into the mouse genome. Thus, YACs were introduced into the mouse germline by the embryonic stem (ES) cell route, in which the DNA is introduced into the ES cells by lipofection (Choi et al., 1993; Strauss et al., 1993) or spheroplast fusion (Davies et al., 1993; Jakobovits et al., 1993). The transfected ES cells were then used to make blastocyst chimeras, and the chimeras were bred to obtain transmission through the mouse germline. An alternative, more direct strategy is the direct microinjection of purified YAC DNA into zygotes (Schedl et al., 1992, 1993), although technical difficulties have been encountered in obtaining purified, intact DNA from large YACs in concentrations sufficient for microinjection as well as in avoiding subsequent shearing (Gnirke et al., 1993; and our own experience). Here, we have examined the possibility of using bacteriophage P1 clones to reconstitute a core human IgH locus in transgenic mice. Phage P1 clones contain about 100 kb of inserted DNA and are propagated in Escherichia coli (Sternberg, 1990, 1994). DNA from these clones can be obtained in good yield and therefore in a high concentration suitable for direct microinjection. DNA from P1 clones is therefore more
405
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
gnma
AP: Genomics
406
WAGNER ET AL.
FIG. 1. Characterization of the YAC IgH1 bacteriophage P1 subclones. (a) Map of IgH1 YAC and three of the P1 clones derived from it. The EcoRI restriction map is taken from Shin et al. (1991). The end probes derived from the NotI and SalI sides of P128 are shown as gray bars. The degree of overlap was estimated by restriction mapping and Southern blotting using end probes. (b) PCR mapping of the three P1 clones for the presence of the four of the VH genes (VH4-4, VH1-3, VH1-2, and VH6-1), Cm (from the Cm1 to Cm3 exons), and Cd (the Cd1 exon and the most downstream Cd membrane exon, dM2) . The germline (i.e., unrearranged) V genes were amplified using primers within the V-intron and downstream of the heptamer and nonamer recombination signal sequences. The following primers were used: VH44BACK, 5*cccaagcttggtgcctctgatcccagggct and VH4-4FOR, 5*gctctagatctgggctcacactcacct; VH1-3BACK, 5*cccaagcttgaagccagtcaagggggcttc; VH1-2BACK, 5*cccaagcttgagtccagtccagggagatct; and a common primer VH1-2/3FOR, 5*gctctagaggggttttcacactgtgtc; VH6-1BACK, 5*cccaagctttcacagcagcattcacaga and VH6-1FOR, 5*ggaattcctgacttcccctcactgtg. Four exons of Cm were PCR amplified using CmBACK, 5*acctctgactcccttctcttga and CmFOR, 5*tgtgaacagagatggtg. Primers used to amplify the first exon of Cd were Cd1BACK, 5*cttgtcctcagagtttccagc and Cd1FOR, 5*gatctccggtgcgaccta. Primers used to amplify dM2 were dM2BACK, 5*tgtcactttcatcaaggtcag and dM2FOR, 5*cccttctctgcaggtaca. (c) Southern blot analysis to show overlap between P1 bacteriophage clones. End probes were derived from the central P1 clone (P128) and hybridized to P100, P128, and P195 DNA that had been digested with EcoRI.
readily prepared than that from YACs and is less prone to shearing. The fact that P1 clones are smaller than YACs is also, of course, one of their limitations, since they are less obviously suitable for the creation of large transgenic loci. However, we show that the core region of the human IgH locus can be reconstructed in mice by co-injecting three overlapping P1 clones. Analogous to what has been noted by others on injecting overlapping DNA fragments from plasmid-based vectors into mouse zygotes (Pieper et al., 1992; Lonberg and Huszar, 1995), the P1 clones appear to have recombined homologously with each. They have incorporated into the mouse genome, yielding a mouse strain that carries a minimum of 180 kb of the core region of the human IgH locus (including five VH genes, the DH locus, and the JH cluster linked to the m and d C-regions). The VH gene segments in this reconstituted ‘‘translocus’’ undergo productive rearrangement and somatic hypermuta-
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
tion in mouse lymphoid tissue, yielding animals that indeed produce repertoires of antigen-specific antibodies on antigen challenge. MATERIALS AND METHODS Subcloning into P1 bacteriophage. A YAC containing fiveVH genes (VH2-5, VH4-4, VH1-3, VH1-2, and VH6-1), D segments, J segments, Cm and Cd, all on a contiguous section of 250 kb of DNA, was isolated from the St. Louis YAC human genomic library using a PCR screening strategy described previously (Walter et al., 1993). Total DNA from the yeast cells containing the IgH YAC was partially digested by Sau3AI and cloned into the BamHI site of P1 bacteriophage vector pAd10sacBII (Pierce et al., 1992). Screening of the P1 library was carried out with probes for Cm, Cd, J segments, D segments, and the VH genes. A total of 10 YAC-derived P1 clones were obtained, of which 3 were used for subsequent work. These 3 overlapping clones (P100, P128, P195) span the entire original YAC as shown by restriction mapping and Southern blot analysis using end probes derived from the SP6 and T7 promoters flanking the BamHI site of pAD10sacBII.
gnma
AP: Genomics
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES Purification, analysis, and microinjection of DNA. One hundred milliliters of bacterial culture was grown overnight with 50 mg/ml kanamycin and DNA extracted by alkaline lysis following IPTG induction (Pierce and Sternberg, 1992). To obtain the insert, clone P100 was digested with NotI / SalI, clone P128 with BsiWI / NotI, and clone P195 with NruI. The digested DNA was embedded in agarose and run on a pulse-field gel at 160 V with a 30-s pulse time overnight. The insert was cut out, digested with agarase, and concentrated. Purified insert DNA from all three clones was mixed together at a concentration of 2 ng/ml each and used directly for microinjection. Mice were screened for integration of P1 clones by Southern blotting using a human Cm probe as well as by ELISA for expression of human m chains in serum. Analysis of P1 clone integration. End probes were derived from the central P1 clone (P128) using a PCR-based method. Thus, DNA from P128 was restricted with either AluI or RsaI, and a double-stranded linker (Riley et al., 1990) was ligated. PCR was carried out using a linker-specific primer and a primer specific for either the NotI side (5*gaaaatgacccagagcgctgc) or the SalI side (5*ctgccagaagtgcagtcg) of pAD10sacBII. The fragments obtained were about 1 kb (NotI end) and 0.5 kb (SalI end) and were used for probing Southern blots. Isolation and analysis of Peyer’s patch B cells. Peyer’s patches were dissected from the mouse ileum and pressed through a cell strainer, and the cells were washed in PBS/1% BSA (Gonza´lez-Ferna´ndez and Milstein, 1993). The pellet was resuspended in 120 ml of the same solution and incubated with a phycoerythrin-conjugated antiCD45R antibody (RA3-6B2; Immunoselect) and FITC-conjugated peanut agglutinin (PNA; Sigma) for 30 min at 47C. After washing in PBS, the cells were again passed through a cell strainer, and the CD45(B220)/ PNAhigh (germinal center B cell) population was sorted using a FACStarPlus (Becton–Dickinson, Mountain View, CA). DNA was extracted from the sorted cells by proteinase K digestion, and PCR was carried out using a JH consensus primer (Marks et al., 1991) and a primer specific for the leader V-intron of VH6-1 (5*cccaagctttcacagcagcattcacaga), VH4-4 (5*cccaagcttggtgcctctgatccc-agggct), or VH1-2 (5*cccaagcttgagtccagtccagggagatct). Immunization and ELISA. Animals (3–4 months old) were primed intraperitoneally with 2-phenyl-oxazol-5-one (phOx) coupled to chicken serum albumin (100 mg of alum-precipitated phOx14 –CSA / 109 heat-inactivated Bordetella pertussis). Boosting was carried out 6 weeks later. Antigen-specific titers were measured on plates coated with phOx14 –CSA (5 mg/ml), detecting with biotinylated rabbit anti-human m (Jackson).
RESULTS
P1 clones. A YAC containing the core region of the human IgH locus was isolated from a human peripheral blood cell library using PCR to screen pools of yeast transformants. This YAC, which we designate IgH1, was characterized by pulsed-field gel electrophoresis, restriction fragmentation, and Southern blotting with a variety of probes. The resultant map is depicted in Fig. 1a. Following partial Sau3A digestion, this YAC was subcloned into a bacteriophage P1 vector (Fig. 1a). As expected from the restriction mapping, PCR analysis (Fig. 1b) confirmed that clone P100 contains the Cm and Cd constant region including the d membrane exons, clone P128 contains VH6-1, and clone P195 contains VH4-4, VH1-3, and VH1-2. [Clone P195 also includes the most 5* VH gene present on IgH1 YAC, VH25 (see below).] End probes were derived from the central P1 clone (P128) and used to show that there is overlap between it and both the upstream (P195) and downstream (P100) P1 clones (Fig. 1c). Thus, the three P1 clones span the starting IgH1 YAC.
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
407
Mice with P1-derived IgH transgenes. The DNA from the individual P1 clones was purified from a pulsed-field gel (Fig. 2a) and used for microinjection. Mice were screened by Southern blot analysis of tail DNA with a human Cm probe and by testing for human m chains in serum by ELISA. Two founder mice were obtained (HuIgHP-1 and HuIgHP-2) from the 16 screened. PCR analysis of tail DNA revealed that HuIgHP-1 contains none of the VH segments found on P195, but it does have VH6-1, Cm, and Cd. In contrast, HuIgHP1-2 contained sequences from all three P1 clones (Fig. 2b) and indeed is positive for all the probes derived from the three P1 clones for which we have screened. In subsequent breeding of the HuIgHP-2 animals, we have not observed segregation of the P1 clones, suggesting that they have co-integrated. To assess whether this co-integration had occurred following homologous recombination between the sequence overlaps of the three P1s, tail DNA from HuIgHP-2 mice was digested with restriction enzymes and blotted with probes derived from the 5* and 3* ends of the central P1 clone, P128. The fragment sizes detected in the HuIgHP-2 tail DNA are similar to those obtained from the IgH1 YAC (and not from the isolated P128 DNA itself; Fig. 2c), suggesting that the P1 clones in HuIgHP-2 have undergone homologous recombination, presumably prior to integration. The transgene integration was also analyzed by pulse-field gel electrophoresis as well as by Southern blotting to determine the copy number of human Cm sequences integrated. The results (Figs. 2d and 2e) suggest that a single copy of a contiguous stretch of about 200 kb of human IgH locus DNA has been reconstructed in the mouse germline. Rearrangement. We screened for DH –JH rearrangements in the transgenic loci using a PCR assay asking whether the JH-proximal D segment (DQ52) rearranged to a member of the JH cluster. Despite this proximity to the JH cluster, no such rearrangements were found in HuIgHP-1 mice. However, HuIgHP-2 animals showed DQ52–JH rearrangements in both spleen and thymus (Fig. 3a); this is similar to what occurs with D–JH rearrangements of the endogenous mouse IgH locus (Forster et al., 1980; Kemp et al., 1980; Kurosawa et al., 1981; Mizutani et al., 1986). For further work, we focused on HuIgHP-2 animals and used PCR to demonstrate that all five VH genes could rearrange to the JH cluster in their lymphoid tissue (Fig. 3b). Expression. Antibody containing human m chains was detectable by ELISA in the serum of HuIgHP-2 but not HuIgHP-1 animals. The titer, however, is relatively low (Table 1). We suspected that this was because most B cells in the HuIgHP-2 mice would be expressing mouse rather than human m chains. This prediction was confirmed by immunofluorescence analysis (Fig. 4a). Indeed, only 1–2% of the LPS-blasted splenic B cells make human m chains, and most of these cells coexpress mouse m since nearly all the B cell blasts are mouse m/. A similar result was obtained by analyzing
gnma
AP: Genomics
408
WAGNER ET AL.
FIG. 2. The human IgH DNA integration in the transgenic mice. (a) Ethidium bromide-stained pulse-field gel showing the inserts of the three P1 bacteriophage clones used for microinjection. (b) PCR to show the extent of microinjected DNA present in the two transgenic mouse lines. PCR using primers as in Fig. 1b was carried out on tail DNA. (c) Southern blot analysis probing EcoRI-digested DNA with the 5* and 3* probes described in Fig. 1b, indicating homologous recombination between the microinjected P1 clones. (d) Southern blot analysis probing EcoRI-digested DNA with a human Cm probe. The samples (10 mg total DNA) are either HuIgHP-2 tail DNA or normal mouse tail DNA spiked with various amounts of P1-100 DNA so as to give the equivalent of 8, 4, 2, 1, or 0.5 human m genes per haploid mouse genome. (e) Pulse-field gel analysis of spleen DNA from HuIgHP-2 mice, digested with BssHII and SfiI and probed with a JH probe. Size markers were provided by a l ladder.
AID
Genom 4210
/
6r19$$4210
07-12-96 12:02:35
gnma
AP: Genomics
409
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES
FIG. 3. Rearrangement of the human VH , D, and JH segments. (a) Southern blot analysis for DQ52/JH rearrangements. Spleen (S) and thymus (T) DNA from founder transgenic animals (HuIgHP-1 and HuIgHP-2) was used as template for the PCR amplification of DQ52/JH rearrangements. DNA from wildtype mice (WT) and from human tonsil (Ton) provided controls. Primers were DQ52BACK, 5*tataggatccagccccacaggccccctaccagccgc and a JH consensus (Marks et al., 1991). The Southern blot was hybridized with a DQ52 oligonucleotide probe. (b) Southern blot analysis showing that all five VH genes are capable of rearrangement to JH . Spleen DNA from HuIgHP-2 and wildtype animals was compared with human tonsil. VH-specific DNA primers (as described in Fig. 1b) were used in separate reactions in combination with a JH consensus (Marks et al., 1991). Probes were derived by PCR amplification of the unrearranged VH genes from the DNA of the IgH1 YAC P1 subclones.
hybridomas, where two of three human m-expressing hybrids coexpressed mouse m. Thus, either (i) productive rearrangement of the HuIgHP-2 translocus does not yield a sufficiently high abundance of human mm to feedback inhibit rearrangement of the endogenous mouse IgH locus or (ii) productive rearrangement of the HuIgHP-2 translocus occurs after the endogenous locus has been rearranged and is insensitive to feedback regulation from it. The HuIgHP-2 translocus rescues B cell development in mMT mice. To assess the performance of the Hu-
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
IgHP-2 translocus in the absence of a functional mouse IgH locus, we crossed the HuIgHP-2 animals with mMT/ mMT mice. The mMT mutation is a targeted disruption in the membrane exon of mouse Cm that leads to a block in B cell development (Kitamura et al., 1991) that can, however, be overcome by providing an exogenous, transgenic IgH locus (Wagner et al., 1994b). HuIgHP-2 animals were crossed with mMT/mMT mice and then backcrossed to achieve homozygosity at the mMT locus. Provision of the HuIgHP-2 locus indeed rescues B cell development, as judged by the restoration of serum immunoglobulin (Table 1). Essentially all the B cells then expressed human m chains on their surface (Fig. 4b), although the total number of B cells was restored to only about one-third of wildtype levels and indeed the spleen sizes of the HuIgHP-2 mMT/mMT mice were about half of normal. It is interesting to compare this dramatic but nevertheless incomplete restoration of B cell development and serum immunoglobulin production to what we and others previously obtained with smaller plasmid-based human IgH (HuIgH) miniloci (Table 1; and Lonberg et al., 1994; Wagner et al., 1994b). The results are essentially similar, although it is notable that, regarding the criteria of expression analyzed here, the HuIgHP-2 translocus shows no advantage over the more compact miniloci. Antibody response. Clearly, to be useful, it is not sufficient for the translocus simply to give rise to serum IgM; it must be able to yield a sufficient diversity of antibodies in response to antigen challenge. Immunization of HuIgHP-2 mMT/mMT mice with the hapten phOx coupled to chicken serum albumin elicited a significant antigen-specific response, although its magnitude was somewhat less than that from normal mice (Fig. 5). Antibody diversity. To study the antibody heavychain diversity that could be generated from the HuIgHP-2 translocus, we sequenced VH rearrangements that had been PCR amplified from sorted germinal center B cells from Peyer’s patches. The rearrangements were amplified using a VH-specific primer together with a JH-consensus oligonucleotide, since this would allow us to analyze the contribution of both junctional/combiTABLE 1 Concentration of Serum Antibody with Human m Chains Background
mMT / mMT mMT
HuIgHP-2 mice (P1-based) 5 { 33 180 { 80
HuIgH mice (Plasmid-based) 7{
Normal mice
4
õ0.01
330 { 150
õ0.01
Note. Titers (mg/ml) are given as the means with the range determined from 10 animals for each group. The results for HuIgH mice are from Wagner et al. (1994b). Normal adult human serum IgM concentration is 0.5–1.9 mg/ml.
gnma
AP: Genomics
410
WAGNER ET AL.
natorial diversity and somatic hypermutation. The results (Figs. 6 and 7) show that the translocus gives rise to appreciable diversity by both gene rearrangement and somatic hypermutation. Thus, with regard to rearrangement, substantial diversity is achieved by the use of multiple D (as well as VH and JH) segments, and there is extensive junctional variation caused by Nregion/P-nucleotide insertion. Further diversification has been achieved by somatic hypermutation (Fig. 7), which is clearly making a substantial contribution to the antibody repertoire. This contrasts with results that we previously obtained with a plasmid-based minilocus where hypermutation, although detectable folFIG. 5. Antibody responses from HuIgHP-2 mMT/mMT mice. Serum responses to immunization with a hapten. Mice [three HuIgHP-2 mMT/mMT (shaded columns) and three wildtype (open columns) animals] were immunized with 100 mg of alum-precipitated phOx–CSA on Day 0 (arrow). Specific serum responses were measured by ELISA, and the titers are given as the negative log10 of the serum dilution that gave half-maximal reading in the ELISA.
lowing extensive antigen challenge, made a far smaller contribution to antibody diversity, as judged by PCR sequence analysis of germinal center B cells from Peyer’s patches (Wagner et al., 1994a). DISCUSSION
FIG. 4. Expression of human m chains in HuIgHP-2 mMT/mMT B cells. (a) Flow cytometry profiles of splenic B cell surfaces stained for human m chains. Spleen cells from HuIgHP-2 mMT/mMT (thick line), HuIgH mMT/mMT (thin line), and a normal (C57BL/6 1 CBA)F1 mouse (thin line showing a negative population) were stained with FITC-conjugated anti-human m antiserum (Jackson) and phycoerythrin-conjugated anti-CD45RO(B220) (Immunoselect; to identify B cells); the profiles show the anti-human m staining on those cells gated as CD45RO/. (b) Immunofluorescence analysis of HuIgHP-2 mMT// spleen cells that have been cultured in the presence of bacterial lipopolysaccharide for 3 days prior to staining with FITC-conjugated anti-human m antiserum (Jackson) and or biotinylated antimouse m antiserum (Southern Biotech) and Streptavidin–Texas red (Jackson).
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
The results presented here show that it is possible to reconstruct the core part of the human IgH locus (a region of some 200 kb) by co-injecting three P1 clones that appear to have recombined homologously—presumably prior to integration. While the HuIgHP-2 translocus does not yield higher levels of serum immunoglobulin than we have previously obtained from plasmid-based miniloci (Bru¨ggemann et al., 1989, 1991; Bru¨ggemann and Neuberger, 1991), it does give rise to a much greater antibody diversity. Part of this is due to much increased germline diversity: the translocus contains five VH segments and essentially the whole human DH repertoire (currently estimated as some 25 to 30 segments; Buluwela et al., 1988; Ichihara et al., 1988a,b; Siebenlist et al., 1981) compared to the two VH segments (one of which was used preferentially) and only four DH segments on our plasmid-based minilocus (Wagner et al., 1994a,b). However, a further, possibly more important, difference is the contribution of somatic hypermutation. Whereas we and others have detected somatic hypermutation of plasmid-based miniloci (Taylor et al., 1993; Wagner et al., 1994a), the contribution of hypermutation to diversification of the P1-based locus is considerably greater than was observed for our plasmid-based minilocus, as judged by an analysis of V gene sequences from germinal centers. It will therefore be of interest to dissect the HuIgHP-2 translocus to ascertain whether it contains cis-acting sequences that enhance hypermutation. This strategy could be used for the reconstitution of other gene loci in transgenic mice, the particular
gnma
AP: Genomics
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES
411
FIG. 6. Junctional and combinatorial diversity of IgH chains from HuIgHP-2 mice. The junctional sequences (VH –D–JH border) of translocus-derived VH rearrangements cloned following PCR amplification from the Peyer’s patch germinal center cells of HuIgHP-2 mMT/ mMT mice. In cases in which they can be identified, sequences derived from germline D segments (identified on the right side) are underlined. Germline D segment sequences were obtained from (Forster et al., 1980; Ichihara et al., 1988a,b; Siebenlist et al., 1981) and S. Corbett (Cambridge, UK, pers. comm.). The amplification was carried out using VH-specific primers and a JH consensus (legend to Fig. 3b).
07-12-96 12:02:35
gnma
AP: Genomics
412
WAGNER ET AL.
FIG. 7. Contribution of somatic hypermutation to IgH chain diversity in HuIgHP-2 mice. (a) The proportions of VH1-2, VH4-4, and VH61 sequences with 0, 1, 2, 3, etc., mutations are shown as pie charts. The VH1-2 and VH4-4 sequences (13 and 19 sequences, respectively) all derive from clonally unrelated B cells as witnessed by the fact that all the sequences differ at the VH –D–JH border. In contrast, analysis of the VH –D–JH border suggests that the 30 VH6-1 sequences may derive from only 14 distinct clonally expanded B cell dynasties (see b). (b) The sequences of the mutated VH1-2, VH4-4, and VH6-1 segments amplified from the germinal center B cells. Only those codon positions harboring mutations are indicated.
attraction being that P1 DNA is easily purified in good yield and can be microinjected without severe problems of DNA shearing. ACKNOWLEDGMENTS We thank David Gilmore and Andrew Riddell for flow cytometry, Theresa Langford and Gareth King for help with animal breedings, Simon Corbett and Ian Tomlinson for providing unpublished data on IgH gene maps, and Daisuke Kitamura and Klaus Rajewsky for
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
the mMT mice. This work was supported in part by a grant from the Leukaemia Research Fund (M.S.N. and S.D.W.). G.P.C. and G.G. were supported by fellowships from the Beit Memorial Trust and EMBO, respectively. S.L.D. was supported by an International Research Scholar’s award from the Howard Hughes Medical Institute to M.S.N.
REFERENCES Bru¨ggemann, M., Caskey, H. M., Teale, C., Waldmann, H., Williams, G. T., Surani, A., and Neuberger, M. S. (1989). A repertoire of
gnma
AP: Genomics
TRANSGENIC HUMAN IgH LOCUS FROM P1 CLONES monoclonal antibodies with human heavy chains from transgenic mice. Proc. Natl. Acad. Sci. USA 86: 6709–6713. Bru¨ggemann, M., and Neuberger, M. S. (1991). Generation of antibody repertoires in transgenic mice. Methods 2: 159–165. Bru¨ggemann, M., Spicer, C., Buluwela, L., Rosewell, I., Barton, S., Surani, M. A., and Rabbitts, T. H. (1991). Human antibody production in transgenic mice: Expression from 100 kb of the human IgH locus. Eur. J. Immunol. 21: 1323–1326. Buluwela, L., Albertson, D. G., Sherrington, P., Rabbitts, P. H., Spurr, N., and Rabbitts, T. H. (1988). The use of chromosomal translocations to study human immunoglobulin gene organization: Mapping DH segments within 35 kb of the Cm gene and identification of a new DH locus. EMBO J. 7: 2003–2010. Choi, T. K., Hollenbacj, P. W., Pearson, B. E., Ueda, R. M., Weddell, G. N., Kurahara, C. G., Woodhouse, C. S., Kay, R. M., and Loring, J. F. (1993). Transgenic mice containing a human heavy chain immunoglobulin gene fragment cloned in a yeast artificial chromosome. Nature Genet. 4: 117–123. Cook, G. P., Tomlinson, I. M., Walter, G., Riethman, H., Carter, N. P., Buluwela, L., Winter, G., and Rabbitts, T. H. (1994). A map of the human immunoglobulin VH locus completed by analysis of the telomeric region of chromosome 14q. Nature Genet. 7: 162– 168. Davies, N. P., Rosewell, I. R., Richardson, J. C., Cook, G. P., Neuberger, M. S., Brownstein, B. H., Norris, M. L., and Bru¨ggemann, M. (1993). Creation of mice expressing human antibody light chains by introduction of a yeast artificial chromosome containing the core region of the human immunoglobulin k locus. BioTechnology 11: 911–914. Forster, A., Hobart, M., Hengartner, H., and Rabbitts, T. H. (1980). An immunoglobulin heavy-chain gene is altered in two T-cell clones. Nature 286: 897–899. Gnirke, A., Huxley, C., Peterson, K., and Olson, M. V. (1993). Microinjection of intact 200 to 500 kb fragments of YAC DNA into mammalian cells. Genomics 15: 659–667. Gonza´lez-Ferna´ndez, A., and Milstein, C. (1993). Analysis of somatic hypermutation in mouse Peyer’s patches using immunoglobulin k light chain transgene. Proc. Natl. Acad. Sci. USA 90: 9862–9866. Green, L. L., Hardy, M. C., Maynard-Currie, C. E., Tsuda, H., Louie, D. M., Mendez, M. J., Abderrahim, H., Noguchi, M., Smith, D. H., Zeng, Y., David, N. E., Sasai, H., Garza, D., Brenner, D. G., Hales, J. F., McGuinness, R. P., Capon, D. J., Klapholz, S., and Jakobovits, A. (1994). Antigen-specific human monoclonal antibodies from mice engineered with human Ig heavy and light chain YACs. Nature Genet. 7: 13–21. Hofker, M. H., Walter, M. A., and Cox, D. W. (1989). Complete physical map of the human immunoglobulin heavy chain constant region gene complex. Proc. Natl. Acad. Sci. USA 86: 5567–5571. Ichihara, Y., Abe, M., Yasui, H., Matsuoka, H., and Kurosawa, Y. (1988a). At least five DH genes of human immunoglobulin heavy chains are encoded in 9-kilobase DNA fragments. Eur. J. Immunol. 18: 649–652. Ichihara, Y., Matsuoka, H., and Kurosawa, Y. (1988b). Organization of human immunoglobulin heavy chain diversity gene loci. EMBO J. 7: 4141–4150. Jakobovits, A., Moore, A. L., Green, L. L., Vergara, G. J., MaynardCurrie, C. E., Austin, H. A., and Klapholz, S. (1993). Germ-line transmission and expression of a human-derived yeast artificial chromosome. Nature 362: 255–258. Kemp, D. J., Harris, A. W., Cory, S., and Adams, J. W. (1980). Expression of the immunoglobulin Cm gene in mouse T and B lymphoid and myeloid cell lines. Proc. Natl. Acad. Sci. USA 77: 2876–2880. Kitamura, D., Roes, J., Ku¨hn, R., and Rajewsky, K. (1991). A B cell deficient mouse by targeted disruption of the membrane exon of the immunoglobulin m chain. Nature 350: 423–426. Kurosawa, Y., von Boehmer, H., Haas, W., Sakano, H., Trauneker, A., and Tonegawa, S. (1981). Identification of D segments of immu-
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
413
noglobulin heavy-chain genes and their rearrangement in T lymphocytes. Nature 290: 565–570. Lonberg, N., and Huszar, D. (1995). Human antibodies from transgenic mice. Int. Rev. Immunol. 13: 65–93. Lonberg, N., Taylor, L. D., Harding, F. A., Trounstine, M., Higgins, K. M., Schramm, S. R., Kuo, C.-C., Mashayekh, R., Wymore, K., McCabe, J. G., Munoz-O’Regan, D., O’Donnell, S. L., Lapachet, E. S. G., Bengoechea, T., Fishwild, D. M., Carmack, C. E., Kay, R. M., and Huszar, D. (1994). Antigen-specific human antibodies from mice comprising four distinct genetic modifications. Nature 368: 856–859. Marks, J. D., Hoogenboom, H. R., Bonnert, T. P., McCafferty, J., Griffiths, A. D., and Winter, G. (1991). By-passing immunization: Human antibodies from V-gene libraries displayed on phage. J. Mol. Biol. 222: 581–597. Mizutani, S., Ford, A. M., Wiedemann, L. M., Chan, L. C., Furley, A. J. W., Greaves, M. F., and Molgaard, H. V. (1986). Rearrangement of immunoglobulin heavy chain genes in human T leukaemic cells shows preferential utilization of the D segment (DQ52) nearest to the J region. EMBO J. 5: 3467–3473. Pieper, F. R., de Wit, I. C. M., Pronk, A. C. J., Kooiman, P. M., Strijker, R., Krimpenfort, P. J. A, Nuyens, J. H., and de Boer, H. A. (1992). Efficient generation of functional transgenes by homologous recombination in murine zygotes. Nucleic Acids Res. 20: 1259–1264. Pierce, J. C., and Sternberg, N. L. (1992). Using bacteriophage P1 system to clone high molecular weight genomic DNA. Methods Enzymol. 216: 549–574. Pierce, J. C., Sauer, B., and Sternberg, N. (1992). A positive selection vector for cloning high molecular weight DNA by the bacteriophage P1 system: Improved cloning efficiency. Proc. Natl. Acad. Sci. USA 89: 2056–2060. Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887–2890. Schedl, A., Beerman, F., Thies, E., Montoliu, L., Kelsey, G., and Schutz, G. (1992). Transgenic mice generated by pronuclear injection of a yeast artificial chromosome. Nucleic Acids Res. 20: 3073– 3077. Schedl, A., Montoliu, L., Kelsey, G., and Schu¨tz, G. (1993). A yeast artificial chromosome covering the tyrosinase gene confers copy number-dependent expression in transgenic mice. Nature 362: 258–261. Shin, E. K., Matsuda, F., Nagaoka, H., Fukita, Y., Imai, T., Yokoyama, K., Soeda, E., and Honjo, T. (1991). Physical map of the 3* region of the human immunoglobulin heavy chain locus: Clustering of autoantibody-related variable segments in one haplotype. EMBO J. 10: 3641–3645. Siebenlist, U., Ravetch, J. V., Korsmeyer, S., Waldmann, T., and Leder, P. (1981). Human immunoglobulin D segments encoded in tandem multigenic families. Nature 294: 631–635. Sternberg, N. (1990). Bacteriophage P1 cloning system for the isolation, amplification, and recovery of DNA fragments as large as 100 kilobase pairs. Proc. Natl. Acad. Sci. USA 87: 103–107. Sternberg, N. (1994). The P1 cloning system: Past and future. Mamm. Genome 5: 397–404. Strauss, W. M., Dausman, J., Beard, C., Johnson, C., Lawrence, J. B., and Jaenisch, R. (1993). Germline transmission of a yeast artificial chromosome spanning the murine a1(I) collagen locus. Science 259: 1904–1907. Taylor, L. D., Carmack, C. E., Huszar, D., Higgins, K. M., Mashayekh, R., Sequar, G., Schramm, S. R., Kuo, C.-C., S.L., O., Kay, R. M., Woodhouse, C. S., and Lonberg, N. (1993). Human immunoglobulin transgenes undergo rearrangement, somatic mutation and class switching in mice that lack endogeneous IgM. Int. Immunol. 6: 579–591.
gnma
AP: Genomics
414
WAGNER ET AL.
Taylor, L. D., Carmack, C. E., Schramm, S. R., Mashayekh, R., Higgins, K. M., Kuo, C.-C., Woodhouse, C., Kay, R. M., and Lonberg, N. (1992). A transgenic mouse that expresses a diversity of human sequence heavy and light chain immunoglobulins. Nucleic Acids Res. 20: 6287–6295. Wagner, S. D., Popov, A. V., Davies, S. L., Xian, J., Neuberger, M. S., and Bru¨ggemann, M. (1994a). The diversity of antigen specific monoclonal antibodies from transgenic mice bearing human immunoglobulin gene miniloci. Eur. J. Immunol. 24: 2672–2681.
AID
Genom 4210
/
6r19$$$561
07-12-96 12:02:35
Wagner, S. D., Williams, G. T., Larson, T., Neuberger, M. S., Kitamura, D., Rajewsky, K., Xian, J., and Bru¨ggemann, M. (1994b). Antibodies generated from human immunoglobulin miniloci in transgenic mice. Nucleic Acids Res. 22: 1389–1393. Walter, G., Tomlinson, I. M., Cook, G. P., Winter, G., Rabbitts, T. H., and Dtar, P. H. (1993). HAPPY mapping of a YAC reveals alternative haplotypes in the human immunoglobulin VH locus. Nucleic Acids Res. 21: 4524–4529.
gnma
AP: Genomics