- Email: [email protected]
Antimicrobial susceptibility phenotypes, resistance determinants and DNA fingerprints of Salmonella enterica serotype Typhimurium isolated from bovine in Southern Japan
International Journal of Antimicrobial Agents 30 (2007) 150–156
Antimicrobial susceptibility phenotypes, resistance determinants and DNA fingerprints of Salmonella enterica serotype Typhimurium isolated from bovine in Southern Japan Francis Shahada a , Asako Amamoto a , Takehisa Chuma a,∗ , Akito Shirai b , Karoku Okamoto a a
Laboratory of Veterinary Public Health, Department of Veterinary Medicine, Faculty of Agriculture, Kagoshima University, 1 21-24 Korimoto, Kagoshima 890-0065, Japan b Kagoshima Livestock Hygiene Service Center, 1678 Hioki, Kagoshima 899-2201, Japan Received 11 January 2007; accepted 8 March 2007
Abstract A longitudinal study was conducted in cattle to determine the antimicrobial resistance phenotypes, integron elements, resistance genes and pulsed-field gel electrophoresis fingerprints among Salmonella enterica serotype Typhimurium isolates. A total of 33 strains were isolated and categorised into Groups A, B and C during the period 1989–2004. Thirty-one strains (93.9%) showed resistance to ampicillin (A) encoded by blaOXA-1 , blaTEM and blaPSE-1 genes; 84.8% showed resistance to chloramphenicol (C) encoded by floR and catA1; 97.0% were resistant both to streptomycin (S) and sulfamethoxazole (Su), the former encoded by aadA1 and aadA2; 100% were resistant to oxytetracycline (T) encoded by tetA, tetB and tetG; and 42.4% were resistant to kanamycin (Km) encoded by aphA1-Iab. Multidrug resistance types observed were ACSSuT-Km (n = 13), ACSSuT (n = 15), ASSuT (n = 3) and SSuT (n = 2). Class 1 integrons ranging from 1.0 kb to 1.9 kb were detected from 54.5% of isolates (18/33). Integrons were not detected initially (1989–1992), then during the 1993–1996 interval a high frequency of 1.0 kb and 1.2 kb amplicons were detected and during 2000–2004 the amplicon size increased to 1.7 kb and 1.9 kb. We report evidence of additional integration of resistance gene cassettes as shown by integrons with increased size. Finally, group B strains showed banding patterns indistinguishable from S. Typhimurium DT104 reference strain, indicating that the DT104 lineage existed on the island since 1993. © 2007 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. Keywords: Salmonella Typhimurium; Cattle; Antimicrobial resistance; Trends
1. Introduction Strains of Salmonella that are resistant to antimicrobial agents have become a worldwide health problem. Reports on the internationally emerging significance of multidrug-resistant (MDR) salmonellae in animals and man prompted studies in Japan to estimate the magnitude of MDR Salmonella enterica serotype Typhimurium. During the last two decades, strains of MDR S. Typhimurium definitive phage type 104 (DT104) with resistance to ampicillin
∗
Corresponding author. Tel.: +81 99 285 8734; fax: +81 99 285 8735. E-mail address: [email protected] (T. Chuma).
(A), chloramphenicol (C), streptomycin (S), sulfamethoxazole (Su) and oxytetracycline (T) (R-type ACSSuT) spread over many countries, including Japan. Nevertheless, there has been a significant decline in isolation since the late 1990s [1–4]. Of concern, however, are reports regarding the detection of diverse MDR strains of S. Typhimurium in Japan [5,6], which may cause difficulty in the treatment of infections they cause in animals and humans. Amongst important resistance determinants, complex integrons have been implicated, which occur either on plasmids or integrated into the bacterial chromosome [7]. However, most integrons are contained within chromosomes, and class 1 integrons are one of the single biggest contributors to MDR infections, carrying resistance to many antibiotics
0924-8579/$ – see front matter © 2007 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. doi:10.1016/j.ijantimicag.2007.03.017
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
in diverse pathogens on a global scale [8]. Because integrons have been integrated into the chromosomal DNA, they are able to persist even in the absence of antimicrobial selection and this has led to the stable and widely disseminated clones of MDR S. Typhimurium [9,10]. Much prevention and control of salmonellosis depends on early outbreak recognition through a suitable surveillance system. The value of phenotypic typing methods as surveillance tools is well established, and DNA fingerprinting is often used in outbreak investigations in which enhanced strain discrimination is required. A number of DNA-based fingerprinting methods, including pulsed-field gel electrophoresis (PFGE) are available. The latter is often considered the gold standard for molecular subtyping of Salmonella strains [11–15]. The aim of this study was to determine the antimicrobial resistance phenotypes (R-types), class 1 integron carriage, genes coding for resistance and DNA fingerprinting of Salmonella isolates. First, resistance to combinations of several classes of antimicrobials was elucidated and the resistance factors involved were determined. Then, XbaI-generated macrorestriction fingerprints were analysed to determine the chromosome profiles and hence to establish relationships among the strains. Finally, the temporal and spatial distribution of resistance determinants was established.
151
2.2. Determination of minimum inhibitory concentrations (MICs) Antimicrobial susceptibility was assayed by the agar dilution method on Mueller–Hinton agar (Oxoid Ltd., Basingstoke, UK) plates following the guidelines of the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards (NCCLS)) [16]. Strains were tested for sensitivity to ampicillin, chloramphenicol, streptomycin, sulfamethoxazole, oxytetracycline and kanamycin (Km). The MIC range tested was 1–512 g/mL for all the antimicrobial agents. MIC breakpoints were those established by the NCCLS [16]. 2.3. Bacterial DNA preparation and detection of resistance determinants Isolates were cultured on brain–heart infusion agar (Eiken Chemical Co., Tokyo, Japan). All DNA templates were prepared by the boiling method as described previously [17]. Detection of integrons and antimicrobial resistance genes was performed by polymerase chain reaction as described previously [17]. Amplifications were carried out using the primers listed in Table 1. 2.4. PFGE
2. Materials and methods 2.1. Origin of bacterial strains, isolation and identification Salmonella Typhimurium strains were involved in 31 cases of salmonellosis in cattle in the southern part of Japan Main Islands during 1989–2004. Initially, the infections were diagnosed by field veterinarians, followed by isolation, identification and serotyping of Salmonella spp. at the Prefecture Animal Health Center. In addition, one isolate was recovered from a cattle barn and another was isolated from an asymptomatic carrier.
Salmonella embedded in agarose plugs was prepared by the previously described method [24]. One-third of the plug slice was digested using 100 L of restriction enzyme mixture containing 30 U of XbaI (Toyobo Biochemicals, Tokyo, Japan). PFGE was performed using a CHEF-DR III system (Bio-Rad, Hercules, CA). The running conditions were 6 V/cm at 14 ◦ C for 22 h with pulse times ramped from 5 s to 50 s. A lambda ladder was used as the molecular size marker, and standardisation of the DT104 genotype employed DT104 strain 300-98. The gels were stained with 1 g/mL ethidium bromide and the images were interpreted by the criteria suggested by Tenover et al. [13].
Table 1 Polymerase chain reaction primers and conditions Gene or region
Primer sequence
Reference
Size (bp)
Ta (◦ C)
intI1 5 CS3 CS blaTEM blaOXA-1 blaPSE-1 floR catA1 aadA1a aadA2 tetA tetB tetG aphA1-Iab
F-(CCTCCCGCACGATGATC), R-(TCCACGCATCGTCAGGC) F-(GGCATCCAAGCAGCAAG), R-(AAGCAGACTTGACCTGA) F-(GCACGAGTGGGTTACATCGA), R-(GGTCCTCCGATCGTTGTCAG) F-(ACCAGATTCAACTTTCAA), R-(TCTTGGCTTTTATGCTTG) F-(TTTGGTTCCGCGCTATCTG), R-(TACTCCGAGCACCAAATCCG) F-(AATCACGGGCCACGCTGTATC), R-(CGCCGTCATTCTTCACCTTC) F-(CCTGCCACTCATCGCAGT),R-(CCACCG TGATATATCCC) F-(GTGGATGGCGGCCTGAAGCC), R-(AATGCCCAGTCGGCAGCG) F-(TGTTGGTTACTGTGGCCGTA), R-(GCTGCGAGTTCCATAGCTTC) F-(GCTACATCCTGCTTGCCTTC), R-(CATAGATCGCCGTGAAGAGG) F-(TTGGTTAGGGGCAAGTTTTG), R-(GTAATGGGCCAATAACACCG) F-(GCTCGGTGGTATCTCTGCTC), R-(AGCAACAGAATCGGGAACAC) F-(AAACGTCTTGCTCGAGGC), R-(CAAACCGTTATTCATTCGTGA)
[18] [19] [20] [21] [22] [23] [19] [19] [22] [22] [22] [22] [17]
280 Variable 310 598 586 215 623 526 381 210 659 468 500
59 55 60 53 62 62 60 68 59 64 64 59 55
F, forward; R, reverse; Ta , annealing temperature.
152
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
Table 2 Antimicrobial susceptibility among Salmonella enterica serotype Typhimurium isolates Drug
Ampicillin Chloramphenicol Streptomycin Sulfamethoxazole Oxytetracycline Kanamycin
No. of isolates at MIC (g/mL) 1
2
0
2 0
0
1
8
16
32
64
128
256
≥512
0 5 0
0 0 1
0 0 0 0
0 0 0 1
14
3
1
0
0 0 0 0 0 0
0 0 0 0 1 0
0 0 2 0 10 0
31 28 30 32 22 14
4
Breakpoint (g/mL)
No. of resistant isolates (%)
32 32 16 512 16 64
31 (93.9) 28 (84.8) 32 (97.0) 32 (97.0) 33 (100) 14 (42.4)
MIC, minimum inhibitory concentration.
3. Results 3.1. Antimicrobial susceptibility profiles A total of 33 S. Typhimurium strains were isolated and categorised into Groups A, B and C based on temporal trends of resistance factors. The groups comprised 13, 9 and 11 isolates recovered during 1989–1992, 1993–1996 and 1997–2004, respectively. Resistance to at least three antimicrobials tested was detected in 97% of strains (32/33), whereas one isolate was resistant to oxytetracycline and kanamycin. Approximately 94% of the strains were resistant to ampicillin, 84.8% to chloramphenicol, 97% both to streptomycin and sulfamethoxazole, 100% to oxytetracycline and 42.4% to kanamycin (Table 2). Five R-types were observed. Thirteen hexa-resistant strains (Group A,
n = 12; Group C, n = 1) belonged to R-type ACSSuTKm, whilst 15 penta-resistant strains (Group B, n = 9; and Group C, n = 6) belonged to R-type ACSSuT. Three isolates (Group C) had R-type ASSuT, whilst one strain each had R-type SSuT (Group C) and R-type T-Km (Group A) (Table 3). 3.2. Distribution of integrons and resistance genes Thirty isolates (90.9%) harboured the class 1 integrasespecific intI1 gene (Table 3). Class 1 integron conserved segment (CS) amplicons ranging from 1.0 kb to 1.9 kb were detected in 18 isolates (54.5%). Ten (66.7%) of the 15 pentaresistant isolates yielded two CS amplicons of 1.0 kb and 1.2 kb, one isolate had a 1.0 kb amplicon and two isolates yielded 1.9 kb CS amplicons. All three tetra-resistant isolates
Fig. 1. (A) Spatial distribution of β-lactamases among Salmonella enterica serotype Typhimurium strains. For isolates with two or more genes, there is shading of the circle for each gene present. (B) Distribution of genes coding for tetracycline efflux proteins.
Table 3 Summary analysis of resistance (R) types, pulsed-field gel electrophoresis (PFGE) patterns and resistance factors of Salmonella enterica serotype Typhimurium isolates from cattle Straina,b
a b
1989 1989 1989 1989 1989 1990 1990 1990 1991 1991 1992 1992 1992 1993 1994 1994 1995 1995 1996 1996 1996 1996 2000 2000 2000 2000 2001 2001 2001 2001 2001 2002 2004
R-type
ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km T-Km ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ASSuT ASSuT SSuT ASSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT-Km
PFGE pattern
IVc IVa IVe IVa IVb IVd IVd IVb IIIa IIIb IIIa IIb IIc Ia Ib Ib Ia Ia Ia Ia Ia Ia IIa IIa IIb IIa IIc Ib Ib IIc IIc IIc V
Resistance determinants intI1
5 CS-3 CS
blaOXA−1
blaTEM
blaPSE−1
floR
catA1
aadA1a
aadA2
tetA
tetB
tetG
aphA1-Iab
+ + + + + + + + − + + + − + + + + + + + + + + + − + + + + + + + +
− − − − − − − − − − − − − 1.0,1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0 1.7 1.7 − 1.7 1.9 1.0, 1.2 1.0, 1.2 1.0 1.9 − 1.0, 1.7
+ + − + − + + − + + − + − − − − − − − − − − − + − + − − + − + + −
− + + − + + + + + + − − − − − − − − − − − − + + − − − − − − + − +
− − − − − − + − − − − − − + + + + + + + + + − − − − − + + + − − +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + − − − − − − − − − − − − − − + − − − + + +
+ − − + − + + − + + − + − + + + + + + + + + + + − + + + + + + + +
− − − − − − − − − − − − − + + + + + + + + + − − − − + + + + + + −
− − − + − − − − − − − − − − − − − − − − − − + + + + − − − − − + +
+ + + + + + + + + + + + + − − − − − − − − − − − − − − − − − + − −
− − − − − − − − − − − − − + + + + + + + + + − − − − − + + + − − +
+ + + + + + + + + + + + + − − − − − − − − − − − − − − − − − − − +
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
ST1 ST2 ST3 ST4 ST5 ST6 ST10 ST11 ST12 ST13 ST14 ST16 ST17 ST19 ST20 ST21 ST22 ST25 ST26 ST27 ST28 ST29 ST32 ST33 ST35 ST36 ST37 ST38 ST39 ST40 ST41 ST42 ST45
Year
All samples were diagnostic submissions except ST27 (environmental) and ST33 (asymptomatic carrier). Group A included strains isolated during the time period 1989–1992, Group B 1993–1996 and Group C 2000–2004.
153
154
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
had one amplicon of 1.7 kb, whereas one hexa-resistant strain had two amplicons of 1.0 kb and 1.7 kb (Table 3). Resistance genes were variably detected among the groups. blaOXA−1 and blaTEM were confined to Groups A and C, whilst blaPSE−1 was predominant in Group B. floR was present in all isolates, whilst catA1 was mostly detected in Group A. aadA1 and aadA2 were detected in all pentaresistant strains in Groups B and C. The distribution of the remaining genes also followed characteristic trends, with Group A predominated by tetB, whereas tetG was abundantly present in Group B and to a lesser extent in Group C. aphA1 was detected in all kanamycin-resistant isolates. The spatial distribution of genes encoding ampicillin and oxytetracycline resistance formed defined trends (Fig. 1). A high frequency of blaTEM , blaOXA-1 , tetA and tetB was observed in the western part of the islands, whilst blaPSE-1 and tetG were abundant towards the eastern part. However, a few foci of blaPSE−1 and tetG were also rarely intermingled within the western part. 3.3. Karyotype profile analysis Analysis of the DNA fingerprints by PFGE revealed five major types (Table 3) as represented by the selected genotypes (Fig. 2). Minor variations within five predominant banding patterns led to further division into 13 subtypes. Group A isolates showed pattern types II, III and IV, whilst Group B isolates displayed a type I profile, designated as the common pattern with the chromosome profiles of seven of nine isolates indistinguishable from the banding pattern displayed by standard DT104 strain. Group C isolates displayed banding pattern types I, II and V (Table 3).
Fig. 2. Genotypes of selected Salmonella enterica serotype Typhimurium strains, demonstrating the five XbaI macrorestriction pulsed-field gel electrophoresis (PFGE) patterns. PFGE analysis of S. Typhimurium genotypes were classified as described in Section 3.3. Lane 1, standard S. Typhimurium DT104 strain 300-98; lanes 2–10, XbaI PFGE patterns representing as types Ia, Ib, IIb, IIc, IIIa, IIIb, IVa, IVb and V, respectively.
4. Discussion The present study was conducted to gain a better understanding of the distribution of resistance determinants and relationships among non-DT104 and DT104-like S. Typhimurium strains. The primary findings were that during 1989–1992, all S. Typhimurium isolated in the southern part of Japan Main Islands were non-DT104 strains as they were negative for the CS amplicons of 1.0 kb and 1.2 kb class 1 integrons and they displayed a hexa-resistant R-type rather than the typical penta-resistance pattern of S. Typhimurium DT104 strains. Then, during the interval 1993–1996, S. Typhimurium DT104-like strains predominated, displaying the characteristic penta-resistant R-type with two class 1 integron amplicons of 1.0 kb and 1.2 kb. Although we did not determine the phage types of the isolates, their MDR profiles and DNA fingerprinting results showed that most of the strains were genetically similar to S. Typhimurium DT104 standard strain 300–98. This implies that the clonal line was disseminated among cattle herds in the study area from around 1993. During 1997–2004, MDR S. Typhimurium were observed with an increased size of class 1 integrons to 1.7 kb and 1.9 kb, compared with 1.0 kb and 1.2 kb previously observed. The increased size of the integrons was evidence of integration of extra gene cassettes, because in addition to the former blaPSE−1 gene commonly possessed by DT104 lineage, blaOXA−1 was also found in one strain originating from the same line. In the present study, we also showed that the temporal distribution of resistance factors followed particular trends with time. Resistance to ampicillin was determined by blaOXA−1 and blaTEM during 1989–1992. Then, during the period 1993–1996 resistance was mainly conferred by blaPSE−1 and thereafter various combinations of the genes were observed. Furthermore, aadA1 was the only streptomycin resistance gene detected during the early period, whilst during the middle and late periods both aadA1 and aadA2 were simultaneously present. A similar trend was evident with oxytetracycline resistance genes, such that tetB was dominant at the beginning, followed by tetG, although tetA and tetB were also infrequently observed especially during the late period. This can be explained by the fact that in DT104 complex, multidrug resistance is due to chromosomal integration of a 43 kb structure called Salmonella genomic island 1 (SGI1) carrying multiple resistance gene cassettes in complex class 1 integrons [10,24–27]. Analysis of class 1 integrons combined with DNA fingerprints showed that Group A isolates did not belong to the DT104 complex. In contrast, we observed blaPSE−1 occurring together with aadA2 and tetG particularly in Group B and C isolates, and a similar occurrence has been reported previously in other DT104 strains [28,29]. Moreover, one isolate in Group C yielded two class 1 integron amplicons of 1.0 kb and 1.7 kb carrying tetA and tetG simultaneously. This finding was further evidence of bacterial gene cassette integration and supported the observation that
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
recent appearance of larger integrons could signify enhanced capability of integrating additional resistance factors. Analysis of PFGE fingerprints revealed trend variability, such that during the interval 1989–1992 chromosome profiles of the majority of isolates deviated from the common pattern (type I), implying that they had different origins and were probably epidemiologically unrelated. In contrast, isolates recovered during the period 1993–1996 displayed an indistinguishable pattern to each other, signifying that they shared the same lineage and were epidemiologically related. Thereafter, banding patterns closely resembling those observed during 1993–1996 re-emerged, indicating that they were possibly related genetically but were less likely to be related epidemiologically. Moreover, the last isolate to be recovered was probably unrelated by descent to any of the genetic lines revealed previously because of a significant deviation of the observed banding pattern. To conclude, both DT104-related and non-DT104 strains of S. Typhimurium prevailed in Japan in different time periods and among them multidrug resistance was the rule. It will be important to survey further the occurrence of resistance phenotypes and genotypes of S. Typhimurium both in animals and humans in order to learn how they change. These trends should be followed carefully by the use of adequate subtyping methods and by the detection of resistance mechanisms.
Acknowledgments We are grateful to Drs. Haruo Watanabe and Hidemasa Izumiya of the National Institute of Infectious Diseases, Tokyo, Japan, for donating the S. Typhimurium DT104 reference strain 300-98.
References [1] Glynn MK, Bopp C, Dewitt W, Dabney P, Mokhtar M, Angulo FJ. Emergence of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N Engl J Med 1998;338:1333–8. [2] Sameshima T, Akiba M, Izumiya H, et al. Salmonella typhimurium DT104 from livestock in Japan. Jpn J Infect Dis 2000;53:15–6. [3] Threlfall EJ, Frost JA, Ward LR, Rowe B. Epidemic in cattle and humans of Salmonella typhimurium DT104 with chromosomally integrated multiple drug resistance. Vet Rec 1994;134:577. [4] Threlfall EJ, Frost JA, Ward LR, Rowe B. Increasing spectrum of resistance in multiresistant Salmonella typhimurium. Lancet 1996;347:1053–4. [5] Izumiya H, Mori K, Kurazono T, et al. Characterization of isolates of Salmonella enterica serovar Typhimurium displaying high-level fluoroquinolone resistance in Japan. J Clin Microbiol 2005;43:5074–9. [6] Esaki H, Morioka A, Ishihara K, et al. Antimicrobial susceptibility of Salmonella isolated from cattle, swine and poultry (2001–2002): report from the Japanese Veterinary Antimicrobial Resistance Monitoring Program. J Antimicrob Chemother 2004;53:266–70. [7] Goldstein C, Lee MD, Sanchez S, et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother 2001;45:723–6.
155
[8] Stokes HW, Nesbo CL, Holley MB, Bahl MI, Gillings MR, Boucher Y. Class 1 integrons potentially predating the association with Tn402-like transposition genes are present in a sediment microbial community. J Bacteriol 2006;188:5722–30. [9] Chen S, Zhao S, White DG, et al. Characterization of multipleantimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol 2004;70:1–7. [10] Boyd D, Cloeckaert A, Chaslus-Dancla E, Mulvey MR. Characterization of variant Salmonella genomic island 1 multidrug resistance regions from serovars Typhimurium DT104 and Agona. Antimicrob Agents Chemother 2002;46:1714–22. [11] Arbeit RD. Laboratory procedures for the epidemiologic analysis of microorganisms. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of clinical microbiology. 6th ed. Washington, DC: American Society for Microbiology; 1995. p. 190–208. [12] Olsen JE, Skov MN, Threlfall EJ, Brown DJ. Clonal lines of Salmonella enterica serotype Enteritidis documented by IS200-, ribo-, pulsed-field gel electrophoresis and RFLP typing. J Med Microbiol 1994;40:15–22. [13] Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233–9. [14] Swaminathan B, Barrett TJ, Hunter SB, Tauxe RV; CDC PulseNet Task Force. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis 2001;7:382–9. [15] Goering RV. Pulsed-field gel electrophoresis. In: Persing DH, Tenover FC, Versalovic J, et al., editors. Molecular microbiology: diagnostic principles and practice. Washington, DC: ASM Press; 2004. p. 185–96. [16] National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. 2nd ed. Approved Standard M31-A2. Wayne, PA: NCCLS; 2002. [17] Shahada F, Chuma T, Tobata T, Okamoto K, Sueyoshi M, Takase K. Molecular epidemiology of antimicrobial resistance among Salmonella enterica serovar Infantis from poultry in Kagoshima, Japan. J Antimicrob Agents 2006;28:302–7. [18] Valverde Romero E, Parras Padilla T, Garc´ıa Garc´ıa MI, et al. Salmonella enterica serovar Infantis producing a CTX-M-9 lactamase. Antimicrob Agents Chemother 2005;49:2142–3. [19] Guerra B, Soto SM, Arguelles JM, Mendoza MC. Multidrug resistance is mediated by large plasmids carrying a class 1 integron in the emergent Salmonella enterica serotype [4,5,12:i:-]. Antimicrob Agents Chemother 2001;45:1305–8. [20] Carlson SA, Bolton LF, Briggs CE, et al. Detection of multiresistant Salmonella typhimurium DT104 using multiplex and fluorogenic PCR. Mol Cell Probes 1999;13:213–22. [21] Gallardo F, Ruiz J, Marco F, Towner KJ, Vila J. Increase in incidence of resistance to ampicillin, chloramphenicol and trimethoprim in clinical isolates of Salmonella serotype Typhimurium with investigation of molecular epidemiology and mechanisms of resistance. J Med Microbiol 1999;48:367–74. [22] Ng L-K, Mulvey MR, Martin I, Peters GA, Johnson W. Genetic characterization of antimicrobial resistance in Canadian isolates of Salmonella serovar Typhimurium DT104. Antimicrob Agents Chemother 1999;43:3018–21. [23] Bolton LF, Kelley LC, Lee MD, Fedorka-Cray PJ, Maurer JJ. Detection of multidrug-resistant Salmonella enterica serotype typhimurium DT104 based on a gene which confers cross-resistance to florfenicol and chloramphenicol. J Clin Microbiol 1999;37:1348–51. [24] Akiba M, Uchida I, Nishimori K, et al. Comparison of Salmonella enterica serovar Abortusequi isolates of equine origin by pulsed-field gel electrophoresis and the fluorescent amplified-fragment length polymorphism fingerprinting. Vet Microbiol 2003;93:379–88. [25] Boyd D, Peters GA, Cloeckaert A, et al. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J Bacteriol 2001;183:5725–32.
156
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
[26] Boyd DA, Peters GA, Ng LK, Mulvey MR. Partial characterization of a genomic island associated with the multidrug resistance region of Salmonella enterica Typhimurium DT104. FEMS Microbiol Lett 2000;189:285–91. [27] Doublet B, Boyd D, Mulvey MR, Cloeckaert A. The Salmonella genomic island 1 is an integrative mobilizable element. Mol Microbiol 2005;55:1911–24.
[28] Threlfall EJ, Hopkins KL, Ward LR. Diversification in Salmonella Typhimurium DT 104. Emerg Infect Dis 2005;11:980–1. [29] Weill F-X, Guesnier F, Guibert V, et al. Multidrug resistance in Salmonella enterica serotype Typhimurium from humans in France (1993–2003). J Clin Microbiol 2006;44:700–8.
Antimicrobial susceptibility phenotypes, resistance determinants and DNA fingerprints of Salmonella enterica serotype Typhimurium isolated from bovine in Southern Japan Francis Shahada a , Asako Amamoto a , Takehisa Chuma a,∗ , Akito Shirai b , Karoku Okamoto a a
Laboratory of Veterinary Public Health, Department of Veterinary Medicine, Faculty of Agriculture, Kagoshima University, 1 21-24 Korimoto, Kagoshima 890-0065, Japan b Kagoshima Livestock Hygiene Service Center, 1678 Hioki, Kagoshima 899-2201, Japan Received 11 January 2007; accepted 8 March 2007
Abstract A longitudinal study was conducted in cattle to determine the antimicrobial resistance phenotypes, integron elements, resistance genes and pulsed-field gel electrophoresis fingerprints among Salmonella enterica serotype Typhimurium isolates. A total of 33 strains were isolated and categorised into Groups A, B and C during the period 1989–2004. Thirty-one strains (93.9%) showed resistance to ampicillin (A) encoded by blaOXA-1 , blaTEM and blaPSE-1 genes; 84.8% showed resistance to chloramphenicol (C) encoded by floR and catA1; 97.0% were resistant both to streptomycin (S) and sulfamethoxazole (Su), the former encoded by aadA1 and aadA2; 100% were resistant to oxytetracycline (T) encoded by tetA, tetB and tetG; and 42.4% were resistant to kanamycin (Km) encoded by aphA1-Iab. Multidrug resistance types observed were ACSSuT-Km (n = 13), ACSSuT (n = 15), ASSuT (n = 3) and SSuT (n = 2). Class 1 integrons ranging from 1.0 kb to 1.9 kb were detected from 54.5% of isolates (18/33). Integrons were not detected initially (1989–1992), then during the 1993–1996 interval a high frequency of 1.0 kb and 1.2 kb amplicons were detected and during 2000–2004 the amplicon size increased to 1.7 kb and 1.9 kb. We report evidence of additional integration of resistance gene cassettes as shown by integrons with increased size. Finally, group B strains showed banding patterns indistinguishable from S. Typhimurium DT104 reference strain, indicating that the DT104 lineage existed on the island since 1993. © 2007 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. Keywords: Salmonella Typhimurium; Cattle; Antimicrobial resistance; Trends
1. Introduction Strains of Salmonella that are resistant to antimicrobial agents have become a worldwide health problem. Reports on the internationally emerging significance of multidrug-resistant (MDR) salmonellae in animals and man prompted studies in Japan to estimate the magnitude of MDR Salmonella enterica serotype Typhimurium. During the last two decades, strains of MDR S. Typhimurium definitive phage type 104 (DT104) with resistance to ampicillin
∗
Corresponding author. Tel.: +81 99 285 8734; fax: +81 99 285 8735. E-mail address: [email protected] (T. Chuma).
(A), chloramphenicol (C), streptomycin (S), sulfamethoxazole (Su) and oxytetracycline (T) (R-type ACSSuT) spread over many countries, including Japan. Nevertheless, there has been a significant decline in isolation since the late 1990s [1–4]. Of concern, however, are reports regarding the detection of diverse MDR strains of S. Typhimurium in Japan [5,6], which may cause difficulty in the treatment of infections they cause in animals and humans. Amongst important resistance determinants, complex integrons have been implicated, which occur either on plasmids or integrated into the bacterial chromosome [7]. However, most integrons are contained within chromosomes, and class 1 integrons are one of the single biggest contributors to MDR infections, carrying resistance to many antibiotics
0924-8579/$ – see front matter © 2007 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved. doi:10.1016/j.ijantimicag.2007.03.017
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
in diverse pathogens on a global scale [8]. Because integrons have been integrated into the chromosomal DNA, they are able to persist even in the absence of antimicrobial selection and this has led to the stable and widely disseminated clones of MDR S. Typhimurium [9,10]. Much prevention and control of salmonellosis depends on early outbreak recognition through a suitable surveillance system. The value of phenotypic typing methods as surveillance tools is well established, and DNA fingerprinting is often used in outbreak investigations in which enhanced strain discrimination is required. A number of DNA-based fingerprinting methods, including pulsed-field gel electrophoresis (PFGE) are available. The latter is often considered the gold standard for molecular subtyping of Salmonella strains [11–15]. The aim of this study was to determine the antimicrobial resistance phenotypes (R-types), class 1 integron carriage, genes coding for resistance and DNA fingerprinting of Salmonella isolates. First, resistance to combinations of several classes of antimicrobials was elucidated and the resistance factors involved were determined. Then, XbaI-generated macrorestriction fingerprints were analysed to determine the chromosome profiles and hence to establish relationships among the strains. Finally, the temporal and spatial distribution of resistance determinants was established.
151
2.2. Determination of minimum inhibitory concentrations (MICs) Antimicrobial susceptibility was assayed by the agar dilution method on Mueller–Hinton agar (Oxoid Ltd., Basingstoke, UK) plates following the guidelines of the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards (NCCLS)) [16]. Strains were tested for sensitivity to ampicillin, chloramphenicol, streptomycin, sulfamethoxazole, oxytetracycline and kanamycin (Km). The MIC range tested was 1–512 g/mL for all the antimicrobial agents. MIC breakpoints were those established by the NCCLS [16]. 2.3. Bacterial DNA preparation and detection of resistance determinants Isolates were cultured on brain–heart infusion agar (Eiken Chemical Co., Tokyo, Japan). All DNA templates were prepared by the boiling method as described previously [17]. Detection of integrons and antimicrobial resistance genes was performed by polymerase chain reaction as described previously [17]. Amplifications were carried out using the primers listed in Table 1. 2.4. PFGE
2. Materials and methods 2.1. Origin of bacterial strains, isolation and identification Salmonella Typhimurium strains were involved in 31 cases of salmonellosis in cattle in the southern part of Japan Main Islands during 1989–2004. Initially, the infections were diagnosed by field veterinarians, followed by isolation, identification and serotyping of Salmonella spp. at the Prefecture Animal Health Center. In addition, one isolate was recovered from a cattle barn and another was isolated from an asymptomatic carrier.
Salmonella embedded in agarose plugs was prepared by the previously described method [24]. One-third of the plug slice was digested using 100 L of restriction enzyme mixture containing 30 U of XbaI (Toyobo Biochemicals, Tokyo, Japan). PFGE was performed using a CHEF-DR III system (Bio-Rad, Hercules, CA). The running conditions were 6 V/cm at 14 ◦ C for 22 h with pulse times ramped from 5 s to 50 s. A lambda ladder was used as the molecular size marker, and standardisation of the DT104 genotype employed DT104 strain 300-98. The gels were stained with 1 g/mL ethidium bromide and the images were interpreted by the criteria suggested by Tenover et al. [13].
Table 1 Polymerase chain reaction primers and conditions Gene or region
Primer sequence
Reference
Size (bp)
Ta (◦ C)
intI1 5 CS3 CS blaTEM blaOXA-1 blaPSE-1 floR catA1 aadA1a aadA2 tetA tetB tetG aphA1-Iab
F-(CCTCCCGCACGATGATC), R-(TCCACGCATCGTCAGGC) F-(GGCATCCAAGCAGCAAG), R-(AAGCAGACTTGACCTGA) F-(GCACGAGTGGGTTACATCGA), R-(GGTCCTCCGATCGTTGTCAG) F-(ACCAGATTCAACTTTCAA), R-(TCTTGGCTTTTATGCTTG) F-(TTTGGTTCCGCGCTATCTG), R-(TACTCCGAGCACCAAATCCG) F-(AATCACGGGCCACGCTGTATC), R-(CGCCGTCATTCTTCACCTTC) F-(CCTGCCACTCATCGCAGT),R-(CCACCG TGATATATCCC) F-(GTGGATGGCGGCCTGAAGCC), R-(AATGCCCAGTCGGCAGCG) F-(TGTTGGTTACTGTGGCCGTA), R-(GCTGCGAGTTCCATAGCTTC) F-(GCTACATCCTGCTTGCCTTC), R-(CATAGATCGCCGTGAAGAGG) F-(TTGGTTAGGGGCAAGTTTTG), R-(GTAATGGGCCAATAACACCG) F-(GCTCGGTGGTATCTCTGCTC), R-(AGCAACAGAATCGGGAACAC) F-(AAACGTCTTGCTCGAGGC), R-(CAAACCGTTATTCATTCGTGA)
[18] [19] [20] [21] [22] [23] [19] [19] [22] [22] [22] [22] [17]
280 Variable 310 598 586 215 623 526 381 210 659 468 500
59 55 60 53 62 62 60 68 59 64 64 59 55
F, forward; R, reverse; Ta , annealing temperature.
152
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
Table 2 Antimicrobial susceptibility among Salmonella enterica serotype Typhimurium isolates Drug
Ampicillin Chloramphenicol Streptomycin Sulfamethoxazole Oxytetracycline Kanamycin
No. of isolates at MIC (g/mL) 1
2
0
2 0
0
1
8
16
32
64
128
256
≥512
0 5 0
0 0 1
0 0 0 0
0 0 0 1
14
3
1
0
0 0 0 0 0 0
0 0 0 0 1 0
0 0 2 0 10 0
31 28 30 32 22 14
4
Breakpoint (g/mL)
No. of resistant isolates (%)
32 32 16 512 16 64
31 (93.9) 28 (84.8) 32 (97.0) 32 (97.0) 33 (100) 14 (42.4)
MIC, minimum inhibitory concentration.
3. Results 3.1. Antimicrobial susceptibility profiles A total of 33 S. Typhimurium strains were isolated and categorised into Groups A, B and C based on temporal trends of resistance factors. The groups comprised 13, 9 and 11 isolates recovered during 1989–1992, 1993–1996 and 1997–2004, respectively. Resistance to at least three antimicrobials tested was detected in 97% of strains (32/33), whereas one isolate was resistant to oxytetracycline and kanamycin. Approximately 94% of the strains were resistant to ampicillin, 84.8% to chloramphenicol, 97% both to streptomycin and sulfamethoxazole, 100% to oxytetracycline and 42.4% to kanamycin (Table 2). Five R-types were observed. Thirteen hexa-resistant strains (Group A,
n = 12; Group C, n = 1) belonged to R-type ACSSuTKm, whilst 15 penta-resistant strains (Group B, n = 9; and Group C, n = 6) belonged to R-type ACSSuT. Three isolates (Group C) had R-type ASSuT, whilst one strain each had R-type SSuT (Group C) and R-type T-Km (Group A) (Table 3). 3.2. Distribution of integrons and resistance genes Thirty isolates (90.9%) harboured the class 1 integrasespecific intI1 gene (Table 3). Class 1 integron conserved segment (CS) amplicons ranging from 1.0 kb to 1.9 kb were detected in 18 isolates (54.5%). Ten (66.7%) of the 15 pentaresistant isolates yielded two CS amplicons of 1.0 kb and 1.2 kb, one isolate had a 1.0 kb amplicon and two isolates yielded 1.9 kb CS amplicons. All three tetra-resistant isolates
Fig. 1. (A) Spatial distribution of β-lactamases among Salmonella enterica serotype Typhimurium strains. For isolates with two or more genes, there is shading of the circle for each gene present. (B) Distribution of genes coding for tetracycline efflux proteins.
Table 3 Summary analysis of resistance (R) types, pulsed-field gel electrophoresis (PFGE) patterns and resistance factors of Salmonella enterica serotype Typhimurium isolates from cattle Straina,b
a b
1989 1989 1989 1989 1989 1990 1990 1990 1991 1991 1992 1992 1992 1993 1994 1994 1995 1995 1996 1996 1996 1996 2000 2000 2000 2000 2001 2001 2001 2001 2001 2002 2004
R-type
ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km ACSSuT-Km T-Km ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ASSuT ASSuT SSuT ASSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT ACSSuT-Km
PFGE pattern
IVc IVa IVe IVa IVb IVd IVd IVb IIIa IIIb IIIa IIb IIc Ia Ib Ib Ia Ia Ia Ia Ia Ia IIa IIa IIb IIa IIc Ib Ib IIc IIc IIc V
Resistance determinants intI1
5 CS-3 CS
blaOXA−1
blaTEM
blaPSE−1
floR
catA1
aadA1a
aadA2
tetA
tetB
tetG
aphA1-Iab
+ + + + + + + + − + + + − + + + + + + + + + + + − + + + + + + + +
− − − − − − − − − − − − − 1.0,1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0, 1.2 1.0 1.7 1.7 − 1.7 1.9 1.0, 1.2 1.0, 1.2 1.0 1.9 − 1.0, 1.7
+ + − + − + + − + + − + − − − − − − − − − − − + − + − − + − + + −
− + + − + + + + + + − − − − − − − − − − − − + + − − − − − − + − +
− − − − − − + − − − − − − + + + + + + + + + − − − − − + + + − − +
+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +
+ + + + + + + + + + + + − − − − − − − − − − − − − − + − − − + + +
+ − − + − + + − + + − + − + + + + + + + + + + + − + + + + + + + +
− − − − − − − − − − − − − + + + + + + + + + − − − − + + + + + + −
− − − + − − − − − − − − − − − − − − − − − − + + + + − − − − − + +
+ + + + + + + + + + + + + − − − − − − − − − − − − − − − − − + − −
− − − − − − − − − − − − − + + + + + + + + + − − − − − + + + − − +
+ + + + + + + + + + + + + − − − − − − − − − − − − − − − − − − − +
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
ST1 ST2 ST3 ST4 ST5 ST6 ST10 ST11 ST12 ST13 ST14 ST16 ST17 ST19 ST20 ST21 ST22 ST25 ST26 ST27 ST28 ST29 ST32 ST33 ST35 ST36 ST37 ST38 ST39 ST40 ST41 ST42 ST45
Year
All samples were diagnostic submissions except ST27 (environmental) and ST33 (asymptomatic carrier). Group A included strains isolated during the time period 1989–1992, Group B 1993–1996 and Group C 2000–2004.
153
154
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
had one amplicon of 1.7 kb, whereas one hexa-resistant strain had two amplicons of 1.0 kb and 1.7 kb (Table 3). Resistance genes were variably detected among the groups. blaOXA−1 and blaTEM were confined to Groups A and C, whilst blaPSE−1 was predominant in Group B. floR was present in all isolates, whilst catA1 was mostly detected in Group A. aadA1 and aadA2 were detected in all pentaresistant strains in Groups B and C. The distribution of the remaining genes also followed characteristic trends, with Group A predominated by tetB, whereas tetG was abundantly present in Group B and to a lesser extent in Group C. aphA1 was detected in all kanamycin-resistant isolates. The spatial distribution of genes encoding ampicillin and oxytetracycline resistance formed defined trends (Fig. 1). A high frequency of blaTEM , blaOXA-1 , tetA and tetB was observed in the western part of the islands, whilst blaPSE-1 and tetG were abundant towards the eastern part. However, a few foci of blaPSE−1 and tetG were also rarely intermingled within the western part. 3.3. Karyotype profile analysis Analysis of the DNA fingerprints by PFGE revealed five major types (Table 3) as represented by the selected genotypes (Fig. 2). Minor variations within five predominant banding patterns led to further division into 13 subtypes. Group A isolates showed pattern types II, III and IV, whilst Group B isolates displayed a type I profile, designated as the common pattern with the chromosome profiles of seven of nine isolates indistinguishable from the banding pattern displayed by standard DT104 strain. Group C isolates displayed banding pattern types I, II and V (Table 3).
Fig. 2. Genotypes of selected Salmonella enterica serotype Typhimurium strains, demonstrating the five XbaI macrorestriction pulsed-field gel electrophoresis (PFGE) patterns. PFGE analysis of S. Typhimurium genotypes were classified as described in Section 3.3. Lane 1, standard S. Typhimurium DT104 strain 300-98; lanes 2–10, XbaI PFGE patterns representing as types Ia, Ib, IIb, IIc, IIIa, IIIb, IVa, IVb and V, respectively.
4. Discussion The present study was conducted to gain a better understanding of the distribution of resistance determinants and relationships among non-DT104 and DT104-like S. Typhimurium strains. The primary findings were that during 1989–1992, all S. Typhimurium isolated in the southern part of Japan Main Islands were non-DT104 strains as they were negative for the CS amplicons of 1.0 kb and 1.2 kb class 1 integrons and they displayed a hexa-resistant R-type rather than the typical penta-resistance pattern of S. Typhimurium DT104 strains. Then, during the interval 1993–1996, S. Typhimurium DT104-like strains predominated, displaying the characteristic penta-resistant R-type with two class 1 integron amplicons of 1.0 kb and 1.2 kb. Although we did not determine the phage types of the isolates, their MDR profiles and DNA fingerprinting results showed that most of the strains were genetically similar to S. Typhimurium DT104 standard strain 300–98. This implies that the clonal line was disseminated among cattle herds in the study area from around 1993. During 1997–2004, MDR S. Typhimurium were observed with an increased size of class 1 integrons to 1.7 kb and 1.9 kb, compared with 1.0 kb and 1.2 kb previously observed. The increased size of the integrons was evidence of integration of extra gene cassettes, because in addition to the former blaPSE−1 gene commonly possessed by DT104 lineage, blaOXA−1 was also found in one strain originating from the same line. In the present study, we also showed that the temporal distribution of resistance factors followed particular trends with time. Resistance to ampicillin was determined by blaOXA−1 and blaTEM during 1989–1992. Then, during the period 1993–1996 resistance was mainly conferred by blaPSE−1 and thereafter various combinations of the genes were observed. Furthermore, aadA1 was the only streptomycin resistance gene detected during the early period, whilst during the middle and late periods both aadA1 and aadA2 were simultaneously present. A similar trend was evident with oxytetracycline resistance genes, such that tetB was dominant at the beginning, followed by tetG, although tetA and tetB were also infrequently observed especially during the late period. This can be explained by the fact that in DT104 complex, multidrug resistance is due to chromosomal integration of a 43 kb structure called Salmonella genomic island 1 (SGI1) carrying multiple resistance gene cassettes in complex class 1 integrons [10,24–27]. Analysis of class 1 integrons combined with DNA fingerprints showed that Group A isolates did not belong to the DT104 complex. In contrast, we observed blaPSE−1 occurring together with aadA2 and tetG particularly in Group B and C isolates, and a similar occurrence has been reported previously in other DT104 strains [28,29]. Moreover, one isolate in Group C yielded two class 1 integron amplicons of 1.0 kb and 1.7 kb carrying tetA and tetG simultaneously. This finding was further evidence of bacterial gene cassette integration and supported the observation that
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
recent appearance of larger integrons could signify enhanced capability of integrating additional resistance factors. Analysis of PFGE fingerprints revealed trend variability, such that during the interval 1989–1992 chromosome profiles of the majority of isolates deviated from the common pattern (type I), implying that they had different origins and were probably epidemiologically unrelated. In contrast, isolates recovered during the period 1993–1996 displayed an indistinguishable pattern to each other, signifying that they shared the same lineage and were epidemiologically related. Thereafter, banding patterns closely resembling those observed during 1993–1996 re-emerged, indicating that they were possibly related genetically but were less likely to be related epidemiologically. Moreover, the last isolate to be recovered was probably unrelated by descent to any of the genetic lines revealed previously because of a significant deviation of the observed banding pattern. To conclude, both DT104-related and non-DT104 strains of S. Typhimurium prevailed in Japan in different time periods and among them multidrug resistance was the rule. It will be important to survey further the occurrence of resistance phenotypes and genotypes of S. Typhimurium both in animals and humans in order to learn how they change. These trends should be followed carefully by the use of adequate subtyping methods and by the detection of resistance mechanisms.
Acknowledgments We are grateful to Drs. Haruo Watanabe and Hidemasa Izumiya of the National Institute of Infectious Diseases, Tokyo, Japan, for donating the S. Typhimurium DT104 reference strain 300-98.
References [1] Glynn MK, Bopp C, Dewitt W, Dabney P, Mokhtar M, Angulo FJ. Emergence of multidrug-resistant Salmonella enterica serotype Typhimurium DT104 infections in the United States. N Engl J Med 1998;338:1333–8. [2] Sameshima T, Akiba M, Izumiya H, et al. Salmonella typhimurium DT104 from livestock in Japan. Jpn J Infect Dis 2000;53:15–6. [3] Threlfall EJ, Frost JA, Ward LR, Rowe B. Epidemic in cattle and humans of Salmonella typhimurium DT104 with chromosomally integrated multiple drug resistance. Vet Rec 1994;134:577. [4] Threlfall EJ, Frost JA, Ward LR, Rowe B. Increasing spectrum of resistance in multiresistant Salmonella typhimurium. Lancet 1996;347:1053–4. [5] Izumiya H, Mori K, Kurazono T, et al. Characterization of isolates of Salmonella enterica serovar Typhimurium displaying high-level fluoroquinolone resistance in Japan. J Clin Microbiol 2005;43:5074–9. [6] Esaki H, Morioka A, Ishihara K, et al. Antimicrobial susceptibility of Salmonella isolated from cattle, swine and poultry (2001–2002): report from the Japanese Veterinary Antimicrobial Resistance Monitoring Program. J Antimicrob Chemother 2004;53:266–70. [7] Goldstein C, Lee MD, Sanchez S, et al. Incidence of class 1 and 2 integrases in clinical and commensal bacteria from livestock, companion animals, and exotics. Antimicrob Agents Chemother 2001;45:723–6.
155
[8] Stokes HW, Nesbo CL, Holley MB, Bahl MI, Gillings MR, Boucher Y. Class 1 integrons potentially predating the association with Tn402-like transposition genes are present in a sediment microbial community. J Bacteriol 2006;188:5722–30. [9] Chen S, Zhao S, White DG, et al. Characterization of multipleantimicrobial-resistant Salmonella serovars isolated from retail meats. Appl Environ Microbiol 2004;70:1–7. [10] Boyd D, Cloeckaert A, Chaslus-Dancla E, Mulvey MR. Characterization of variant Salmonella genomic island 1 multidrug resistance regions from serovars Typhimurium DT104 and Agona. Antimicrob Agents Chemother 2002;46:1714–22. [11] Arbeit RD. Laboratory procedures for the epidemiologic analysis of microorganisms. In: Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, editors. Manual of clinical microbiology. 6th ed. Washington, DC: American Society for Microbiology; 1995. p. 190–208. [12] Olsen JE, Skov MN, Threlfall EJ, Brown DJ. Clonal lines of Salmonella enterica serotype Enteritidis documented by IS200-, ribo-, pulsed-field gel electrophoresis and RFLP typing. J Med Microbiol 1994;40:15–22. [13] Tenover FC, Arbeit RD, Goering RV, et al. Interpreting chromosomal DNA restriction patterns produced by pulsed-field gel electrophoresis: criteria for bacterial strain typing. J Clin Microbiol 1995;33:2233–9. [14] Swaminathan B, Barrett TJ, Hunter SB, Tauxe RV; CDC PulseNet Task Force. PulseNet: the molecular subtyping network for foodborne bacterial disease surveillance, United States. Emerg Infect Dis 2001;7:382–9. [15] Goering RV. Pulsed-field gel electrophoresis. In: Persing DH, Tenover FC, Versalovic J, et al., editors. Molecular microbiology: diagnostic principles and practice. Washington, DC: ASM Press; 2004. p. 185–96. [16] National Committee for Clinical Laboratory Standards. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals. 2nd ed. Approved Standard M31-A2. Wayne, PA: NCCLS; 2002. [17] Shahada F, Chuma T, Tobata T, Okamoto K, Sueyoshi M, Takase K. Molecular epidemiology of antimicrobial resistance among Salmonella enterica serovar Infantis from poultry in Kagoshima, Japan. J Antimicrob Agents 2006;28:302–7. [18] Valverde Romero E, Parras Padilla T, Garc´ıa Garc´ıa MI, et al. Salmonella enterica serovar Infantis producing a CTX-M-9 lactamase. Antimicrob Agents Chemother 2005;49:2142–3. [19] Guerra B, Soto SM, Arguelles JM, Mendoza MC. Multidrug resistance is mediated by large plasmids carrying a class 1 integron in the emergent Salmonella enterica serotype [4,5,12:i:-]. Antimicrob Agents Chemother 2001;45:1305–8. [20] Carlson SA, Bolton LF, Briggs CE, et al. Detection of multiresistant Salmonella typhimurium DT104 using multiplex and fluorogenic PCR. Mol Cell Probes 1999;13:213–22. [21] Gallardo F, Ruiz J, Marco F, Towner KJ, Vila J. Increase in incidence of resistance to ampicillin, chloramphenicol and trimethoprim in clinical isolates of Salmonella serotype Typhimurium with investigation of molecular epidemiology and mechanisms of resistance. J Med Microbiol 1999;48:367–74. [22] Ng L-K, Mulvey MR, Martin I, Peters GA, Johnson W. Genetic characterization of antimicrobial resistance in Canadian isolates of Salmonella serovar Typhimurium DT104. Antimicrob Agents Chemother 1999;43:3018–21. [23] Bolton LF, Kelley LC, Lee MD, Fedorka-Cray PJ, Maurer JJ. Detection of multidrug-resistant Salmonella enterica serotype typhimurium DT104 based on a gene which confers cross-resistance to florfenicol and chloramphenicol. J Clin Microbiol 1999;37:1348–51. [24] Akiba M, Uchida I, Nishimori K, et al. Comparison of Salmonella enterica serovar Abortusequi isolates of equine origin by pulsed-field gel electrophoresis and the fluorescent amplified-fragment length polymorphism fingerprinting. Vet Microbiol 2003;93:379–88. [25] Boyd D, Peters GA, Cloeckaert A, et al. Complete nucleotide sequence of a 43-kilobase genomic island associated with the multidrug resistance region of Salmonella enterica serovar Typhimurium DT104 and its identification in phage type DT120 and serovar Agona. J Bacteriol 2001;183:5725–32.
156
F. Shahada et al. / International Journal of Antimicrobial Agents 30 (2007) 150–156
[26] Boyd DA, Peters GA, Ng LK, Mulvey MR. Partial characterization of a genomic island associated with the multidrug resistance region of Salmonella enterica Typhimurium DT104. FEMS Microbiol Lett 2000;189:285–91. [27] Doublet B, Boyd D, Mulvey MR, Cloeckaert A. The Salmonella genomic island 1 is an integrative mobilizable element. Mol Microbiol 2005;55:1911–24.
[28] Threlfall EJ, Hopkins KL, Ward LR. Diversification in Salmonella Typhimurium DT 104. Emerg Infect Dis 2005;11:980–1. [29] Weill F-X, Guesnier F, Guibert V, et al. Multidrug resistance in Salmonella enterica serotype Typhimurium from humans in France (1993–2003). J Clin Microbiol 2006;44:700–8.