Antisense peptide nucleic acids againstftsZ andefaA genes inhibit growth and biofilm formation of Enterococcus faecalis

Microbial Pathogenesis 139 (2020) 103907

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

Antisense peptide nucleic acids againstftsZ andefaA genes inhibit growth and biofilm formation of Enterococcus faecalis

T

Hanar Narenjia,b, Omid Teymournejadc, Mohammad Ahangarzadeh Rezaeed, Sepehr Taghizadeha, Bahareh Mehramuzd, Mohammad Aghazadeha, Mohammad Asgharzadehe, Masoumeh Madhia, Pourya Gholizadeha, Khudaverdi Ganbarovf, Mehdi Yousefid, Asrin Pakravang, Tuba Dalh, Raman Ahmadia, Hossein Samadi Kafila,∗ a

Drug Applied Research Center, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran Student Research Committee, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran Department of Veterinary Biosciences, Ohio State University, Columbus, OH, 43210, United States d Immunology Research Center, Faculty of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran e Biotechnology Research Center, Tabriz University of Medical Sciences, Tabriz, Iran f Department of Microbiology, Baku State University, Baku, Azerbaijan g Department of Chemistry, Faculty of Basic Sciences, Azarbaijan Shahid Madani University, Tabriz, Iran h Department of Clinical Microbiology, Faculty of Medicine, Ankara Yildirim Beyazit University, Ankara, Turkey b c

A R T I C LE I N FO

A B S T R A C T

Keywords: Antimicrobial activity Peptide nucleic acid Cellular delivery Cell penetrating peptide (CPP) Electroporation

Enterococcus faecalis is one of the important causes of nosocomial infections. Nowadays, increasing prevalence of antibiotic-resistant bacteria and slow progress in recognizing new antimicrobial agents has limited the efficiency of conventional antibiotics, which cause to find novel strategies to overcome bacteria. Therefore, in this study, we aimed to assess the role of efaA gene in the biofilm formation and the role of ftsZ gene in the controlling of bacterial growth by the anti-sense PNAs(Peptide Nucleic Acid).E. faecalis ATCC® 29212™was used for the study of PNAs designed to targeting the start codon section of the ftsZ andefaA genes. PNA attachment to RNA was confirmed by blotting. Electroporation technique was used for the intracellular transfer of anti-ftsZ PNAs. The spot-plating method was used to the assessment of alteration in bacterial growth. Biofilm formation assay and real-time PCR were used for detection of biofilm inhibitory effect of cell penetrating peptide (CPP) conjugated to anti-efaA PNAs.ByftsZ PNAs treatment, no growth was seen from the strain in agar by a spot plating method and the inhibition zone of anti-ftsZ PNAs was not seen. PNAs against the efaA gene decreased by 95% the expression of the efaA gene and biofilm formation. In addition, the(3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide) MTT assay showed no toxicity on MCF7 cells for both of anti-ftsZand anti-efaA PNAs.This study used new genetic and molecular tools to inhibit pathogenicity and infection by E. faecalis. In this study, we suggested that efaA gene plays a critical role in the biofilm formation and anti-efaA PNAs could decrease the formation of biofilm, as well as, anti-ftsZ PNAs could eliminate bacterial growth.

1. Introduction The Peptide Nucleic Acid (PNA) is a polymer analog to DNA and RNA. PNA is a chimeric molecule of the nucleic acid and peptide. PNA is structurally similar to nucleic acid and chemically similar to protein, which is resistant to proteases and nucleases [1,2]. In PNA structure, sugar-phosphate backbone in nucleotide bases has been exchanged with repeating N-(2-aminoethyl) glycine units that were linked through methylene carbonyl linkers [3]. Antibacterial and biofilm inhibitory

∗

effects of PNAs are influenced by several factors including size and sequences of PNAs (10–12 bp) [4,5], the position of membrane-penetrating peptide and in the structure of peptide-PNA and presence or absence of linker between peptide conjugated to PNAs and sequences of PNAs [4–7]. Due to the presence of purine and pyrimidine in PNAs structure, they have the potential of attaching to DNA and RNA. Therefore, today they have many applications in biology studies [2,8]. Antisense PNAs can enter bacteria and the control gene expression through targeted RNA silencing and inhibit the expression of the

Corresponding author. Drug Applied Research Centre, Tabriz University of Medical Sciences, Tabriz, Iran. E-mail address: kafi[email protected] (H. Samadi Kafil).

https://doi.org/10.1016/j.micpath.2019.103907 Received 6 November 2019; Received in revised form 23 November 2019; Accepted 2 December 2019 Available online 05 December 2019 0882-4010/ © 2019 Elsevier Ltd. All rights reserved.

Microbial Pathogenesis 139 (2020) 103907

H. Narenji, et al.

relevant gene. Anti-bacterial anti-antisense agents including PNAs, locked nucleic acids (LNAs), phosphorodiamidatemorpholino oligomers (PMOs) are usually very short sequences approximately 10–20 mer [9]. Both Gram-positive and Gram-negative bacteria are susceptible to PNAs and PMOs as antisense antibiotics [10,11]. Enterococcus species are ubiquitous, Gram-positive and anaerobic cocci (4). Two of the most important and common species are E. faecalis and E. faecium. E. faecalis is a saprophytic oral cavity, which is the most common microorganism isolated from the canal of the root teeth, where endodontic treatments have failed and other systemic infections of enterococci after entering the bloodstream (5). The chronic infections caused by E. faecalis have the ability to produce biofilms. Biofilms are communities of bacteria that bind to bio or non-bio surfaces [12,13], as well as, are generally more resistant to antimicrobial agents [14–18]. Several virulence genes such as esp,efaA, gelE and fsr genes are contributed in the biofilm formation by E. faecalis. The efaA (E. faecalis antigen A) gene plays an important role in the adhesion of bacteria to surfaces, as well as, biofilm production of E. faecalis and has a high expression in patients with enterococcal endocarditis [19–21]. Filamenting temperature-sensitive mutant Z (FtsZ) has been reported as an essential structure that involved in bacterial division process and is highly conserved in a wide range of bacteria. Therefore, ftsZ can be a potential target for the development of new antibiotics [22]. Therefore, in this study, we aimed to assess the role of efaA gene in the biofilm formation and the role of ftsZ gene in the controlling of bacterial growth by the anti-sense PNAs.

Fig. 1. Biofilm assay for E. faecalis.B: Concentration of efaA PNA.C: E. coli DH5α was used as a negative control of biofilm formation. D: E. faecalis ATCC 29212 as a biofilm formation strain (no PNA). E: E. faecalis treated with mismatch and wells 3, 6, 9 (no bacteria). F: E. faecalis ATCC 29212 treated with anti-efaA PNAs.

T2 = 2 h, T3 = 6 h, T4 = 12 h, T5 = 24 h) and were measured the optical density (OD) of the cultures in the wells at 570 nm by using a microtiter plate reader (BioTeck, Winooski, USA). Harvest 20 μl from all wells in a different phase of growth into one microfuge tube and immediately store at −80 °C for RNA extraction later. Wells containing biofilms were washed twice with PBS(Phosphate buffer serum) and added 150 μl methanol for 20 min for fixation of biofilm and leave the microplate to dry. The wells were stained for 20 min with 175 μL of 0.1 %crystal violets (CV). The wells were washed three times with PBS until the excess stain is removed and redissolve the CV in30% acetic acid (200 μL). Biofilm formation was quantified by measurement of the optical density at 570 nm (Fig. 1) [26,27].All experiments were done in triple.

2. Methods and materials 2.1. Bacterial strains The experimental assessment was done on E. faecalis ATCC 29212 as a biofilm formation strain, Escherichia coli DH5α was used as a negative control of biofilm formation. All strains were provided from Persian taxonomic collection (Karaj, Iran).

2.4. Quantitative real-time PCR (qPCR) assay Quantitative real-time PCR was performed for assessing the effect of efaA-targeting PNAs on efaA gene expression. Quantitative RT-PCR assay was done by the real-time PCR machine (Applied Biosystems StepOnePlus™, Australia) using the SYBR Premix EX TaqII, TliRNaseH plus (Takara Bio Inc.Japan). The sequences of primers used for realtime PCR are shown in Table 2 (The 23SrRNA was used as a housekeeping gene) [26,28]. RNA was extracted by FavorPrep™ Blood/Cultured Cell Total RNA Mini Kit (Favorgen, Pingtung, Taiwan) [29]. DNAfree RNA was used for cDNA synthesis following the manufacturer's instruction (YektaTajhizAzma, Tehran, Iran). The PCR reaction protocol of efaA was done followed by initial 95 °C for 5 min and 40 cycles of 20 s at 95 °C, 10 s at 60 °C and 20 s at 72 °C [30]. The PCR reaction protocol of 23SrRNA was done followed by initial 95 °C for 15 min and 40 cycles of 25 s at 95 °C, 30 s at 60 °C and 30 s at 72 °C.

2.2. Preparation of PNA To design and synthesize suitable antisense PNAs, ftsZandefaAgenes sequences were extracted from the NCBI Database. Start codon section of the ftsZandefaAgenes were considered as PNAs targets. PNAs can bind to the complementary sequence of mRNA and can modify its function. In both genes, PNAs in the 9 to 12-mer range were most active. The PNAs were synthesized by Panagene Company (South Korea). PNA attachment to RNA was confirmed by blotting. The PNAs sequences and characteristics are shown in Table 1. 2.3. Biofilm inhibitory effects of anti efaA PNAs

2.5. Electroporation for anti-ftsZPNA The biofilm formation was analyzed by the quantitative biofilm formation in 96-wells flat-bottom polystyrene microplates(Greiner, Germany) under static condition [23,24]. A fresh overnight culture of E. faecalis 29212 and E.coli DH5α incubated in Tryptic soy broth (TSB) (Merck, Germany) +1% glucose at 37 °C. The cell density was adjusted approximately 10−5 CFU/ml. Different concentrations of efaA-targeting PNAs (10−5, 10−7, 10−8 μM) were prepared with TSB+1% glucose, as well as, were prepared different concentration of mismatch like match PNAs [25]. Growth rates were determined in the five times (T1 = 0 h,

To deliver PNAs into the bacterial cells, a suitable cell-penetrating peptide should be designed that can be linked to the PNA, Due to the lack of cell-penetrating peptide. Electroporation procedure was used for penetrating PNA targeted ftsZ gene intoE. faecalis [31–33]. 2.5.1. Preparation of competence cell E. faecalis ATCC® 29212™ strain was incubated in sheep blood agar at 37 °C for 24 h. One colony of E. faecalis 29212 was cultured in 25 mL

Table 1 Sequences of prepared PNAs for E. faecalis. Sample name

sequence

nmole

Molecular weight (Dalton)

weight

efaA with carrier peptide ftsZ

(RXR)4-gct ttttct cat aattccatgata

50.1 50.1

4903.2 3252.1

245.7 163

2

Microbial Pathogenesis 139 (2020) 103907

H. Narenji, et al.

3. Results

Table 2 The sequences of efaA and 23SrRNA primers for real-time PCR. Gene

Primer name

Primer Sequences

Ref

efaA

EfaA-F EfaA-R 23SrRNA-F 23SrRNA-R

TGGGACAGACCCTCACGAATA CGCCTGTTTCTAAGTTCAAGCC CCTATCGGCCTCGGCTTAG AGCGAAAGACAGGTGAGAATCC

[27,50] [27,50] [50,51] [50,51]

Housekeeping (23srRNA)

3.1. Inhibiting the biofilm formation in E. faecalis with PNAs targeting efaA gene The growth of E. faecalis was 30.21% inhibited by anti-efaA PNAs at a concentration of 10−5μM 2 h after treatment, as well as, concentration of 10−8μM was 76.62% and 87.5% inhibited 6 h and 12 h after treatment, respectively. Biofilm formation was evaluated to examine the inhibitory effects of various concentrations of antisense PNAs and mismatch PNAs. Biofilm formation was reduced 59.72% after 24 h treatment with PNA at concentration 10−5μM. There was no difference between mismatch and positive control (no PNA) and the graphs were same (shown in Fig. 2).

of TSB culture medium and placed in shaker incubators at 37 °C for 6 h. Then, the prepared bacterial suspension was incubated on ice-cooled for 10 min. All bacteria were transferred to 50 mL of the falcon and were centrifuged for 3 min at 4 °C in 6000 rpm. The supernatant was discarded and cold sterilized MgCl2 was added to the precipitation. These bacteria were centrifuged again at 4 °C for 10 min in 6000 rpm. The supernatant was discarded after centrifugation and the mixtures were mixed with 20 mL (0.1 M) cold sterilized CaCl2. After 20 min, the bacteria were again centrifuged at 4 °C for 10 min in 6000 rpm. The supernatant was discarded and the cells were mixed with 10 mL of (0.1 M) CaCl2 containing 15% glycerol. Finally, they were divided into 1.5 μL vials at 100 μL and immediately stored at −70 °C.

3.2. Inhibiting efaA gene expression The expression of efaA mRNA was assayed with qRT-PCR. The levels of efaA mRNA was 99.84% downregulated in the sample group (in comparison to the control group) at PNA concentration 10−5 μM. PNAs treatment reduces efaA expression (99.998%), whereas efaA expression was unchanged when treated with mismatch PNAs at the same concentration (10−5 μM). The expression ratio of efaA gene in strains exposed with PNAs were significantly reduced in comparison strains, which were not exposed with PNAs (P-value < 0.01). The expression was normalized by 23SrRNAand the statistical analysis was done by demonstrating that the antisense gene knockdown effect was sequencespecific (Fig. 3).

2.5.2. Electroporation procedure One microliter of PNA with concentration 10−4 μM was added to 50 μL of bacteria suspension. Gene Pulser TM electroporation device and Pulse Controller TM device together electroporation cuvettes (BioRad) were used. After the electroporation, 1 mL of TSB was immediately added to the cuvettes and incubated for 1 h at 37 °C. The products were transferred to 1.5 mL sterile microtube and were centrifuged for 10 min at 4 °C in 6000 rpm. The supernatant was discarded and pellets added to a 96-wells microtiter plate and agar plate to consider the effect of antisense PNAs on the growth of E. faecalis strains.

3.3. Growth inhibition by anti-ftsZ PNA The inhibition of FtsZ protein leads to a deficiency in cell division, resulting in growth inhibition. The results demonstrated that the growth of E. faecalis was inhibited after treatment with anti-ftsZPNAs, while in the positive control (no PNA), E. faecalishad growth. In addition, no live bacteria were detected from the anti-ftsZPNAs treated bacteria in agar medium by a spot plating method. These results were shown in Fig. 4.

2.6. Inhibition of bacterial growth Treated bacteria with anti-ftsZ PNAs were transferred to MullerHinton agar plate and were examined its growth after incubation at 37 °C for 24 h. The taken pellets with electroporation method were added to a 96-well microtiter plate, which was adjusted to 5 × 105 CFU/ml per well of a 96 well plate. The anti-ftsZ PNAs were added to final concentrations of 10−4μM and incubated at 37 °C for 24 h (25).Experiments were done in triple.

3.4. Cytotoxicity assay results To recognize the cytotoxic dose, the human breast cancer cell line MCF-7 were treated with higher doses of anti-ftsZ and anti-efaAPNAs (10−5, 10−7, 10−8μM) at 24 and 48 h, These results demonstrated that anti-ftsZPNAs (10−5, 10−7, 10−8 μM) were 93%, 95%, 96% and antiefaAPNAs (10−5, 10−7, 10−8 μM) were 98%,100%, 100% presented in Fig. 5. Both of the PNAs had no toxic effects on cells in the effective bactericidal dose concentrations, which are shown in Fig. 6.

2.7. Cell viability assay For cytotoxicity experiments, MCF7 breast cancer cells (Institute Pasture, Tehran, Iran)were added in Dulbecco modified Eagle medium (DMEM) supplemented with 10% fetal bovine serum (FBS). The cells with a density of 3000 were seeded to wells of 96-well test plates and incubated before treated with PNAs of ftsZ gene. Different concentrations of PNAs (10−5, 10−7 and 10−8 μM) were prepared by dilution in RPMI supplemented with 10% FBS. Cell viability was measured for a period of 24 and 48 h after treatment with PNAs. The optical density of the solution was measured by a microplate reader at a wavelength of 570 nm. The cell viability was determined via(3-(4,5-dimethylthiazol2-yl)-2,5-diphenyl-tetrazolium bromide) MTT assay. The percentage of (OD sample − OD  blank) viable cells was calculated by viability % = (OD control − OD  blank) ˟100 and each experiment was analyzed in triplicate samples [34,35].

4. Discussion The advance of antibiotic resistance and the appearance of new microbial infections have increased the necessity of studies to identify new therapies and control methods.E. faecalis is a microorganism important in asymptomatic, persistent endodontic infections and involving its ability to compete with other microorganisms, invade dentinal tubules, and resist nutritional deprivation [36]. Bacterial biofilms are dissimilar from those of their plankton and shows their particular phenotypes, for example, their antibiotic resistance is 10–1000 times greater than that of plankton forms and has a much higher casual of genetic exchanges [12,13]. Biofilm exhibit reduced susceptibility to antimicrobials, detergents and the host immune system compared to planktonic cells [37,38].In recent years, several RNA polymerase interfering agents has been developed for antibacterial, antibiofilmand antisense purposes such as PNAs [39]. Moreover, inhibition of RNA polymerase can lead to cell death [6]. Ghosal and Nielsen confirmed

2.8. Statistical analysis ΔΔCT (delta cycle threshold) method was used for relative expression analysis and a P-value below 0.05 was considered significant. Pfaffle formula was applied by REST 2009 version 2.0.13. 3

Microbial Pathogenesis 139 (2020) 103907

H. Narenji, et al.

Fig. 2. Analysis OD of biofilm formation and growth of E. faecalis after exposure to anti-efaA PNAs. Biofilm formation reduction was seen at concentration 10−5 μM of PNAs in 24 h after incubation and the graphs between mismatch and positive control (no PNA) were same.

4

Microbial Pathogenesis 139 (2020) 103907

H. Narenji, et al.

[11]. Goh et al. revealed that PNAs can inhibitmobilization of mecA and ftsZ genes (as the growth essential gene) in methicillin-resistant Staphylococcus aureus (MRSA) in human infections and methicillin-resistant Staphylococcus pseudintermedius in pets [40]. In their study, PNA was designed for the Shine-Dalgarno sequence of both mecA and ftsZ genes [40]. Their results confirmed that anti-mecA and anti-ftsZ PNAs could decrease the MIC of oxacillin and were most active and sensitized these genera against oxacillin and prevent the growth at lower concentrations of PNAs [40]. Studies showed that ftsZ recruits PBP2a in peptidoglycan synthesis and inhibition of ftsZ results in loss of cell wall integrity [9,40]. Liang et al. demonstrated that ftsZ inhibition is related to PPNA concentrations and higher concentrations of anti-ftsZ PPNA had bactericidal effects [9]. These results confirmed that the antibacterial effects of PPNA are associated with the dose-dependent manner in gene expression [9]. Streptococcus pyogenes is Gram-positive bacteria that cause invasive infections and pharyngitis and susceptible to penicillin [41,42]. Due to beta-lactamase generating bacteria, penicillin-resistant S. pyogenes have been reported frequently [43]. For these patients, macrolide drugs have been suggested (especially patients with allergic reaction to penicillin) but streptococcal resistance to macrolides has increased recently [44,45]. Consequently, PPNAs has been tested as antimicrobial agents in the S. pyogenes strains. Patenge et al. confirmed that anti-gyrA PPNAs had bactericidal activity against S. pyogenes and also showed that HIV–I Tat peptide-PNAs more efficient the inhibitor compared with (KFF)3K–PNAs against S. pyogenes [46]. Moreover, their study confirmed that higher concentrations of anti-gyrA PPNAs are required for the execution of the growth inhibition ofS. pyogenes compared to gram-negative bacteria [46]. Nevertheless, they couldn't find any reason for this higher concentration requirement. In the same way, our study showed for Enterococci PNA in higher concentrations are needed.Hatamoto et al. used PNAs against Bacillussubtilis and Corynebacterium spp. efficiency 16s ribosomal RNA (16srRNA) and demonstrated that PNAs conjugated with CCPs can reduce and inhibited cell growth related to the dose-dependent manner [47]. Moreover, Mondhe et al. demonstrated that anti-ftsZ PNAs could inhibit cell growth in Bacillus subtilis and had bactericidal activity against these organisms [48]. Nowadays, the presence of antibiotic-resistant bacteria and slow progress in recognizing new components of antimicrobial agent'smake it very essential to innovate methods for fighting with microbes and developing knowledge in these approaches [49]. Therefore, this study aimed to develop a new molecular tool to inhibit biofilm

Fig. 3. efaA gene expression ratio at concentration 10−5 anti-efaA PNA in E. faecalis.

Fig. 4. E. faecalis treated with anti-ftsZ PNAs. B, C, F and G (2–11 column's wells) row treated with anti-ftsZ PNAs, which had no growth. D and E (2–11 column's wells) row untreated with the PNAs, which bacteria were grew.

that anti-ftsZ and -acpP (as important genes) PPNAs had antimicrobial action in MDR Pseudomonas aeruginosa [11]. Their results suggested that particular PNA targeting acpP is well conserved in diverse species of Pseudomonas spp. and it could be used for other Pseudomonas species

Fig. 5. Analysis of MTT assay, the MTT assay showed no toxicity on MCF7 cells for both of anti-ftsZ and anti-efaA PNAs ratio at concentration 10−5. 5

Microbial Pathogenesis 139 (2020) 103907

H. Narenji, et al.

Fig. 6. MTT assay for different concentration of anti-efaA and anti-ftsZ PNAs. These results demonstrated that both of the PNAs had no toxic effects on MCF7 cells.

Teymournejad: Formal analysis. Mohammad Ahangarzadeh Rezaee: Formal analysis. Sepehr Taghizadeh: Formal analysis. Bahareh Mehramuz: Formal analysis. Mohammad Aghazadeh: Writing - original draft, Funding acquisition. Mohammad Asgharzadeh: Writing original draft, Funding acquisition. Masoumeh Madhi: Formal analysis. Pourya Gholizadeh: Formal analysis, Writing - original draft. Khudaverdi Ganbarov: Formal analysis, Writing - original draft. Mehdi Yousefi: Funding acquisition, Formal analysis. Asrin Pakravan: Writing - original draft. Tuba Dal: Writing - original draft. Raman Ahmadi: Formal analysis. Hossein Samadi Kafil: Methodology, Funding acquisition, Formal analysis, Writing - original draft.

formation and restrain infection by E. faecalis. Specific peptide nucleic acid sequences were designed and synthesized for promoter regions and genomic regions of genes and carrier peptid was used for efaA gene transformation into bacterial cells and electroporation technique was used for ftsZ. Antisense PNAs are bigger than most drugs, and PNA size is expected to be a significant factor for efficiency. In this study PNAs targeted to the start codon section of the ftsZgene PNA which can bind to the complementary sequence of mRNA and can modify functions, we intended antisense PNA for Knockdown gene related to cell division after the electroporation of the ftsZ gene, the growth of the bacteria was stopped and the bacteria were killed and infection was controlled in invitro model.Also, PNA which developed against efaA gene was able to reduce the efaA gene expression, subsequently, PNA conjugated with CCPs against the efaA gene partly diminished biofilm formation and the results of gene expression confirmed exactly in the biofilm assay. This result can indicates importance of efaA gene in biofilm formation of Enterococci spp. However, several genes are introduced to participate in biofilm formation by Enterococci spp. but these results can prove importance of efaA in biofilm formation of this pathogen. The MTT assay showed no toxicity on eukaryotic cells for both of the genes, the results of the cell viability assays and the cell growth inhibition assays described that PNAs exerts a safe activity for eukaryotic cells in vitro.

Acknowledgment Local ethics committee with reference IR.TBZMED.REC.1396.584 approved this study.

number

References [1] H. Narenji, P. Gholizadeh, M. Aghazadeh, M.A. Rezaee, M. Asgharzadeh, H.S. Kafil, Peptide nucleic acids (PNAs): currently potential bactericidal agents, Biomed. Pharmacother. 93 (2017) 580–588. [2] N. Sahu, G. Shilakari, A. Nayak, D.V. Kohli, Peptide nucleic acids: a novel approach, Curr. Chem. Biol. 2 (2008) 110–121. [3] B. Hyrup, P.E. Nielsen, Peptide nucleic acids (PNA): synthesis, properties and potential applications, Bioorg. Med. Chem. 4 (1996) 5–23. [4] L. Good, S.K. Awasthi, R. Dryselius, O. Larsson, P.E. Nielsen, Bactericidal antisense effects of peptide–PNA conjugates, Nat. Biotechnol. 19 (2001) 360. [5] T. Otsuka, A.L. Brauer, C. Kirkham, E.K. Sully, M.M. Pettigrew, Y. Kong, et al., Antimicrobial activity of antisense peptide–peptide nucleic acid conjugates against non-typeable Haemophilus influenzae in planktonic and biofilm forms, J. Antimicrob. Chemother. 72 (2016) 137–144. [6] H. Bai, G. Sang, Y. You, X. Xue, Y. Zhou, Z. Hou, et al., Targeting RNA polymerase primary σ70 as a therapeutic strategy against methicillin-resistant Staphylococcus aureus by antisense peptide nucleic acid, PLoS One 7 (2012) e29886. [7] D.E. Greenberg, K.R. Marshall-Batty, L.R. Brinster, K.A. Zarember, P.A. Shaw, B.L. Mellbye, et al., Antisense phosphorodiamidate morpholino oligomers targeted to an essential gene inhibit Burkholderia cepacia complex, J. Infect. Dis. 201 (2010) 1822–1830. [8] S. Goh, J. Stach, L. Good, Antisense Effects of PNAs in Bacteria. Peptide Nucleic Acids: Methods and Protocols Second Edition, (2014), pp. 223–236. [9] S. Liang, Y. He, Y. Xia, H. Wang, L. Wang, R. Gao, et al., Inhibiting the growth of methicillin-resistant Staphylococcus aureus in vitro with antisense peptide nucleic acid conjugates targeting the ftsZ gene, Int. J. Infect. Dis. 30 (2015) 1–6. [10] B.L. Geller, Antibacterial antisense, Curr. Opin. Mol. Ther. 7 (2005) 109–113. [11] A. Ghosal, P.E. Nielsen, Potent antibacterial antisense peptide–peptide nucleic acid conjugates against Pseudomonas aeruginosa, Nucleic Acid Ther. 22 (2012) 323–334. [12] C.B. Whitchurch, T. Tolker-Nielsen, P.C. Ragas, J.S. Mattick, Extracellular DNA required for bacterial biofilm formation, Science 295 (2002) 1487. [13] R.M. Donlan, J.W. Costerton, Biofilms: survival mechanisms of clinically relevant microorganisms, Clin. Microbiol. Rev. 15 (2002) 167–193. [14] P. Joyanes, A. Pascual, L. Martínez‐Martínez, A. Hevia, E.J. Perea, In vitro adherence of Enterococcus faecalis and Enterococcus faecium to plastic biomaterials, Clin. Microbiol. Infect 5 (1999) 382–386. [15] P. Joyanes, A. Pascual, L. Martinez-Martinez, A. Hevia, E. Perea, In vitro adherence of Enterococcus faecalis and Enterococcus faecium to urinary catheters, Eur. J. Clin. Microbiol. Infect. Dis. 19 (2000) 124–127. [16] J.W. Costerton, P.S. Stewart, E.P. Greenberg, Bacterial biofilms: a common cause of persistent infections, Science 284 (1999) 1318–1322. [17] S.R. Nallapareddy, K.V. Singh, J. Sillanpää, D.A. Garsin, M. Höök, S.L. Erlandsen,

5. Conclusion This study aimed to develop new molecular tools to inhibit Biofilm formation and infection by E. faecalis.Results of the present studies showed antisense PNAs designed against efaA gene was able to reduce biofilm formation and anti-ftsZ was able to inhibit growth of bacteria by interruption in cell division of E. faecalis.These results indicate importance of efaA gene in biofilm formation of Enterococci spp. which is the main part of pathogenesis in these bacteria and can be targeted for further therapies. Also, ftsZ function was confirmed by this way and this PNA was able to inhibit its growth completely. It can be used as new advance in control of infection by Enterococci. However, using PNA in higher concentration and in-vivo models were our limitation in this study. Funding National Institute for Medical Research Development (NIMAD) No 957280 and Drug Applied Research Center, Tabriz University of Medical Sciences supported this study. Declaration of competing interestCOI None to declare. CRediT authorship contribution statement Hanar Narenji: Methodology, Writing - original draft. Omid 6

Microbial Pathogenesis 139 (2020) 103907

H. Narenji, et al.

[18] [19]

[20] [21]

[22] [23] [24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

et al., Endocarditis and biofilm-associated pili of Enterococcus faecalis, J. Clin. Investig. 116 (2006) 2799–2807. R. Love, Enterococcus faecalis–a mechanism for its role in endodontic failure, Int. Endod. J. 34 (2001) 399–405. A. Lowe, P. Lambert, A. Smith, Cloning of an Enterococcus faecalis endocarditis antigen: homology with adhesins from some oral streptococci, Infect. Immun. 63 (1995) 703–706. I. Portenier, T.M. Waltimo, M. Haapasalo, Enterococcus faecalis–the root canal survivor and ‘star’in post‐treatment disease, Endod. Top. 6 (2003) 135–159. H.S. Kafil, A.M. Mobarez, M.F. Moghadam, Z. sadat Hashemi, M. Yousefi, Gentamicin induces efaA expression and biofilm formation in Enterococcus faecalis, Microb. Pathog. 92 (2016) 30–35. R.L. Lock, E.J. Harry, Cell-division inhibitors: new insights for future antibiotics, Nat. Rev. Drug Discov. 7 (2008) 324. B.M. Coffey, G.G. Anderson, Biofilm Formation in the 96-well Microtiter Plate. Pseudomonas Methods and Protocols, Springer, 2014, pp. 631–641. M. Aghazadeh, A. Zahedi Bialvaei, F. Kabiri, N. Saliani, M. Yousefi, H. Eslami, et al., Survey of the antibiofilm and antimicrobial effects of Zingiber officinale (in vitro study), Jundishapur J. Microbiol. 9 (2016). J. Nezhadi, H. Narenji, M.H. Soroush Barhaghi, M.A. Rezaee, R. Ghotaslou, T. Pirzadeh, et al., Peptide nucleic acid-mediated re-sensitization of colistin resistance Escherichia coli KP81 harboring mcr-1 plasmid, Microb. Pathog. 135 (2019) 103646. D. Yang, Z. Qiu, Z. Shen, H. Zhao, M. Jin, H. Li, et al., The occurrence of the colistin resistance gene mcr-1 in the Haihe River (China), Int. J. Environ. Res. Public Health 14 (2017) 576. S. Flahaut, A. Hartke, J.-C. Giard, Y. Auffray, Alkaline stress response in Enterococcus faecalis: adaptation, cross-protection, and changes in protein synthesis, Appl. Environ. Microbiol. 63 (1997) 812–814. M. Aghamali, M.A. Rezaee, S. Taghizadeh, M. Aghazadeh, A. Hasani, M. Rahbar, et al., Evaluation of two novel biofilm-specific antibiotic resistance genes in clinical Pseudomonas aeruginosa isolates, Gene Rep. 13 (2018) 99–103. S.N. Abdi, R. Ghotaslou, M. Asgharzadeh, B. Mehramouz, A. Hasani, H.B. Baghi, et al., AdeB efflux pump gene knockdown by mRNA mediated peptide nucleic acid in multidrug resistance Acinetobacter baumannii, Microb. Pathog. 138 (2020) 1. H.S. Kafil, A.M. Mobarez, Assessment of biofilm formation by enterococci isolates from urinary tract infections with different virulence profiles, J. King Saud Univ. Sci. 27 (2015) 312–317. A.L. Cruz-Rodz, M.S. Gilmore, High efficiency introduction of plasmid DNA into glycine treated Enterococcus faecalis by electroporation, Mol. Gen. Genet. MGG 224 (1990) 152–154. B.D. Shepard, M.S. Gilmore, Electroporation and Efficient Transformation of Enterococcus faecalis Grown in High Concentrations of glycine. Electroporation Protocols for Microorganisms, Springer, 1995, pp. 217–226. A. Friesenegger, S. Fiedler, L.A. Devriese, R. Wirth, Genetic transformation of various species of Enterococcus by electroporation, FEMS Microbiol. Lett. 79 (1991) 323–328. L. Vistejnova, J. Dvorakova, M. Hasova, T. Muthny, V. Velebny, K. Soucek, et al., The comparison of impedance-based method of cell proliferation monitoring with commonly used metabolic-based techniques, Neuroendocrinol. Lett. 30 (2009) 121. S. Mohanty, P. Jena, R. Mehta, R. Pati, B. Banerjee, S. Patil, et al., Cationic

[36]

[37] [38]

[39]

[40]

[41] [42]

[43]

[44]

[45]

[46]

[47]

[48] [49] [50]

[51]

7

antimicrobial peptides and biogenic silver nanoparticles kill mycobacteria without eliciting DNA damage and cytotoxicity in mouse macrophages, Antimicrob. Agents Chemother. 57 (2013) 3688–3698. C.H. Stuart, S.A. Schwartz, T.J. Beeson, C.B. Owatz, Enterococcus faecalis: its role in root canal treatment failure and current concepts in retreatment, J. Endod. 32 (2006) 93–98. E. Drenkard, Antimicrobial resistance of Pseudomonas aeruginosa biofilms, Microb. Infect. (2003) 1213–1219. A. Oliver, R. Cantón, P. Campo, F. Baquero, J. Blázquez, High frequency of hypermutable Pseudomonas aeruginosa in cystic fibrosis lung infection, Science 288 (2000) 1251–1253. H. Bai, Y. You, H. Yan, J. Meng, X. Xue, Z. Hou, et al., Antisense inhibition of gene expression and growth in gram-negative bacteria by cell-penetrating peptide conjugates of peptide nucleic acids targeted to rpoD gene, Biomaterials 33 (2012) 659–667. S. Goh, A. Loeffler, D.H. Lloyd, S.P. Nair, L. Good, Oxacillin sensitization of methicillin-resistant Staphylococcus aureus and methicillin-resistant Staphylococcus pseudintermedius by antisense peptide nucleic acids in vitro, BMC Microbiol. 15 (2015) 262. J.R. Carapetis, A.C. Steer, E.K. Mulholland, M. Weber, The global burden of group A streptococcal diseases, Lancet Infect. Dis. 5 (2005) 685–694. M.L. van Driel, A.I. De Sutter, N. Keber, H. Habraken, T. Christiaens, Different antibiotic treatments for group A streptococcal pharyngitis, Cochrane Database Syst. Rev. 4 (2013) CD004406. S.M. Kuhn, J. Preiksaitis, G.J. Tyrrell, T. Jadavji, D. Church, H. Davies, Evaluation of potential factors contributing to microbiological treatment failure in Streptococcus pyogenes pharyngitis, Can. J. Infect Dis. Med. Microbiol. 12 (2001) 33–39. A.G. Michos, C.G. Bakoula, M. Braoudaki, F.I. Koutouzi, E.S. Roma, A. Pangalis, et al., Macrolide resistance in Streptococcus pyogenes: prevalence, resistance determinants, and emm types, Diagn. Microbiol. Infect. Dis. 64 (2009) 295–299. S.S. Richter, K.P. Heilmann, C.L. Dohrn, S.E. Beekmann, F. Riahi, J. Garcia-deLomas, et al., Increasing telithromycin resistance among Streptococcus pyogenes in Europe, J. Antimicrob. Chemother. 61 (2008) 603–611. N. Patenge, R. Pappesch, F. Krawack, C. Walda, M.A. Mraheil, A. Jacob, et al., Inhibition of growth and gene expression by PNA-peptide conjugates in Streptococcus pyogenes, Mol. Ther. Nucleic Acids 2 (2013). M. Hatamoto, K. Nakai, A. Ohashi, H. Imachi, Sequence-specific bacterial growth inhibition by peptide nucleic acid targeted to the mRNA binding site of 16S rRNA, Appl. Microbiol. Biotechnol. 84 (2009) 1161–1168. M. Mondhe, A. Chessher, S. Goh, L. Good, J.E. Stach, Species-selective killing of bacteria by antimicrobial peptide-PNAs, PLoS One 9 (2014) e89082. J. Davies, Inactivation of antibiotics and the dissemination of resistance genes, Science 264 (1994) 375–382. S.M. Ozbek, A. Ozbek, A.S. Erdorgan, Analysis of Enterococcus faecalis in samples from Turkish patients with primary endodontic infections and failed endodontic treatment by real-time PCR SYBR green method, J. Appl. Oral Sci. 17 (2009) 370–374. E. Bore, S. Langsrud, Ø. Langsrud, T.M. Rode, A. Holck, Acid-shock responses in Staphylococcus aureus investigated by global gene expression analysis, Microbiology 153 (2007) 2289–2303.