Antioxidant peptides derived from the hydrolyzate of purple sea urchin (Strongylocentrotus nudus) gonad alleviate oxidative stress in Caenorhabditis elegans

Journal of Functional Foods 48 (2018) 594–604

Contents lists available at ScienceDirect

Journal of Functional Foods journal homepage: www.elsevier.com/locate/jff

Antioxidant peptides derived from the hydrolyzate of purple sea urchin (Strongylocentrotus nudus) gonad alleviate oxidative stress in Caenorhabditis elegans

T

Sixu Zhaoa, Qiong Chenga, Qiong Penga, Xuesong Yua,c, Xiquan Yinb, Ming Liangb, ⁎ Chung Wah Mab, Zebo Huanga,d, Weizhang Jiaa,c, a

Center for Bioresources and Drug Discovery & School of Biosciences and Biopharmaceutics, Guangdong Pharmaceutical University, Guangzhou 510006, China Research and Development Center, Infinitus (China) Company Ltd., Guangzhou 510665, China Guangdong Province Key Laboratory for Biotehnology Drug Candidates, Guangdong Pharmaceutical University, Guangzhou 510006, China d School of Food Science and Engineering, South China University of Technology, Guangzhou 510641, China b c

A R T I C LE I N FO

A B S T R A C T

Keywords: Antioxidant peptide Oxidative stress Reactive oxygen species Purple sea urchin Strongylocentrotus nudus Caenorhabditis elegans

The papain hydrolyzate prepared from purple sea urchin (Strongylocentrotus nudus) gonad exerts significant antioxidant activity. Through ultrafiltration, gel filtration and high performance liquid chromatography, the active fractions from the hydrolyzate were screened by alleviating paraquat-induced oxidative stress in Caenorhabditis elegans, and the peptide components were identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS). Two antioxidant peptides SnP7 (AAVPSGASTGIYEALELR, 1805.03 Da) and SnP10 (NPLLEAFGNAK, 1173.34 Da) exhibit significant antioxidant capacity, which reduce reactive oxygen species (ROS) level and the expression of superoxide dismutase-3 (SOD-3) and heat shock protein-16.2 (HSP-16.2) in oxidation-damaged nematodes. Further studies indicated that SnP7 and SnP10 induce DAF-16 nuclear translocation and the expression of stress-related genes such as sod-3. RNA interference (RNAi) suggested that peptideinduced enhancement of resistance is dependent on DAF-16. Taken together, S. nudus antioxidant peptides might act through activate DAF-16 signaling pathway, and induce the expression of DAF-16 target genes that enhance antioxidant potential of organisms.

1. Introduction Aging is a multifactorial process of progressive decline in biological function that accompanies with an increased risk for the development of age-related diseases (Beckman & Ames, 1998; Si & Liu, 2014). The free radical theory of aging, first articulated by Denham Harman in 1956, proposes that the accumulation of oxidative damage caused by reactive oxygen species (ROS) is a major contributor to the aging process (Beckman & Ames, 1998; Harman, 1956). Nevertheless, researches have suggested that ROS are not only toxic by-products of cellular normal metabolic processes, but also are signaling molecules involved in normal physiological processes in organisms (D'Autréaux & Toledano, 2007; Halliwell & Gutteridge, 2007). Under normal physiological conditions, ROS are continuously generated inevitably and efficiently scavenged by endogenous antioxidant defense systems, including superoxide dismutases (SODs), glutathione peroxidases (GPx),

glutathione transferases (GSTs) and catalases (CATs) (Back, Braeckman, & Matthijssens, 2012; Matés, 2000). Once abnormally high production of ROS disrupts the balance with the cellular antioxidant system leading to oxidative stress, and the resulting redox imbalance emerges as a potentially important pathogenic factor in the development of a range of disorders including cancer, diabetes, Alzheimer's disease and atherosclerosis (Moon & Shibamoto, 2009; Si & Liu, 2014). Therefore, the scavenging and detoxification of excess ROS are important for maintenance of cellular homeostasis. There are many evolutionarily conserved signaling pathways that involved in the regulation of antioxidant defenses of organisms (Back et al., 2012). For instance, the insulin/insulin like growth factor (IGF) signaling (IIS) cascade, as a nutrient-sensing pathway, is important for the aging process and stress resistance in a wide range of organisms (Giannakou & Partridge, 2007; Havermann, Chovolou, Humpf, & Wätjen, 2014; Soerensen et al., 2010). The transcription factor DAF-16,

⁎ Corresponding author at: Center for Bioresources and Drug Discovery & School of Biosciences and Biopharmaceutics, Guangdong Pharmaceutical University, Guangzhou 510006, China. E-mail address: [email protected] (W. Jia).

https://doi.org/10.1016/j.jff.2018.07.060 Received 30 March 2018; Received in revised form 13 June 2018; Accepted 30 July 2018 1756-4646/ © 2018 Elsevier Ltd. All rights reserved.

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

(Beijing, China). Acetonitrile was of liquid chromatography (LC) grade from Merk Co. (Darmstadt, Germany). 1,1′-dimethyl-4,4′-bipyridinium dichloride (Paraquat, PQ), 5-fluoro-2′-deoxyuridine (5-FUdR), isopropyl-beta-D-thiogalactopyranoside (IPTG) and 1,1-diphenyl-2-picrylhydrazyl (DPPH) were bought from Sigma-Aldrich Co. (St. Louis, USA). TRIzol reagent was purchased from Invitrogen (Carlsbad, USA). PrimeScript™ RT reagent kit with gDNA Eraser and SYBR Premix Ex Taq™ assay kit were purchased from Takara (Dalian, China). The bicinchoninic acid (BCA) protein assay kit was purchased from Beyotime (Shanghai, China). The water was prepared from a mili-Q-ultrapure water purification system purchased from Milipore (Billerica, USA). Ethyl alcohol and other chemicals used in this study were of analytical grade and obtained from Guangzhou Chemical Reagent Co. (Guangzhou, China).

Caenorhabditis elegans ortholog of the mammalian FOXO proteins, is the canonical transcriptional target of the IIS signaling pathway, and upregulation of daf-16 target genes, such as sod-3 and hsp-16.2, could increase oxidative stress resistance in C. elegans (Shi, Yu, Liao, & Pan, 2012). Correlated oxidative stress resistance is also observed in C. elegans with the activated transcription factor SKN-1, which is the C. elegans functional ortholog of the mammalian Nrf transcription factors (Blackwell, Steinbaugh, Hourihan, Ewald, & Isik, 2015). Transcriptome profiling analysis revealed that SKN-1 induces expression of a wide variety of detoxification genes including the known SKN-1 targets gst-4 and gst-10 (Oliveira et al., 2009). Therefore, the transcription regulators DAF-16 and SKN-1 play pivotal roles in signal integration from several pathways and then regulate their downstream target genes to activate the conserved detoxification responses (Blackwell et al., 2015; Wu, Deonarine, Przybysz, Strange, & Choe, 2016). At present, a number of natural compounds, such as peptides, polysaccharides and flavonoids, have been shown to possess significant antioxidant activities against oxidative stress (Asthana, Mishra, & Pandey, 2016; Sarmadi & Ismail, 2010; Wang et al., 2016; Zhang et al., 2016). Specific attention has thus to be paid on the use of natural antioxidants to mitigate oxidative damage through regulation of stress-related signaling pathways (Havermann et al., 2014; Zhang et al., 2016). In recent years, the significance of food proteins in diet has been increasingly recognized because of the various physiological functionalities of peptides that have a positive impact on body functions and may ultimately influence health (Power, Jakeman, & Fitzgerald, 2013; Sila, & Bougatef, 2016; Udenigwe, & Howard, 2013). Marine-derived peptides have drawn much attention due to their diverse biological activities such as antitumor (Huang, Jing, Ding, & Yang, 2017), neuroprotective (Ryu & Kim, 2013), antihypertensive (Neves et al., 2017) and antioxidant activities (Neves et al., 2017; Sila & Bougatef, 2016). Enzymatic hydrolysis of protein is an effective way to prepare active peptide (Ambigaipalan & Shahidi, 2017; Udenigwe, Udechukwu, Yiridoe, Gibson, & Gong, 2016). Marine products and by-products serve as important protein sources that can be used for enzymatic synthesis of various functional peptides with high potential nutraceutical and medicinal values (Klompong, Benjakul, Kantachote, & Shahidi, 2007; Sila & Bougatef, 2016). Purple sea urchins (Strongylocentrotus nudus) is one of the most important marine economic animals, and its gonad has long been used as a food nutraceutical in many countries. The hydrolysates of S. nudus gonad have been reported to possess significant antioxidant activity in vitro, which have the potential to be applied as natural antioxidant agents (Qin et al., 2011; Zhou et al., 2012). Nevertheless, little is known about the antioxidant effects of the hydrolysates from S. nudus gonad in vivo, neither about the information of peptide sequence characteristics in the hydrolysates. In this study, using C. elegans that is an advantageous model organism to study various physiological processes (Havermann et al., 2014; Rea, Wu, Cypser, Vaupel, & Johnson, 2005), we investigated the action mechanism of antioxidant peptides separated and identified from the hydrolyzate of S. nudus gonad.

2.2. Strains and maintenance The following C. elegans strains were used in this study: Bristol N2 (wild-type), GR1352 {xrIs87[daf-16(alpha)::GFP::daf-16B + rol6(su1006)]}, LG345 {geIs9[gpa-4p::skn-1b::GFP + rol-6(su1006)]}, CF1553 {muIs84 [(pAD76) sod-3p::GFP + rol-6(su1006)]} and CL2070 {dvIs70 [pCL25 (hsp-16.2p::GFP)+pRF4 (rol-6 (su1006))]}. Escherichia coli strains OP50, NA22 and HT115 were used as food sources for the nematodes as appropriate. All C. elegans and E. coli strains were obtained from the Caenorhabditis Genetics Center (University of Minnesota, Minneapolis, MN, USA). Nematodes were maintained at either 15 °C or 20 °C on Nematode Growth Medium (NGM) agar plates containing E. coli strain OP50 supplemented with 5 μg/mL of cholesterol. Synchronization of nematodes was performed using the standard alkaline hypochlorite method. The synchronized L1-stage growth-arrested larvae were obtained by hatching eggs in M9 medium overnight with shaking. 2.3. Preparation of the protein hydrolysates of sea urchin gonad

2. Materials and methods

The freeze-dried homogenate was dissolved in deionized water (50 mg/mL) and hydrolyzed using papain and trypsin for single or stepwise dual-enzymatic hydrolysis, respectively. The enzymolysis conditions were performed as previously described with minor modifications (Qin et al., 2011): papain at 55 °C, pH 7.0, and hydrolyzed for 4 h; trypsin at 40 °C, pH 8.0 and hydrolyzed for 4 h. As for the condition of dual-enzymatic hydrolysis: the sample was first hydrolyzed by papain at 55 °C, pH 7.0 for 4 h, then the pH was raised to 8.0 with 0.5 M NaOH, and further hydrolyzed with trypsin at 40 °C for another 4 h. The enzyme/substrate ratio was 3000 U/g. After hydrolysis, the hydrolysates were boiled immediately for 10 min to inactivate protease and added ethanol to a final concentration of 60% (v/v). The hydrolysate mixture was placed at 4 °C for 12 h and then collected the supernatant after suction filtration. The supernatant was collected by centrifugation at 6000g for 30 min at 4 °C, and further evaporated under reduced pressure in a rotary evaporator (Yarong, Shanghai, China) at 35 °C for removal of ethanol. The final aqueous solution was freeze-dried and stored at −20 °C until used.

2.1. Materials and chemical regents

2.4. Scavenging activity on DPPH radical

Purple sea urchins (S. nudus) were collected from the Yellow Sea of China in July 2016. After dissection, the gonad tissues were collected and mixed with deionized water at a ratio of 1:1 (W/V), and homogenized three times for 15 s at 4 °C. The homogenate was then freezedried and stored at −80 °C until used for protein enzymolysis. The papain and trypsin were purchased from Aladdin Biochemical Technology Co. (Shanghai, China). Ultrafiltration centrifuge tubes were purchased from Millipore (Bedford, USA). Sephadex G-25 (medium) was obtained from GE Healthcare Co. (Uppsala, Sweden). Trifluoroacetic acid was purchase from Solarbio Technology Co.

The DPPH free radical-scavenging activity was assayed according to the published method with minor modifications (Luo et al., 2013). In brief, a 0.1 mM solution of DPPH was freshly prepared in ethanol. 100 μL of ethanol DPPH solution was added to sample (100 μL) with the indicated concentration (1–6 mg/mL) in 96-well plates to initiate the reaction. In the blank group, the DPPH solution was substituted with ethanol. A control group containing DPPH without sample was also prepared. Discolorations were measured at 517 nm after reaction for 30 min at room temperature in the dark. The scavenging activity (%) on DPPH radical was calculated according to the following equation: 595

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Radical scavenging activity (%) = (Acontrol − Asample)/(Acontrol − Ablank) × 100.

2.8. Peptide synthesis and screening The identified peptides were synthesized by solid phase peptide synthesis in Top-Peptides biotechnology Co. Ltd (Shanghai, China). Then the synthetic peptides were further purified and detected by HPLC and MS spectra, receptively. The antioxidant activities of synthetic peptides at the concentration of 2 mM was first investigated by paraquat survival assay, then the peptides with better antioxidant activity were further tested to verified the optimal concentration among 1, 2 and 4 mM. The experimental protocol refers to 2.5.

where Acontrol, Asample and Ablank represent the absorbance of the control, the selected antioxidant sample at certain concentration, and the blank measured at 517 nm, respectively. 2.5. Paraquat survival assay Paraquat, a free radical generator, was selected as a measure of oxidative stress resistance in C. elegans (Wang et al., 2016). Synchronized L1-stage N2 nematodes were incubated at 20 °C in S. medium seeded with NA22 until L4-stage and then 75 μg/mL of 5-FUdR was added. The nematodes were transferred to 96-well plates (∼20 nematodes/well; approximately 100 nematodes for each group) containing NA22 and samples with the indicated concentration. Equal volumes of S. Medium was added to the control group. The positive control nematodes were treated with glutathione (GSH, 2 mM), which has protective effect against oxidative stress-induced damage (Homma & Fujii, 2015). After incubation for another 24 h, the nematodes were exposed to 50 mM paraquat. The live and dead nematodes were scored microscopically based on their movement every 12 h until all dead.

2.9. Measurement of ROS level The ROS level was determined using the DCFH-DA as previously described (Wu et al., 2006). Synchronized L1-stage N2 nematodes were incubated in S. medium seeded with NA22 until L4-stage and then added 75 μg/mL of 5-FUdR. The young adults nematodes were incubated with or without peptide samples for 24 h at 20 °C, then were exposed to 10 mM paraquat for another 24 h. Meanwhile, the blank group nematodes were incubated in S. medium for 48 h at 20 °C. Approximately 1,500 were collected and washed three times with M9 buffer, and then homogenized in PBST buffer (1 × PBS with 0.1% Tween 20) using a glass homogenizer. The lysates were centrifuged at 10,000g for 5 min at 4 °C. The protein concentration was determined with BCA protein assay kit. A total of 50 μL of nematodes lysate was transferred to a 96-well black microplate and incubated with 50 μL of 100 μM DCFH-DA. Fluorescence intensity (485 nm excitation and 535 nm emission) was monitored on a Fluoroskan Ascent FL Microplate Reader (Thermo Fisher Scientific, Inc., Waltham, MA, US).

2.6. Separation of antioxidant peptide fractions The papain hydrolyzate was dissolved in deionized water (20 mg/ mL) and separated into > 10, 3–10 and < 3 kDa fractions using the ultrafiltration tubes with Molecular Weight Cut Off (MWCO) of 10 and 3 kDa. These fractions were collected and freeze-dried for paraquat survival assay at the concentration of 2 mg/mL. The active fraction (MW < 3 kDa; 2 mL, 10 mg/mL) was further separated by loading on a Sephadex G-25 gel chromatography column (60 × 2.5 cm). The sample was eluted with deionized water at a flow rate of 2 mL/min and monitored at 280 nm with a UVD-680-4 UV detector (Jinda, Shanghai, China). Four fractions (F1, F2, F3 and F4) were collected and freezedried for paraquat survival assay at the concentration of 2 mg/mL. The active fraction F1 (0.5 mL, 20 mg/mL) was further separated by reversephase high performance liquid chromatography (RP-HPLC) (LC-3000, CXTH Science & Technology Co., Ltd., Beijing, China) on a Elite C18 column (4.6 × 250 mm, 5 μm, Elite Co. Ltd., Dalian, China) using a linear gradient of acetonitrile (5–30% in 5–20 min) containing 0.1% trifluoroacetic acid at a flow rate of 0.8 mL/min. The eluate was analyzed at 214 nm, and six fractions (F1a, F1b, F1c, F1d, F1e and F1f) were collected and freeze-dried for activity analysis.

2.10. Determination of SOD-3 and HSP-16.2 expression levels The transgenic C. elegans CF1553 expressing sod-3::GFP reporter and CL2070 expressing hsp-16.2::GFP reporter were employed to detect SOD-3 and HSP-16.2 expression levels as described (Asthana et al., 2016; Strayer, Wu, Christen, Link, & Luo, 2003). The synchronized L1stage nematodes were treated with or without peptide samples until L4stage at 20 °C, and then exposed to 10 mM paraquat for another 24 h. To visually observe sod-3::GFP and hsp-16.2::GFP expression, the nematodes were incubated with M9 buffer containing 1% sodium azide and fluorescence images were acquired using a Zeiss Axio Observer with ZEN software (Carl Zeiss, Jena, Germany). To quantify sod-3::GFP and hsp-16.2::GFP expression levels, the fluorescence intensities were determined by using Image-J software (National Institute of Health, USA. NIH).

2.7. Identification of peptide sequences by LC-MS/MS

2.11. Nuclear localization assays of DAF-16 and SKN-1

The amino acid sequences of the peptides in F1a, which has better antioxidant activity, were identified by liquid chromatography-tandem mass spectrometry using a reverse-phase nanocolumn (RP-nano-LCMS/MS). Briefly, the desalted sample was redissolved in solvent A (water/acetonitrile/formic acid, 98:2:0.1, v/v/v) and loaded on an analytical column (75 μm × 15 cm C18, 3 μm, 120 Å, ChromXP Eksigent) for nano-LC separation at a flow rate of 300 nL/min. Then, the gradient elution was performed with 5 to 80% solvent B (water/ acetonitrile/formic acid, 2:98:0.1, v/v/v). LC-MS/MS analysis was performed with a Triple TOF 5600 System fitted with a Nanospray III source (AB SCIEX, Concord, ON, Canada). All raw data files (*.wiff) were collectively searched with Protein Pilot Software v. 4.5 (AB SCIEX, Foster City, California, USA) against a protein database of S. nudus, which translated from the raw sequencing data that have been submitted to the Short Read Archive (SRA) of NCBI under accession number SUB3619287. A threshold of confidence above 95% and a local false discovery rate (FDR) of less than 1% were used for peptide identification.

The transgenic C. elegans GR1352 expressing DAF-16::GFP reporter and LG345 expressing SKN-1::GFP reporter were used to detect nuclear localization of DAF-16 and SKN-1, respectively. The synchronized L1stage nematodes were first incubated for 24 h at 20 °C, and then treated with or without peptide samples for 24 h at 20 °C. Meanwhile, the GR1352 and LG345 nematodes of positive control were treated with paraquat at a final concentration of 25 mM for 1.5 h and 35 Mm for 2 h, respectively, when reach L4-stage (Wu et al., 2016, 2017). For each group, images of 30 nematodes were acquired using a Zeiss Axio Observer with ZEN software. The ratio of nematodes with GFP nuclear localization were calculated based on the discrete fluorescent aggregate phenotype in the nematodes as previously described (Shi et al., 2012; Wu et al., 2016). 2.12. Real-time PCR Synchronized L1-stage N2 nematodes were incubated in S. medium containing NA22 for 24 h at 20 °C, and then incubated with peptide 596

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Table 1 Primers used for expression and RNAi studies. Gene name

Forward Primer (5′–3′)

Reverse Primer (5′–3′)

Annealing temperature (°C)

Fragment size (bp)

Application

β-actin sod-3 gst-4 gst-10 hsp-16.2 hsp-6 daf-16

CCACGAGACTTCTTACAACTCCATC GAGCTGATGGACACTATTAAGCG TCAAAGCTGAAGCCAACGAC TGGGAAGAGTTCATGGCTTG CTCCATCTGAGTCTTCTGAGATTGT GGACGCTGGAGATAAGATCATCG TGCTCTAGACTCGATCCGTCACAATCTGTC

CTTCATGGTTGATGGGGCAAGAG GCACAGGTGGCGATCTTCAAG GCAGTTTTTCCAGCGAGTCCA CGGGATGGTTTTGTTGACAC CTCCTTGGATTGATAGCGTACGA CAACGAGGTGATGGACGAGAG CGGGGTACCAGCTGGAGAAACACGAGACGA

59 59 59 59 59 59 58

157 149 128 155 126 164 400

qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR qRT-PCR RNAi

Underlines were Xba I (TCTAGA) and Kpn I (GGTACC) sites, respectively.

can alleviate oxidative stress at different degrees. Compared with the nematodes treated with GSH, the papain hydrolyzate exhibits significant antioxidant capacity in paraquat-exposed nematodes. These results indicated that the papain hydrolyzate exerts significant antioxidant activity in vitro and in vivo, and suggesting that papain is an effective protease that can release antioxidant peptides from S. nudus gonad proteins, which is consistent with the previous study reported that gonad protein hydrolysate using papain has more significant antioxidant activity than other hydrolysates (Qin et al., 2011). Therefore, the papain hydrolyzate was selected for further separation and activity analysis.

samples for another 24 h. The samples were collected and washed three times with M9 buffer. Total RNA was extracted from the nematodes with TRIzol reagent according to the manufacturer’s instruction. After reverse transcription using the PrimeScript™ RT reagent Kit, the realtime PCR was performed on a StepOne Plus Real-Time PCR Detection System (Applied Biosystems Inc. Foster, CA, USA) using the SYBR Premix Ex Taq reagent kit. Primer sequences used for real-time PCR are listed in Table 1. 2.13. RNA interference RNA interference (RNAi) was carried out using the feeding method as described previously with some modifications (Kamath, Martinezcampos, Zipperlen, Fraser, & Ahringer, 2000). RNAi plasmids were constructed by cloning portion of daf-16 cDNA into RNAi vector (pL4440). The primer sequences are listed in Table 1. RNAi bacteria were induced with 1 mM IPTG for 2 h at 37 °C, then collected and added to 96-well plates. Synchronized L1-stage N2 nematodes were transferred to the 96-well plates (∼20 nematodes/well; approximately 100 nematodes for each group) and incubated at 20 °C until L4-stage. After adding 75 μg/mL of 5-FUdR and peptide samples, the plates were incubated for another 24 h. The nematodes were then exposed to 50 mM of paraquat for paraquat survival assay as described above.

3.2. Antioxidant activities of peptide fractions Study has shown that molecular size of peptide mixture in protein hydrolysate contributes to different functional properties, especially low MW fractions after ultrafiltration in general contained more potent antioxidant activity (Chang, Ismail, Yanagita, Esa, & Mohamad, 2015). Therefore, the papain hydrolyzate was filtered through ultrafiltration membranes with the MWCO of 10 and 3 kDa, and the fractions with MW distribution of > 10 kDa, 3–10 kDa or < 3 kDa were obtained, separately. In order to determine the fraction with better antioxidant effect in vivo, we used C. elegans to screen the peptide fraction by paraquat survival assay in the following researches. As shown in Fig. 2A, pretreatments with > 10, 3–10 or < 3 kDa peptide fractions were all capable of increasing the survival rate of the nematodes exposed to 50 mM paraquat with the < 3 kDa fraction slightly better. These results are in accord with previous report that peptide fractions with lower MW present a significant antioxidant activity in vivo (Wang et al., 2016). Therefore, the < 3 kDa fraction should be the main contributors to the antioxidant activity, and this fraction was chosen for further separation. Gel filtration chromatography is an effective separation technique on the basis of molecule size and is widely applied to separate compounds such as peptide and protein in aqueous solution, remove salt or buffer from a preparation of macromolecule (Sila & Bougatef, 2016). Considering the significant antioxidant activity of the < 3 kDa fraction, this fraction was fractionated using Sephadex-G25 gel filtration chromatography and further separated into 4 fractions (F1, F2, F3 and F4) (Fig. 2B). These fractions were pooled, freeze-dried and analyzed for their antioxidant effects in paraquat-exposed nematodes as above. As shown in Fig. 2C, pretreatments with 2 mg/mL of the fractions F1, F2 and F3 were able to increase the survival rate of the paraquat-exposed nematodes, especially fraction F1 with better antioxidant effect was selected for further separation. Throughout the ultrafiltration and gel filtration chromatography, the potential fraction F1 was prepared and subsequently purified by RPHPLC, which was widely used to separate peptide according to their structural properties, that is, large polar or hydrophilic peptides eluted earlier, while the non-polar or hydrophobic peptides eluted much later (Mant et al., 2007). The elution profile of fraction F1 was shown in Fig. 2D. Based on the elution time, 6 fractions (F1a, F1b, F1c, F1d, F1e and F1f) were collected separately through a linear gradient elution

2.14. Statistical analysis GraphPad Prism version 7.0 for Microsoft Windows (GraphPad Software, San Diego, CA, USA) was used to generate graphs and perform statistical analysis. C. elegans survival was analyzed by KaplanMeier method and log-rank test. The gene-specific primers for real-time PCR analysis were designed using Primer 3 software (http://bioinfo.ut. ee/primer3/). The transcript level of each gene was normalized with the transcript level of the internal control gene, β-actin. All experiments were performed at least three times. Probability value of p < 0.05 was considered as statistically significant. 3. Results and discussion 3.1. Antioxidant activities of the protein hydrolysates of sea urchin gonad The hydrolysates of S. nudus gonad have been reported to possess significant antioxidant activity in vitro, which can be used as a potential source of natural antioxidant (Qin et al., 2011; Zhou et al., 2012). In this study, the S. nudus gonad were hydrolyzed using papain and trypsin for single or stepwise dual-enzymatic hydrolysis, respectively. As shown in Fig. 1A, these hydrolysates have the ability of scavenging DPPH radical in a dose dependent manner at various concentration ranging from 1 to 6 mg/mL. It is noteworthy that the DPPH radical scavenging activity of papain hydrolysate (EC50 0.945 mg/mL) was significantly higher than that of trypsin (EC50 1.699 mg/mL) and dual-enzymatic hydrolysates (EC50 2.481 mg/mL). Moreover, the paraquat survival assay in C. elegans was used to study antioxidant activities of these hydrolysates in vivo. As shown in Fig. 1B–D, three kinds of hydrolyzates 597

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Fig. 1. Antioxidant effects of the protein hydroysates of S. nudus gonad prepared by papain, trypsin and dualenzymatic hydrolysis in vitro and in vivo. (A) DPPH free radical scavenging activity. (B–D) Effects of the protein hydrolysates of papain, trypsin and dualenzymatic hydrolysis on survival rates of paraquat-exposed C. elegans, respectively. L4-stage N2 nematodes were pretreated with or without protein hydrolysates (0.5, 1, 2 and 4 mg/L), GSH (2 mM) at 20 °C for 24 h prior to exposure to 50 mM paraquat, and the survival rates were scored every 12 h until all dead. Papain hydrolate (2 mg/ mL) showed significant antioxidant activity in comparison to untreated control (p < 0.001). Results are representative of three independent experiments, and data are presented as Kaplan-Meier curves and compared for significance by the log-rank test.

At present, a number of studies have reported the antioxidant activities of peptide in vitro (Qin et al., 2011; Sila & Bougatef, 2016; Zhou et al., 2012). However, in vivo potency of an antioxidant peptide could be more meaningful than that predicted from the in vitro response (Power et al., 2013). Our results showed that SnP7 and SnP10 are novel peptides with significant antioxidant activities in vivo. It is noteworthy that the C-terminus of SnP7 and SnP10 are Arg and Lys, respectively, which are in accordance with the characteristics of the C-terminus of identified peptides from papain hydrolysates (Luo et al., 2013; Ménard et al., 1990; Wang, Li, Chi, Zhang, & Luo, 2012). Study indicated that the amino acid constituents of peptides are critical to their antioxidant properties (Chen, Muramoto, Yamaguchi, Fujimoto, & Nokihara, 1998). Some amino acids, such as Pro, Ala, Leu, Gly, Glu and Val, have been reported to be important for peptide to exert antioxidant activity (Mendis, Rajapakse, Byun, & Kim, 2005; Nimalaratne, Bandara, & Wu, 2015; Udenigwe & Aluko, 2011; Zhang, Zhang, Wang, Chen & Luo, 2017). SnP7 (AAVPSGASTGIYEALELR) was rich in Ala (22.22%), Leu (11.11%), Gly (11.11%) and Glu (11.11%). So we inferred that Ala, Leu, Gly and Glu may play important roles of the antioxidant activity of SnP7. Additionally, Ile and Gly consisting of a single hydrogen atom might enhance it’s antioxidant activity. Besides, it has been reported that the presence of Ala or Val at N-terminus was also contributed to peptide antioxidant capacity (Guo, Kouzuma, & Yonekura, 2009; Sarmadi & Ismail, 2010). For SnP10 (NPLLEAFGNAK) was rich in Ala (18.18%) and Leu (18.18%), we inferred that Ala and Leu are critical for it’s antioxidant activity. Additionally, SnP10 containing the structure of Leu–Leu also has a strong antioxidant potential,

chromatography and concentrated in vacuo prior to test their antioxidant activities. As shown in Fig. 2E, the fraction F1a possesses obvious antioxidant activity and is better than GSH (2 mM) and other fractions at the concentration of 2 mg/mL. Therefore, the F1a was chosen for peptide sequencing.

3.3. Identification, synthesis and antioxidant activities of peptides In order to identify the peptide components, the fraction F1a was subjected to LC-MS/MS analysis. As shown in Table 2, 14 peptides were identified through database-assisted peptide sequencing, which is consistent with previous studies that suggesting active peptides are often less than 20 amino acid residues (Sila & Bougatef, 2016). The MS/ MS spectrum of the SnP7 (AAVPSGASTGIYEALELR) and SnP10 (NPLLEAFGNAK), for instance, was shown in Fig. 3A and 3B, respectively. Although not up to a total sequence coverage of 100% and the observed mass values agreed with the calculated mass values within 1.0 mass unit, SnP7: MWcalcd 1805.03, m/zcalcd [M+3H]3+ 602.68, m/zobsd [M +3H]3+ 602.37; SnP10: MWcalcd 1173.34, m/zcalcd [M+2H]2+ 587.67, m/zobsd [M+2H]2+ 587.32. To determine which peptide contributes to the high antioxidant activity of F1a fraction, the identified peptides were synthesized and screened for their antioxidant activities at the concentration of 2 mM, and then the peptides with significant antioxidant activity were verified at the concentration of 1, 2 and 4 mM. As shown in Fig. 3C and D, the S. nudus peptides SnP7 and SnP10 were found to significantly increase the survival rate of paraquat-exposed nematodes with a better antioxidant effects at 4 and 2 mM, respectively. 598

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Fig. 2. Antioxidant effects of peptide fractions separated from papain hydrolyzate using ultrafiltration, gel filtration and RP-HPLC. (A) Effects of > 10, 3–10 and < 3 kDa ultrafiltration fractions on survival rates of paraquat-exposed nematodes. (B) Elution profile of < 3 kDa fraction. (C) Effects of fractions F1, F2, F3 and F4 on survival rates of paraquat-exposed nematodes. (D) RP-HPLC chromatography profile of fraction F1. (E) Effects of fractions F1a, F1b, F1c, F1d, F1e and F1f on survival rates of paraquat-exposed nematodes. The nematodes in activity analysis were treated with or without peptide fractions (2 mg/mL), GSH (2 mM), and then exposed to paraquat (50 mM) as described in Fig. 1. The < 3 kDa, F1 and F1a fractions is the most effective fractions in comparison to untreated control (p < 0.001). Results are representative of three independent experiments, and data are presented as Kaplan-Meier curves and compared for significance by the log-rank test.

hydrolysate for the first time, which is crucial for peptidomic studies.

and the sequence characteristic is in accordance with the previous report (Zhu, Chen, Tang & Xiong, 2008). On the other hand, since the hydrophobicity of peptides is important for accessibility to hydrophobic targets and enhance the affinity and reactivity of peptide, the composition and position of hydrophobic amino acids are pivotal in peptide antioxidant activity, especially considered to be associated with antioxidant effects in vivo (Chi, Wang, Wang, Zhang & Deng, 2015; Girgih et al., 2015; Klompong et al., 2007; Sarmadi & Ismail, 2010). This balance was also observed in the sequences of SnP7 and SnP10, and the contents of hydrophobic amino acids were 50.0% and 54.5%, respectively. Previous studies suggested that the hydrolysates of sea urchin S. nudus gonad possess antioxidant activity, however, the sequence information of antioxidant peptides is unknown. In this study, two novel antioxidant peptides were identified and characterized from the

3.4. Alleviation of oxidative stress by SnP7 and SnP10 Superfluous ROS are known to play a crucial role in oxidative damage of organisms. Active peptides can play a regulatory role in ROS scavenging which is essential for the survival of organisms (Wang et al., 2016). To identify whether the antioxidant effects of SnP7 and SnP10 were through regulation of ROS, we investigated their effects on ROS level in N2 nematodes. As shown in Fig. 4A, both SnP7 and SnP10 can reduce ROS level in oxidation-damaged nematodes. Researches have found that oxidative stress results in the activation of stress-signaling pathways that aim at restoring homeostasis through enhance the activity of cell antioxidant enzymes and molecular chaperones, such as

Table 2 The information of identification and synthesis of peptides by LC-MS/MS and solid-phase methods, respectively. ID

Identified peptide

Observed (m/z)

Charge number

Molecular Weight (Da)

Minconfidence (≥)

Purity of synthetic peptide (%)

SnP1 SnP2 SnP3 SnP4 SnP5 SnP6 SnP7 SnP8 SnP9 SnP10 SnP11 SnP12 SnP13 SnP14

GYSFTTTAER LGMESAGIHETTYNSIMK SYELPDGQVITIGNER AGFAGDDAPRAVFPS YPIEHGIITNWDDMEK TWDNETPIYK AAVPSGASTGIYEALELR FYGNTDPLTR TTIMVPNPRSPQ EPLLEAFGNAK SGGTTMYPGIADR TGDGVNDAPALK GILAADESTGSIAK IQLVEEELDR

565.77 661.31 895.95 739.35 658.98 664.81 602.31 592.29 678.85 587.31 663.31 579.29 666.85 622.32

2 3 2 2 2 2 3 2 2 2 2 2 2 2

1132.2 1982.28 1790.96 1477.61 1961.2 1328.46 1805.03 1183.3 1340.58 1173.34 1325.47 1157.26 1332.48 1243.39

99 99 99 99 99 99 99 99 99 99 99 99 99 99

97.4 96.49 96.16 96.31 95.02 96.67 99.06 97.93 97.66 98.59 95.4 98.4 98.57 98.08

599

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Fig. 3. MS/MS spectrums and antioxidant effects of SnP7 and SnP10. (A)-(B) MS/MS spectrum of SnP7 and SnP10. The MS/MS spectrum at m/z 602.37 corresponding to the [M + 3H]3+ ion of SnP7 (AAVPSGASTGIYEALELR); the MS/MS spectrum at m/z 587.32 corresponding to the [M+2H]2+ ion of SnP10 (NPLLEAFGNAK). (C–D) Effects of SnP7 and SnP10 on survival rates of paraquat-exposed nematodes. The nematodes in activity analysis were treated with or without peptide samples (1, 2 and 4 mM), GSH (2 mM), and then exposed to paraquat (50 mM) as described in Fig. 1. SnP7 4 mM and SnP10 2 mM are the most effective concentration in comparison to untreated control (p < 0.001). Results are representative of three independent experiments, and data are presented as Kaplan-Meier curves and compared for significance by the log-rank test.

intensity of the nematodes treated with SnP7 and SnP10 was both significantly lower than that of the only paraquat-exposed nematodes, indicating that SnP7 and SnP10 pretreatment alleviate ROS-induced acute oxidative injury.

SOD-3 and HSP-16.2, both of which can serve as stress-sensitive reporter (Hsu, Murphy, & Kenyon, 2003; Rea et al., 2005). Previous study indicated that the stress-induced expression of hsp-16.2 could be suppressed in C. elegans fed with antioxidant such as the extract of Ginkgo biloba leaves EGb 761 (Strayer et al., 2003). So we used the transgenic C. elegans CF1553 and CL2070 which carry integrated sod-3::GFP and hsp-16.2::GFP reporters to determine whether S. nudus antioxidant peptides were able to reduce oxidative damage in paraquat-exposed nematodes. As shown in Fig. 4B and C, the relative fluorescence

3.5. Involvement of DAF-16 transcription factor in SnP7- and SnP10mediated antioxidant defenses Since oxidative stress resistance is usually attributed to activation of 600

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Fig. 4. Alleviation of oxidative stress by SnP7 and SnP10 in oxidation-damaged C. elegans. (A) Effects of SnP7 and SnP10 on ROS level in paraquat-exposed N2 nematodes. L4-stage N2 nematodes were treated with or without SnP7 and SnP10 (4 and 2 mM, respectively) for 24 h at 20 °C, and then exposed to 10 mM paraquat for another 24 h. The control nematodes at L4-stage were only incubated in S. medium for 48 h at 20 °C. (B) Quantified sod-3::GFP intensity of control, SnP7- and SnP10-treated groups in paraquat-exposed CF1553 nematodes. (C) Quantified hsp-16.2::GFP intensity of control, SnP7- and SnP10-treated groups in paraquatexposed CL2070 nematodes. (D)-(F) Representative images of paraquat-exposed CF1553 nematodes in control, SnP7- and SnP10-treated groups are shown. (G)-(I) Representative images of paraquat-exposed CL2070 nematodes in control, SnP7- and SnP10-treated groups are shown. Synchronized L1-stage transgenic nematodes CF1553 and CL2070 were treated with or without SnP7 and SnP10 (4 and 2 mM, respectively) until L4-stage at 20 °C, and then exposed to 10 mM paraquat for another 24 h. Quantified sod-3::GFP and hsp-16.2::GFP intensities were analyzed using Image-J software. Data are expressed as GFP mean pixel density obtained from three independent experiments with approximately 30 worms in each experimental group. Arrows indicated the sod-3::GFP expression. Scale bar = 20 μm. *: p < 0.05; **: p < 0.01.

C. elegans LG345 expresses SKN-1::GFP fusion proteins in ASI neurons and intestinal cells, which was used to detect the effects of SnP7 and SnP10 on SKN-1::GFP activation (An & Blackwell, 2003). As expected in Fig. 5H, nuclear localization of SKN-1::GFP was significantly increased in paraquat-exposed nematodes. However, SnP7 and SnP10 failed to induce SKN-1 nuclear localization, indicating that DAF-16 and SKN-1 play different roles in peptides-enhanced antioxidant defense. These results are in line with previous studies that have shown some natural antioxidants enhance the stress resistance through nuclear translocation of DAF-16, but not SKN-1 (Havermann et al., 2014; Zhang et al., 2016). Moreover, our results also suggested that both DAF-16 and SKN1 were involved in the response to paraquat-induced oxidative stress in C. elegans, which have been implicated in resistance to free radical or other stresses, supporting the idea that stress defenses and detoxification are fundamentally important for survival (An & Blackwell, 2003; Asthana et al., 2016).

certain signaling pathways and then enhance the antioxidant potential of organisms, we analyzed the impacts of SnP7 and SnP10 on the activation of two central stress-related transcription factors DAF-16 and SKN-1 (An & Blackwell, 2003; Hsu et al., 2003). The C. elegans GR1352 is a transgenic model, which has been used to quantify the extent of DAF-16 nuclear localization for monitoring the activity of the signaling pathway (Shi et al., 2012), and thus was used to detect the effects of SnP7 and SnP10 on DAF-16 activation. As shown in Fig. 5G, the majority of the control nematodes (approximately 60%) showed a cytosolic DAF-16::GFP localization with < 7.67% of the nematodes displayed a nuclear DAF-16::GFP localization. In addition to a significant increase of DAF-16::GFP nuclear localization in paraquat-exposed nematodes, when the nematodes were treated with SnP7 and SnP10, the percentage of nematodes with detectable nuclear DAF-16::GFP localization was increased as compared to the control, indicating a translocation of DAF-16 from cytoplasm to nuclei induced by the peptides. The 601

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Fig. 5. Effects of SnP7 and SnP10 on the nuclear translocation of DAF-16 and SKN-1 and the expression levels of stress-related genes. (A)-(C) Representative micrographs of DAF-16::GFP localization were categorized as “cytosolic”, “intermedia”, and “nuclear” in transgenic nematodes GR1352. (D)-(F) Representative micrographs of SKN-1::GFP accumulation in nuclei were assessed as “low”, “medium” and “high” in transgenic nematodes LG345. (G) Quantification of DAF-16::GFP distribution in control, paraquat-exposed, SnP7- and SnP10-treated groups. (H) Quantification of SKN-1::GFP accumulation in control, paraquat-exposed, SnP7- and SnP10-treated groups. The synchronized L1-stage nematodes GR1352 and LG345 were incubated for 24 h at 20 °C, and then treated with or without SnP7 and SnP10 (4 and 2 mM, respectively) for another 24 h at 20 °C. The paraquat-exposed nematodes GR1352 and LG345 were incubated at 20 °C until L4-stage, and then treated with paraquat at the concentration of 25 mM for 1.5 h and 35 Mm for 2 h, respectively. Arrows indicated the DAF-16::GFP and SKN-1::GFP accumulated in nuclei. Scale bar = 100 μm. Subcellular DAF-16::GFP and SKN-1::GFP localization was scored in approximately 30 animals per condition and three independent biological replicates were performed. *: p < 0.05; **: p < 0.01; ***: p < 0.001. (I) Effects of SnP7 and SnP10 on the expression of stress-related genes. Synchronized L1-stage N2 nematodes were incubated for 24 h at 20 °C, and then treated with or without SnP7 and SnP10 (4 and 2 mM, respectively) for another 24 h at 20 °C. *: p < 0.05; **: p < 0.01.

antioxidants such as Acacetin can up-regulate the stress-related genes sod-3 and hsp-16.2, which also leads to the enhancement of the potential of antioxidant stress (Asthana et al., 2016). However, there is no obvious differences in the expression of gst-4 and gst-10 with that of control. Taken together with the result that SKN-1 cannot be induced by SnP7 and SnP10, the antioxidant effects of SnP7 and SnP10 are thus not due to the activation of the gst-4 and gst-10 that regulated by SKN-1 under normal conditions (Blackwell et al., 2015).

3.6. Regulation of stress-related gene expression by SnP7 and SnP10 DAF-16 plays an important role in regulating stress resistance through its downstream target genes such as sod-3 and hsp16.2 (Shi et al., 2012), and SnP7 and SnP10 were shown to induce DAF-16 nuclear localization as above. To further confirm the action mechanism of SnP7 and SnP10 increasing resistance of C. elegans against oxidative stress, we examined the effects of SnP7 and SnP10 treatment on the transcriptional expression of stress-related genes including sod-3, gst-4, gst-10, hsp16.2 and hsp-6. As shown in Fig. 5I, both SnP7 and SnP10 increase the expression of sod-3. This result is consistent with the findings that DAF-16 activated by SnP7 and SnP10. However, the expression of hsp-16.2 was up-regulated by SnP10 rather than SnP7, at the same time, neither of them obviously affect the expression of hsp-6. These results are similar with previous report indicated that two hexapeptides (EAMAPK and AVPYPQ) showed significant effects in reducing the cellular oxidative stress through inhibiting ROS release and induction of SOD expression (Pepe et al., 2016). Moreover, other

3.7. Verification of antioxidant signaling pathways modulated by SnP7 and SnP10 Our current analysis reveals that DAF-16 is a critical regulator for enhancement of stress resistance by SnP7 and SnP10. Therefore, daf-16 RNAi was used to test the changes of antioxidant effects of SnP7 and SnP10 in paraquat-exposed nematodes. As shown in Fig. 6A and B, the antioxidant capacity decreased dramatically in daf-16 RNAi nematodes. This finding may be due to a generally low resistance in the daf-16 602

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

Fig. 6. RNAi analysis of the changes in antioxidant effects of SnP7 (A) and SnP10 (B) on survival rates in paraquat-exposed nematodes. The N2 nematodes in activity analysis were treated with or without SnP7 and SnP10 (4 and 2 mM, respectively), and then exposed to paraquat (50 mM) as described in Fig. 1. Results are representative of three independent experiments, and data are presented as Kaplan-Meier curves and compared for significance by the log-rank test.

Conflict of interest

knockdown nematodes which cannot further be modulated by SnP7 and SnP10 (Havermann et al., 2014). The reduction of oxidative stress resistance occurs more in the case of knockdown of the key regulator in stress-related signaling pathway (Zhang et al., 2016). At the same time, these results demonstrated that peptides-induced enhancement of stress resistance is dependent on regulator DAF-16. It is noteworthy that some natural compounds with antioxidant activities could enhance oxidative stress resistance that also via activation of DAF-16 signaling pathway (Havermann et al., 2014; Shi et al., 2012; Zhang et al., 2016). Therefore, DAF-16 is one of the important targets for antioxidants to play antioxidant effects. In summary, the current studies showed that S. nudus antioxidant peptides treatment during initial preconditioning period could enhance the antioxidant stress potential and subsequent ameliorate oxidative stress damage by activation of DAF-16 and modulating DAF-16 target gene expression. Future directions and studies are needed to explore the effects of these antioxidant peptides on the prevention of human age-related diseases.

No conflict of interest exists in the submission of this paper. References Ambigaipalan, P., & Shahidi, F. (2017). Bioactive peptides from shrimp shell processing discards: Antioxidant and biological activities. Journal of Functional Foods, 34, 7–17. An, J. H., & Blackwell, T. K. (2003). SKN-1 links C. elegans mesendodermal specification to a conserved oxidative stress response. Genes & Development, 17, 1882–1893. Asthana, J., Mishra, B. N., & Pandey, R. (2016). Acacetin promotes healthy aging by altering stress response in Caenorhabditis elegans. Free Radical Research, 50, 861–874. Back, P., Braeckman, B. P., & Matthijssens, F. (2012). ROS in aging Caenorhabditis elegans: Damage or signaling? Oxidative Medicine and Cellular Longevity, 2012, 608478. Beckman, K. B., & Ames, B. N. (1998). The free radical theory of aging matures. Physiological Reviews, 78, 547–581. Blackwell, T. K., Steinbaugh, M. J., Hourihan, J. M., Ewald, C. Y., & Isik, M. (2015). SKN1/Nrf, stress responses, and aging in Caenorhabditis elegans. Free Radical Biology & Medicine, 88, 290–301. Chang, S. K., Ismail, A., Yanagita, T., Esa, N. M., & Mohamad, T. H. B. (2015). Antioxidant peptides purified and identified from the oil palm (elaeis guineensis jacq.) kernel protein hydrolysate. Journal of Functional Foods, 14, 63–75. Chen, H. M., Muramoto, K., Yamaguchi, F., Fujimoto, K., & Nokihara, K. (1998). Antioxidative properties of histidine containing peptides designed from peptide fragments found in the digests of a soybean protein. Journal of Agricultural and Food Chemistry, 46, 49–53. Chi, C. F., Wang, B., Wang, Y. M., Zhang, B., & Deng, S. G. (2015). Isolation and characterization of three antioxidant peptides from protein hydrolysate of bluefin leatherjacket (Navodon septentrionalis) heads. Journal of Functional Foods, 12, 1–10. D'Autréaux, B., & Toledano, M. B. (2007). ROS as signalling molecules: Mechanisms that generate specificity in ROS homeostasis. Nature Reviews Molecular Cell Biology, 8, 813–824. Giannakou, M. E., & Partridge, L. (2007). Role of insulin-like signaling in Drosophila lifespan. Trends in Biochemical Sciences, 32, 180–188. Girgih, A. T., He, R., Hasan, F. M., Udenigwe, C. C., Gill, T. A., & Aluko, R. E. (2015). Evaluation of the in vitro antioxidant properties of a cod (Gadus morhua) protein hydrolysate and peptide fractions. Food Chemistry, 173, 652–659. Guo, H., Kouzuma, Y., & Yonekura, M. (2009). Structures and properties of antioxidative peptides derived from royal jelly protein. Food Chemistry, 113, 238–245. Halliwell, B., & Gutteridge, J. M. C. (2007). Free radicals in biology and medicine (4th ed.). New York: Oxford University Press230–240. Harman, D. (1956). Aging: A theory based on free radical and radiation chemistry. Journal of Gerontology, 11, 298–300. Havermann, S., Chovolou, Y., Humpf, H. U., & Wätjen, W. (2014). Caffeic acid phenethylester increases stress resistance and enhances lifespan in Caenorhabditis elegans by modulation of the insulin-like DAF-16 signalling pathway. Plos One, 9, e100256. Homma, T., & Fujii, J. (2015). Application of glutathione as anti-oxidative and anti-aging drugs. Current Drug Metabolism, 16, 560–571. Hsu, A. L., Murphy, C. T., & Kenyon, C. (2003). Regulation of aging and age-related disease by DAF-16 and heat-shock factor. Science, 300, 1142–1145. Huang, F., Jing, Y., Ding, G., & Yang, Z. (2017). Isolation and purification of novel peptides derived from Sepia ink: Effects on apoptosis of prostate cancer cell PC-3. Molecular Medicine Reports, 16, 4222–4228. Kamath, R. S., Martinezcampos, M., Zipperlen, P., Fraser, A. G., & Ahringer, J. (2000). Effectiveness of specific RNA-mediated interference through ingested doublestranded RNA in Caenorhabditis elegans. Genome Biology, 2, 1–10. Klompong, V., Benjakul, S., Kantachote, D., & Shahidi, F. (2007). Antioxidative activity and functional properties of protein hydrolysate of yellow stripe trevally (Selaroides leptolepis) as influenced by the degree of hydrolysis and enzyme type. Food Chemistry, 102, 1317–1327. Luo, H., Wang, B., Li, Z., Chi, C., Zhang, Q., & He, G. (2013). Preparation and evaluation

4. Conclusions In this study, through ultrafiltration, gel filtration, RP-HPLC and LCMS/MS, two novel peptides separated and identified from the hydrolyzate of S. nudus gonad exert significant antioxidant activity against paraquat-induced oxidative stress in Caenorhabditis elegans model. S. nudus antioxidant peptides can reduce ROS level and the expression of SOD-3 and HSP-16.2 in oxidation-damaged nematodes. Further studies indicated that S. nudus antioxidant peptides pretretment promote DAF16 nuclear translocation and induce the expression of its target genes. Functional analysis suggested that peptides-induced enhancement of stress resistance was dependent on DAF-16. Taken together, our studies provide new insight on the antioxidant mechanism associated with the protective effects of antioxidant peptides against oxidative damage, which hold much promise for application in food nutraceutical and pharmaceutical agents.

Acknowledgements This work was supported by grants from the Special Funds of the Central Finance to Support the Development of Local Universities and Colleges, and Guangdong Province Department of Education (No. 2015KGJHZ022), Guangdong Provincial Medical Science Foundation (No. A2016232) and “climbing program” of Guangdong Province Students for Scientific and Technological Innovation (No. 138981). We would like to thank Dr. Jun Zhang (School of Biosciences and Biopharmaceutics, Guangdong Pharmaceutical University) for his excellent technical assistance. 603

Journal of Functional Foods 48 (2018) 594–604

S. Zhao et al.

identification and application in food systems. A review. Journal of Functional Foods, 21, 10–26. Soerensen, M., Dato, S., Christensen, K., Mcgue, M., Stevnsner, T., Bohr, V. A., & Christiansen, L. (2010). Replication of an association of variation in the FOXO3A gene with human longevity using both case-control and longitudinal data. Aging Cell, 9, 1010–1017. Strayer, A., Wu, Z., Christen, Y., Link, C. D., & Luo, Y. (2003). Expression of the small heat-shock protein Hsp16-2 in Caenorhabditis elegans is suppressed by Ginkgo biloba extract EGb 761. FASEB Journal, 17, 2305–2307. Udenigwe, C. C., & Aluko, R. E. (2011). Chemometric analysis of the amino acid requirements of antioxidant food protein hydrolysates. International Journal of Molecular Sciences, 12, 3148–3161. Udenigwe, C. C., & Howard, A. (2013). Meat proteome as source of functional biopeptides. Food Research International, 54, 1021–1032. Udenigwe, C. C., Udechukwu, M. C., Yiridoe, C., Gibson, A., & Gong, M. (2016). Antioxidant mechanism of potato protein hydrolysates against in vitro oxidation of reduced glutathione. Journal of Functional Foods, 20, 195–203. Wang, Q., Huang, Y., Qin, C., Liang, M., Mao, X., Li, S., ... Huang, Z. (2016). Bioactive peptides from Angelica sinensis protein hydrolyzate delay senescence in Caenorhabditis elegans through antioxidant activities. Oxidative Medicine & Cellular Longevity, 2016, 1–10. Wang, B., Li, Z., Chi, C., Zhang, Q., & Luo, H. (2012). Preparation and evaluation of antioxidant peptides from ethanol-soluble proteins hydrolysate of Sphyrna lewini muscle. Peptides, 36, 240–250. Wu, C. W., Deonarine, A., Przybysz, A., Strange, K., & Choe, K. P. (2016). The Skp1 homologs SKR-1/2 are required for the Caenorhabditis elegans SKN-1 antioxidant/ detoxification response independently of p38 MAPK. Plos Genetics, 12, e1006361. Wu, Y., Wu, Z., Butko, P., Christen, Y., Lambert, M. P., Klein, W. L., ... Luo, Y. (2006). Amyloid-beta-induced pathological behaviors are suppressed by Ginkgo biloba extract EGb 761 and ginkgolides in transgenic Caenorhabditis elegans. Journal of Neuroscience, 26, 13102–13113. Wu, M., Xin, K., Qiang, W., Zhou, C., Mohan, C., & Ai, P. (2017). Regulator of G protein signaling-1 modulates paraquat-induced oxidative stress and longevity via the insulin like signaling pathway in Caenorhabditis elegans. Toxicology Letters, 273, 97–105. Zhang, J., Shi, R., Li, H., Xiang, Y., Xiao, L., Hu, M., ... Huang, Z. (2016). Antioxidant and neuroprotective effects of Dictyophora indusiata polysaccharide in Caenorhabditis elegans. Journal of Ethnopharmacology, 192, 413–422. Zhang, C., Zhang, Y., Wang, Z., Chen, S., & Luo, Y. (2017). Production and identification of antioxidant and angiotensin-converting enzyme inhibition and dipeptidyl peptidase IV inhibitory peptides from bighead carp (Hypophthalmichthys nobilis) muscle hydrolysate. Journal of Functional Foods, 35, 224–235. Zhou, D., Qin, L., Zhu, B., Li, D., Yang, J., Dong, X., & Murata, Y. (2012). Optimisation of hydrolysis of purple sea urchin (Strongylocentrotus nudus) gonad by response surface methodology and evaluation of in vitro, antioxidant activity of the hydrolysate. Journal of the Science of Food and Agriculture, 92, 1694–1701. Zhu, L., Chen, J., Tang, X., & Xiong, Y. L. (2008). Reducing, radical scavenging and chelation properties of in vitro digests of alcalase treated zein hydrolysate. Journal of Agricultural and Food Chemistry, 56, 2714–2721.

of antioxidant peptide from papain hydrolysate of Sphyrna lewini muscle protein. LWT-Food Science and Technology, 51, 281–288. Mant, C. T., Chen, Y., Yan, Z., Popa, T. V., Kovacs, J. M., Mills, J. B., ... Hodges, R. S. (2007). HPLC analysis and purification of peptides. Methods of Molecular Biology, 386, 3–55. Matés, J. M. (2000). Effects of antioxidant enzymes in the molecular control of reactive oxygen species toxicology. Toxicology, 153, 83–104. Ménard, R., Khouri, H. E., Plouffe, C., Dupras, R., Ripoll, D., Vernet, T., ... Storer, A. C. (1990). A protein engineering study of the role of aspartate 158 in the catalytic mechanism of papain. Biochemistry, 29, 6706–6713. Mendis, E., Rajapakse, N., Byun, H. G., & Kim, S. K. (2005). Investigation of jumbo squid (dosidicus gigas) skin gelatin peptides for their in vitro antioxidant effects. Life Sciences, 77, 2166–2178. Moon, J. K., & Shibamoto, T. (2009). Antioxidant assays for plant and food components. Journal of Agricultural & Food Chemistry, 57, 1655–1666. Neves, A. C., Harnedy, P. A., Okeeffe, M. B., Alashi, M. A., Aluko, R. E., & Fitzgerald, R. J. (2017). Peptide identification in a salmon gelatin hydrolysate with antihypertensive, dipeptidyl peptidase IV inhibitory and antioxidant activities. Food Research International, 100, 112–120. Nimalaratne, C., Bandara, N., & Wu, J. (2015). Purification and characterization of antioxidant peptides from enzymatically hydrolyzed chicken egg white. Food Chemistry, 188, 467–472. Oliveira, R. P., Porter, A. J., Dilks, K., Landis, J., Ashraf, J., Murphy, C. T., & Blackwell, T. K. (2009). Condition-adapted stress and longevity gene regulation by Caenorhabditis elegans SKN-1/Nrf. Aging Cell, 8, 524–541. Pepe, G., Sommella, E., Ventre, G., Scala, M. C., Adesso, S., Ostacolo, C., ... Campiglia, P. (2016). Antioxidant peptides released from gastrointestinal digestion of “Stracchino” soft cheese: Characterization, in vitro intestinal protection and bioavailability. Journal of Functional Foods, 26, 494–505. Power, O., Jakeman, P., & Fitzgerald, R. J. (2013). Antioxidative peptides: Enzymatic production, in vitro and in vivo antioxidant activity and potential applications of milkderived antioxidative peptides. Amino Acids, 44, 797–820. Qin, L., Zhu, B. W., Zhou, D. Y., Wu, H. T., Tan, H., Yang, J. F., ... Murata, Y. (2011). Preparation and antioxidant activity of enzymatic hydrolysates from purple sea urchin (Strongylocentrotus nudus) gonad. LWT-Food Science and Technology, 44, 1113–1118. Rea, S. L., Wu, D., Cypser, J. R., Vaupel, J. W., & Johnson, T. E. (2005). A stress-sensitive reporter predicts longevity in isogenic populations of Caenorhabditis elegans. Nature Genetics, 37, 894–898. Ryu, B., & Kim, S. (2013). Potential beneficial effects of marine peptide on human neuron health. Current Protein & Peptide Science, 14, 173–176. Sarmadi, B. H., & Ismail, A. (2010). Antioxidative peptides from food proteins: A review. Peptides, 31, 1949–1956. Shi, Y. C., Yu, C. W., Liao, V. H., & Pan, T. M. (2012). Monascus-fermented dioscorea enhances oxidative stress resistance via DAF-16/FOXO in Caenorhabditis elegans. PLoS One, 7, e39515. Si, H., & Liu, D. (2014). Dietary antiaging phytochemicals and mechanisms associated with prolonged survival. Journal of Nutritional Biochemistry, 25, 581–591. Sila, A., & Bougatef, A. (2016). Antioxidant peptides from marine by-products: Isolation,

604