- Email: [email protected]
Aquaporin 7 expression in postimplantation mouse uteri: a potential role for glycerol transport in uterine decidualization
Aquaporin 7 expression in postimplantation mouse uteri: a potential role for glycerol transport in uterine decidualization The aquaglyceroporin aquaporin 7 (AQP7) is dynamically expressed in mouse uteri undergoing decidualization after implantation. The expansion of AQP7 during uterine decidualization is associated with elevated uterine glycerol accumulation and glycerol kinase expression, suggesting that glycerol might be a potential energy substrate involved in the process of decidualization. (Fertil Steril 2011;95:1514–7. 2011 by American Society for Reproductive Medicine.) Key Words: AQP7, uterus, decidualization, glycerol, glycerol kinase The aquaporins (AQPs) are a family of transmembrane proteins that transport water (1). Among the members, some of the AQPs (AQP3, AQP7, and AQP9) are also permeable to other small molecules such as glycerol. These subsets of AQPs are also called aquaglyceroporins (1, 2). Emerging evidence has shown important physiologic roles for aquaglyceroporins in facilitating glycerol transport in many tissue types, including skin, adipocyte, liver, and intestine (3–10). One novel concept raised from these Hongying Peng, M.D.a Ying Zhang, B.S.b,c Li Lei, B.S.b,c Qi Chen, M.D.b,c Jingwen Yue, B.S.b Yi Tan, Ph.D.a Enkui Duan, Ph.D.b a Laboratory Animal Center, Chongqing Medical University, Chongqing, People’s Republic of China b State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, Beijing, People’s Republic of China c Graduate School, Chinese Academy of Sciences, Beijing, People’s Republic of China Received August 5, 2010; revised November 1, 2010; accepted November 4, 2010; published online December 4, 2010. H.P. has nothing to disclose. Y.Z. has nothing to disclose. L.L. has nothing to disclose. Q.C. has nothing to disclose. J.Y. has nothing to disclose. Y.T. has nothing to disclose. E.D. has nothing to disclose. H.P., Y.Z., and L.L. contributed equally to this work. Supported by grants from the China National Basic Research Program (2011CB710905, 2011CB944401), the Chinese National Natural Science Foundation (30770816), the Chongqing National Natural Science Foundation (CSTC2009BB5409), and the Research Fund for the Doctoral Program of Higher Education of China (20095503110006). Reprint requests: Yi Tan, Ph.D., Laboratory Animal Center, Chongqing Medical University, No. 1, Yi Xue Yuan Road, Chongqing 400016, People’s Republic of China (E-mail: [email protected]); or Enkui Duan, Ph.D., State Key Laboratory of Reproductive Biology, Institute of Zoology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang, Beijing, 100101, People’s Republic of China (E-mail: [email protected]).
1514
studies is that the aquaglyceroporins could facilitate glycerol transport at the cellular level, thus providing glycerol as a substrate for cell energy metabolism, especially in tissues where rapid cell turnover is involved, such as intestinal epithelial regeneration and skin tumorigenesis (3–5, 11). During mouse embryo implantation, the endometrium undergoes progressive stromal cell decidualization initiating at the site of embryo attachment, a process that involves complex cellular changes characterized by extensive stromal cell proliferation and differentiation into decidual cells (12, 13). In human endometrium, the hormonal requirements and cellular behavior during decidualization are thought to be similar to those in the mouse (14), despite the difference that human decidualization occurs even without the presence of a blastocyst. During mouse decidualization, the uterus undergoes a substantial increase in volume and weight because of vascular angiogenesis and extensive stromal cell growth (13–15), a process somewhat similar to tumor growth regarding cellular behavior and energy metabolism. It is our hypothesis that the process of uterine decidualization might utilize glycerol as an extra energy source through aquaglyceroporin-facilitated glycerol transport. A previous screening of various aquaporins at days 4 and 5 pregnant uteri in the mouse has shown an elevated AQP7 expression after embryo attachment (16), implicating that AQP7 might play a role during postimplantation. In this study we used adult CD1 female mice (7–8 weeks old) to study the expression of AQP7 during decidualization both in vivo and in vitro, as well as its association with uterine glycerol contents during postimplantation. For all experiments in this study, guidelines for the use of research animals were followed (Institute of Zoology, Chinese Academy of Sciences). Experimental procedures were followed as previously described: mouse mating to induce pregnancy or pseudopregnancy (The morning finding of vaginal plug was designated Day 1) (17), induction of artificial decidualization in vivo and uterine stromal cell decidualization in vitro (17–19), RNA preparation, real-time PCR and in situ hybridization immunofluorescence (specific primers and probe for in situ hybridization are provided in Supplemental Table 1)
Fertility and Sterility Vol. 95, No. 4, March 15, 2011 Copyright ª2011 American Society for Reproductive Medicine, Published by Elsevier Inc.
0015-0282/$36.00 doi:10.1016/j.fertnstert.2010.11.011
FIGURE 1 (A–E) In situ hybridization of AQP7 in mouse uteri during pregnancy on days 4–8. The positive signal was visualized as a dark-brown color. (F) Negative control using a sense probe on day 8. Scale bars in A–F, 500 mm. (G–R) AQP7 immunofluorescence in mouse uteri during pregnancy od days 4–8. FITC-labeled AQP7 antibody in green, propidium iodide (PI) labeled nuclei in red. Scale bars in G, I, K, M, P, 500 mm; scale bars in H, J, L, 200 mm; scale bars in N, O, Q, R, 100 mm. + or * represents the location of embryo. PDZ ¼ primary decidual zone; SDZ ¼ secondary decidual zone. In A–R, the mesometrial pole is on the upper side, and the antimesometrial pole is on the lower side of the pictures. (S–V) Immunofluorescence analysis of AQP7 expression at different stages of in vitro–cultured stromal cells undergo decidualization from 0–72 h. Scale bars in S–V, 50 mm. TRITC-labeled AQP7 antibody are in red, and Hoechst-labeled nuclei are in blue. (W) Glycerol contents during periimplantation uteri from days 4–8 showing an significantly increase with the progress of uterine decidualization (day 4, n ¼ 4; days 5 and 6, n ¼ 5; days 7 and 8, n ¼ 6; linear regression analysis). (X) gyk expression changes during periimplantation uteri from days 4–8 (days 4–7, n ¼ 3; day 8, n ¼ 4; linear regression analysis).
Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
Fertility and Sterility
1515
(18, 20, 21). Primary antibodies used in this study were as follows: rabbit anti-AQP7 (1:500; AB15568; Millipore, Billerica MA), mouse anti-vimentin (1:500; ab20346; Abcam, Cambridge MA), mouse anti-cytokeratin (1:300; ab6401; Abcam). For glycerol assay, uterine samples from day 4–8 pregnant female mice were trimmed off mesometrium and fat, flash-frozen, and stored in liquid nitrogen before use. Tissue glycerol contents were detected by using a Glycerol Assay Kit (Biovision, Mountain View, CA) according to the manufacturer’s instructions. In situ hybridization results revealed that AQP7 showed no obvious expression in the uterine stroma on day 4 of pregnancy (Fig. 1A), whereas on the morning of day 5, immediately after the initiation of embryo attachment, AQP7 showed a specific increase around the attachment site of embryo implantation (Fig. 1B). This expression pattern further expanded with the decidualization process in day 6–8 uteri (Fig. 1C–1E). We also performed AQP7 immunofluorescence during days 4–8 and showed a consistent expression pattern compared with in situ hybridization (Fig. 1G, 1I, 1K, 1M, and 1P). Notably, when AQP7 initially appeared in the decidual cells at day 5, its localization is intensely confined in the cells surrounding implantation site, with a spotty distribution (Fig. 1J). From day 6–8, AQP7 become extensively expressed in the primary decidual zone; during this time, AQP7 expression showed a region-specific pattern. While the peripheral expression region showed a spotty signal similar to day 5 (Fig. 1L, 1N, and 1Q), the subluminal stroma surrounding the implantation site showed a distinct pattern with strong cell plasma membrane staining (Fig. 1L, 1O, and 1R). To examine whether AQP7 expression is dependent on the presence of living embryo or mainly induced by uterine decidualization reaction, we analyzed AQP7 expression in an artificial uterine decidualization model induced by intraluminal oil infusion (17). As shown in Supplemental Figure 1, the AQP7 expression pattern is strikingly similar with that observed in normal implantation and decidualization, suggesting that AQP7 induction in uteri is mainly dependent on uterine decidualization process. Besides the expression pattern being described, there is also a constant detection of AQP7 in the myometrium in most examined samples; however, the biologic significance of such staining is still unclear. We next used an in vitro uterine stromal cell decidualization model (18, 19) to further reveal the association between AQP7 expression and uterine cell decidualization. The in vitro cultured stromal cells (isolated from day 4 uteri) were identified as vimentin-positive and cytokeratin-negative cells (Supplemental Fig. 2A) (18). After 24, 48, and 72 hours of culture, these stromal cells grew extensively in vitro and progressively showed characteristics of decidual cells with large volume and multiple nucleoli (Supplemental Fig. 2B). Furthermore, we used a sensitive decidualization marker, decidual prolactin-related protein (dPRP) (18, 22), to monitor the process of decidualization in vitro. As shown in Supplemental Figure 2D, the substantially increased dPRP demonstrated the robust decidualization process in our in vitro culture system (0, 24, 48, 72 hours), which is similar to the decidualization process in vivo (Supplemental Fig. 2C). The cultured cells were used for AQP7 immunofluorescence and showed increased expression with the progression of decidualization in a time dependent manner (Fig. 1S–1V). It is notable that AQP7 expression in vitro showed a spotty pattern within the cells, which mimicked the expression observed in day 5 uteri (Fig. 1J) and
1516
Peng et al.
AQP7 in mouse uterine decidualization
some subregions of day 7–8 uteri (Fig. 1N and 1Q), without forming an extensive cell plasma membrane localization (Fig. 1O and 1R). These results might reflect the different cellular environment of in vitro and in vivo decidualization. Because AQP7 is an aquaglyceroporin that is important for glycerol permeability, its specific expression in close association with the decidualization process suggested that there might be a relationship between glycerol transport and uterine decidualization. Glycerol has been recently demonstrated as an alternative energy source for cell proliferation, especially at tissues with rapid cell turnover (4, 5). We supposed that the rapid uterine weight increase and cell proliferation during decidualization might similarly involve increased glycerol utilization facilitated by AQP7. Therefore, we next examined the uterine glycerol contents during early pregnancy from days 4–8. As shown in Figure 1W, the glycerol contents of pregnant uteri indeed showed a significant increase after implantation as revealed by linear regression analysis. Because gyk is the rate-limiting enzyme that catalyzes glycerol into glycerol-3-P and then enters metabolic pathway for ATP production (4, 23), we next examined the uterine expression of gyk during days 4–8. As shown in Figure 1X, gyk also showed an increasing trend during days 4–8 uteri in a fashion similar to that of glycerol level. These results are inconsistent with previous reports indicating that glycerol itself is a stimulator for Gyk enzymatic activation (23, 24), further supporting the hypothesis that there might be an increasing requirement in glycerol utilization for energy production during decidualization. AQP7 was first cloned from human adipose tissue and rat testis as an aquaglyceroporin by independent groups (25, 26). AQP7 is abundantly expressed in adipose tissue and is currently considered as the only glycerol channel for adipocyte, which is involved in glycerol metabolism by facilitating glycerol transport (4, 5, 23). Using AQP7 knockout mice models (8, 27–30), it has been revealed that AQP7 is responsible for glycerol exit from the adipocyte and is involved in the development of obesity (8, 23). In addition, AQP7 deletion could affect insulin production and secretion in mouse pancreatic b-cells because of dysregulated glycerol contents and Gyk activity (27). A recent discovery also showed that AQP7-mediated glycerol transport is important for cardiomyocyte function by introducing glycerol as an energy substrate (31). This evidence has reached a consensus suggesting AQP7 as a general glycerol gateway involved in energy metabolism of specific tissues and cells. In this regard, our data have added to the suggestion that AQP7 serves as a glycerol gateway providing the decidualizing uteri with increased glycerol concentration, which could be further utilized as an energy substrate for the rapid proliferation of decidual cells. However, it seems that AQP7-knockout mice are fertile, suggesting that the loss of AQP7 was not critical, or more possibly its functions were compensated by other genes involved in glycerol transport or metabolism in the uterus. The gyk knockout mice were also generated, but showed neonatal death by 3–4 days after birth (32), precluding the examination of the functional importance of glycerol metabolism in the uterus. In the future, creating gyk-loxp mice to generate a uterine-specific gyk knockout will provide further insight to the biologic functions of Gyk-mediated glycerol metabolism in uteri. Nonetheless, our data show that the process of uterine decidualization might involve AQP7-facilitated glycerol accumulation and
Vol. 95, No. 4, March 15, 2011
increased gyk expression, suggesting a possibility that uterine decidualization might use glycerol as a potential energy substrate for extensive cell growth.
Acknowledgment: The authors thank Zeng-Ming Yang, Ph.D., at Xiamen University for technical help in performing in situ hybridization experiments.
REFERENCES 1. King LS, Kozono D, Agre P. From structure to disease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Biol 2004;5:687–98. 2. Rojek A, Praetorius J, Frokiaer J, Nielsen S, Fenton RA. A current view of the mammalian aquaglyceroporins. Annu Rev Physiol 2008;70: 301–27. 3. Hara-Chikuma M, Verkman AS. Aquaporin-3 facilitates epidermal cell migration and proliferation during wound healing. J Mol Med 2008;86:221–31. 4. Hara-Chikuma M, Verkman AS. Prevention of skin tumorigenesis and impairment of epidermal cell proliferation by targeted aquaporin-3 gene disruption. Mol Cell Biol 2008;28:326–32. 5. Thiagarajah JR, Zhao D, Verkman AS. Impaired enterocyte proliferation in aquaporin-3 deficiency in mouse models of colitis. Gut 2007;56:1529–35. 6. Ma T, Hara M, Sougrat R, Verbavatz JM, Verkman AS. Impaired stratum corneum hydration in mice lacking epidermal water channel aquaporin-3. J Biol Chem 2002;277: 17147–53. 7. Hara M, Ma T, Verkman AS. Selectively reduced glycerol in skin of aquaporin-3-deficient mice may account for impaired skin hydration, elasticity, and barrier recovery. J Biol Chem 2002;277: 46616–21. 8. Hara-Chikuma M, Sohara E, Rai T, Ikawa M, Okabe M, Sasaki S, et al. Progressive adipocyte hypertrophy in aquaporin-7-deficient mice: adipocyte glycerol permeability as a novel regulator of fat accumulation. J Biol Chem 2005;280:15493–6. 9. Rojek AM, Skowronski MT, Fuchtbauer EM, Fuchtbauer AC, Fenton RA, Agre P, et al. Defective glycerol metabolism in aquaporin 9 (AQP9) knockout mice. Proc Natl Acad Sci U S A 2007;104:3609–14. 10. Hara M, Verkman AS. Glycerol replacement corrects defective skin hydration, elasticity, and barrier function in aquaporin-3-deficient mice. Proc Natl Acad Sci U S A 2003;100:7360–5. 11. Verkman AS, Hara-Chikuma M, Papadopoulos MC. Aquaporins–new players in cancer biology. J Mol Med 2008;86:523–9. 12. Lim HJ, Wang H. Uterine disorders and pregnancy complications: insights from mouse models. J Clin Invest 2010;120:1004–15.
Fertility and Sterility
13. Das SK. Cell cycle regulatory control for uterine stromal cell decidualization in implantation. Reproduction 2009;137:889–99. 14. Lim HJ, Wang H. Uterine disorders and pregnancy complications: insights from mouse models. J Clin Invest 2010;120:1004–15. 15. Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, et al. Molecular cues to implantation. Endocr Rev 2004;25:341–73. 16. Richard C, Gao J, Brown N, Reese J. Aquaporin water channel genes are differentially expressed and regulated by ovarian steroids during the periimplantation period in the mouse. Endocrinology 2003;144:1533–41. 17. Kuang H, Chen Q, Fan X, Zhang Y, Zhang L, Peng H, et al. CXCL14 inhibits trophoblast outgrowth via a paracrine/autocrine manner during early pregnancy in mice. J Cell Physiol 2009;221: 448–57. 18. Zhang L, Guo W, Chen Q, Fan X, Zhang Y, Duan E. Adam12 plays a role during uterine decidualization in mice. Cell Tissue Res 2009;338:413–21. 19. Tan Y, Li M, Cox S, Davis MK, Tawfik O, Paria BC, et al. HB-EGF directs stromal cell polyploidy and decidualization via cyclin D3 during implantation. Dev Biol 2004;265:181–95. 20. Ni H, Yu XJ, Liu HJ, Lei W, Rengaraj D, Li XJ, et al. Progesterone regulation of glutathione S-transferase Mu2 expression in mouse uterine luminal epithelium during preimplantation period. Fertil Steril 2009;91:2123–30. 21. Kuang H, Chen Q, Zhang Y, Zhang L, Peng H, Ning L, et al. The cytokine gene CXCL14 restricts human trophoblast cell invasion by suppressing gelatinase activity. Endocrinology 2009;150: 5596–605. 22. Gu Y, Soares MJ, Srivastava RK, Gibori G. Expression of decidual prolactin-related protein in the rat decidua. Endocrinology 1994;135:1422–7. 23. Hibuse T, Maeda N, Funahashi T, Yamamoto K, Nagasawa A, Mizunoya W, et al. Aquaporin 7 deficiency is associated with development of obesity through activation of adipose glycerol kinase. Proc Natl Acad Sci U S A 2005;102: 10993–8. 24. Yeh JI, Charrier V, Paulo J, Hou L, Darbon E, Claiborne A, et al. Structures of enterococcal glycerol kinase in the absence and presence of
25.
26.
27.
28.
29.
30.
31.
32.
glycerol: correlation of conformation to substrate binding and a mechanism of activation by phosphorylation. Biochemistry-Us 2004;43: 362–73. Ishibashi K, Kuwahara M, Gu Y, Kageyama Y, Tohsaka A, Suzuki F, et al. Cloning and functional expression of a new water channel abundantly expressed in the testis permeable to water, glycerol, and urea. J Biol Chem 1997;272: 20782–6. Kuriyama H, Kawamoto S, Ishida N, Ohno I, Mita S, Matsuzawa Y, et al. Molecular cloning and expression of a novel human aquaporin from adipose tissue with glycerol permeability. Biochem Biophys Res Commun 1997;241:53–8. Matsumura K, Chang BH, Fujimiya M, Chen W, Kulkarni RN, Eguchi Y, et al. Aquaporin 7 is a beta-cell protein and regulator of intraislet glycerol content and glycerol kinase activity, beta-cell mass, and insulin production and secretion. Mol Cell Biol 2007;27:6026–37. Skowronski MT, Lebeck J, Rojek A, Praetorius J, Fuchtbauer EM, Frokiaer J, et al. AQP7 is localized in capillaries of adipose tissue, cardiac and striated muscle: implications in glycerol metabolism. Am J Physiol Renal Physiol 2007;292:F956–65. Sohara E, Rai T, Miyazaki J, Verkman AS, Sasaki S, Uchida S. Defective water and glycerol transport in the proximal tubules of AQP7 knockout mice. Am J Physiol Renal Physiol 2005;289:F1195–200. Maeda N, Funahashi T, Hibuse T, Nagasawa A, Kishida K, Kuriyama H, et al. Adaptation to fasting by glycerol transport through aquaporin 7 in adipose tissue. Proc Natl Acad Sci U S A 2004;101:17801–6. Hibuse T, Maeda N, Nakatsuji H, Tochino Y, Fujita K, Kihara S, et al. The heart requires glycerol as an energy substrate through aquaporin 7, a glycerol facilitator. Cardiovasc Res 2009;83: 34–41. Huq AH, Lovell RS, Ou CN, Beaudet AL, Craigen WJ. X-linked glycerol kinase deficiency in the mouse leads to growth retardation, altered fat metabolism, autonomous glucocorticoid secretion and neonatal death. Hum Mol Genet 1997;6:1803–9.
1517
SUPPLEMENTAL FIGURE 1 AQP7 immunofluorescence detection in murine pseudopregnant uteri undergo oil-induced artificial decidualization on day 5 (A–D), day 6 (E–H), and day 8 (I–M), showing a similar expression pattern compared with normal pregnancy. FITC-labeled AQP7 antibody in green, propidium iodide (PI)-labeled nuclei in red. Scale bars in A, E, I, 500 mm; scale bars in D, H, L, M, 500 mm. Similar results were obtained in two to three independent mice.
Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
1517.e1
Peng et al.
AQP7 in mouse uterine decidualization
Vol. 95, No. 4, March 15, 2011
SUPPLEMENTAL FIGURE 2 Identification of uterine stromal cells undergoing in vitro decidualization. Uterine stromal cells were collected from day 4 pregnant uteri and treated with P4 and E2 to induce decidualization in vitro. (A) Immunofluorescence analysis of vimentin and cytokeratin staining in cultured stromal cells. The vimentin positive, cytokeratin-negative staining demonstrated that these cells are of stromal origin. (B) Phase contrast images showing morphologic changes of cultured stromal cells under progesterone (P4) and estrogen (E2) treatment up to 72 h (in vitro decidualization). (C, D) Quantitative RT-PCR analysis of dPRP mRNA as a sensitive marker for uterine cell decidualization during (C) day 4–8 uteri and in (D) stromal cells at different time points of in vitro decidualization (mean SE of three independent samples for each time point). *P<0.05; **P<0.01, compared with 0 h. The fold values on the y axis represent relative expression level compared with day 4 (C) or 0 hours (D). For statistics in C and D, the original fold values were converted into s log value after one-way ANOVA.
Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
Fertility and Sterility
1517.e2
SUPPLEMENTAL TABLE 1 Primers used in this study. Forward primer(50 –30 )
Reverse primer(50 –30 )
TTATGGGTGCATGGATCACTCC AAAGGTCCAAGAGGCTGTTGA TGGAATCCTGTGGCATCCATG AAAC TCGTGACTGGGATGCTGC
CCCACGTAAGGTCATCATGGAT GCCCCAGCTTTCAGGCTAT TAAAACGCAGCTCAGTAACAG TCCG ACGGGATGGGTTGATTGC
Transcript dPRP Gyk b-actin AQP7
GenBank accession number NM_010088.1 AK044308.1 NM_007393 NM_007473.4
Note: The Gyk primers were obtained from Primer Bank, PrimerBank ID: 26336352a3. The AQP7 primers for the in situ hybridization probe generated a product of 158 bp (759–917) used as a detection probe. Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
1517.e3
Peng et al.
AQP7 in mouse uterine decidualization
Vol. 95, No. 4, March 15, 2011
1514
studies is that the aquaglyceroporins could facilitate glycerol transport at the cellular level, thus providing glycerol as a substrate for cell energy metabolism, especially in tissues where rapid cell turnover is involved, such as intestinal epithelial regeneration and skin tumorigenesis (3–5, 11). During mouse embryo implantation, the endometrium undergoes progressive stromal cell decidualization initiating at the site of embryo attachment, a process that involves complex cellular changes characterized by extensive stromal cell proliferation and differentiation into decidual cells (12, 13). In human endometrium, the hormonal requirements and cellular behavior during decidualization are thought to be similar to those in the mouse (14), despite the difference that human decidualization occurs even without the presence of a blastocyst. During mouse decidualization, the uterus undergoes a substantial increase in volume and weight because of vascular angiogenesis and extensive stromal cell growth (13–15), a process somewhat similar to tumor growth regarding cellular behavior and energy metabolism. It is our hypothesis that the process of uterine decidualization might utilize glycerol as an extra energy source through aquaglyceroporin-facilitated glycerol transport. A previous screening of various aquaporins at days 4 and 5 pregnant uteri in the mouse has shown an elevated AQP7 expression after embryo attachment (16), implicating that AQP7 might play a role during postimplantation. In this study we used adult CD1 female mice (7–8 weeks old) to study the expression of AQP7 during decidualization both in vivo and in vitro, as well as its association with uterine glycerol contents during postimplantation. For all experiments in this study, guidelines for the use of research animals were followed (Institute of Zoology, Chinese Academy of Sciences). Experimental procedures were followed as previously described: mouse mating to induce pregnancy or pseudopregnancy (The morning finding of vaginal plug was designated Day 1) (17), induction of artificial decidualization in vivo and uterine stromal cell decidualization in vitro (17–19), RNA preparation, real-time PCR and in situ hybridization immunofluorescence (specific primers and probe for in situ hybridization are provided in Supplemental Table 1)
Fertility and Sterility Vol. 95, No. 4, March 15, 2011 Copyright ª2011 American Society for Reproductive Medicine, Published by Elsevier Inc.
0015-0282/$36.00 doi:10.1016/j.fertnstert.2010.11.011
FIGURE 1 (A–E) In situ hybridization of AQP7 in mouse uteri during pregnancy on days 4–8. The positive signal was visualized as a dark-brown color. (F) Negative control using a sense probe on day 8. Scale bars in A–F, 500 mm. (G–R) AQP7 immunofluorescence in mouse uteri during pregnancy od days 4–8. FITC-labeled AQP7 antibody in green, propidium iodide (PI) labeled nuclei in red. Scale bars in G, I, K, M, P, 500 mm; scale bars in H, J, L, 200 mm; scale bars in N, O, Q, R, 100 mm. + or * represents the location of embryo. PDZ ¼ primary decidual zone; SDZ ¼ secondary decidual zone. In A–R, the mesometrial pole is on the upper side, and the antimesometrial pole is on the lower side of the pictures. (S–V) Immunofluorescence analysis of AQP7 expression at different stages of in vitro–cultured stromal cells undergo decidualization from 0–72 h. Scale bars in S–V, 50 mm. TRITC-labeled AQP7 antibody are in red, and Hoechst-labeled nuclei are in blue. (W) Glycerol contents during periimplantation uteri from days 4–8 showing an significantly increase with the progress of uterine decidualization (day 4, n ¼ 4; days 5 and 6, n ¼ 5; days 7 and 8, n ¼ 6; linear regression analysis). (X) gyk expression changes during periimplantation uteri from days 4–8 (days 4–7, n ¼ 3; day 8, n ¼ 4; linear regression analysis).
Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
Fertility and Sterility
1515
(18, 20, 21). Primary antibodies used in this study were as follows: rabbit anti-AQP7 (1:500; AB15568; Millipore, Billerica MA), mouse anti-vimentin (1:500; ab20346; Abcam, Cambridge MA), mouse anti-cytokeratin (1:300; ab6401; Abcam). For glycerol assay, uterine samples from day 4–8 pregnant female mice were trimmed off mesometrium and fat, flash-frozen, and stored in liquid nitrogen before use. Tissue glycerol contents were detected by using a Glycerol Assay Kit (Biovision, Mountain View, CA) according to the manufacturer’s instructions. In situ hybridization results revealed that AQP7 showed no obvious expression in the uterine stroma on day 4 of pregnancy (Fig. 1A), whereas on the morning of day 5, immediately after the initiation of embryo attachment, AQP7 showed a specific increase around the attachment site of embryo implantation (Fig. 1B). This expression pattern further expanded with the decidualization process in day 6–8 uteri (Fig. 1C–1E). We also performed AQP7 immunofluorescence during days 4–8 and showed a consistent expression pattern compared with in situ hybridization (Fig. 1G, 1I, 1K, 1M, and 1P). Notably, when AQP7 initially appeared in the decidual cells at day 5, its localization is intensely confined in the cells surrounding implantation site, with a spotty distribution (Fig. 1J). From day 6–8, AQP7 become extensively expressed in the primary decidual zone; during this time, AQP7 expression showed a region-specific pattern. While the peripheral expression region showed a spotty signal similar to day 5 (Fig. 1L, 1N, and 1Q), the subluminal stroma surrounding the implantation site showed a distinct pattern with strong cell plasma membrane staining (Fig. 1L, 1O, and 1R). To examine whether AQP7 expression is dependent on the presence of living embryo or mainly induced by uterine decidualization reaction, we analyzed AQP7 expression in an artificial uterine decidualization model induced by intraluminal oil infusion (17). As shown in Supplemental Figure 1, the AQP7 expression pattern is strikingly similar with that observed in normal implantation and decidualization, suggesting that AQP7 induction in uteri is mainly dependent on uterine decidualization process. Besides the expression pattern being described, there is also a constant detection of AQP7 in the myometrium in most examined samples; however, the biologic significance of such staining is still unclear. We next used an in vitro uterine stromal cell decidualization model (18, 19) to further reveal the association between AQP7 expression and uterine cell decidualization. The in vitro cultured stromal cells (isolated from day 4 uteri) were identified as vimentin-positive and cytokeratin-negative cells (Supplemental Fig. 2A) (18). After 24, 48, and 72 hours of culture, these stromal cells grew extensively in vitro and progressively showed characteristics of decidual cells with large volume and multiple nucleoli (Supplemental Fig. 2B). Furthermore, we used a sensitive decidualization marker, decidual prolactin-related protein (dPRP) (18, 22), to monitor the process of decidualization in vitro. As shown in Supplemental Figure 2D, the substantially increased dPRP demonstrated the robust decidualization process in our in vitro culture system (0, 24, 48, 72 hours), which is similar to the decidualization process in vivo (Supplemental Fig. 2C). The cultured cells were used for AQP7 immunofluorescence and showed increased expression with the progression of decidualization in a time dependent manner (Fig. 1S–1V). It is notable that AQP7 expression in vitro showed a spotty pattern within the cells, which mimicked the expression observed in day 5 uteri (Fig. 1J) and
1516
Peng et al.
AQP7 in mouse uterine decidualization
some subregions of day 7–8 uteri (Fig. 1N and 1Q), without forming an extensive cell plasma membrane localization (Fig. 1O and 1R). These results might reflect the different cellular environment of in vitro and in vivo decidualization. Because AQP7 is an aquaglyceroporin that is important for glycerol permeability, its specific expression in close association with the decidualization process suggested that there might be a relationship between glycerol transport and uterine decidualization. Glycerol has been recently demonstrated as an alternative energy source for cell proliferation, especially at tissues with rapid cell turnover (4, 5). We supposed that the rapid uterine weight increase and cell proliferation during decidualization might similarly involve increased glycerol utilization facilitated by AQP7. Therefore, we next examined the uterine glycerol contents during early pregnancy from days 4–8. As shown in Figure 1W, the glycerol contents of pregnant uteri indeed showed a significant increase after implantation as revealed by linear regression analysis. Because gyk is the rate-limiting enzyme that catalyzes glycerol into glycerol-3-P and then enters metabolic pathway for ATP production (4, 23), we next examined the uterine expression of gyk during days 4–8. As shown in Figure 1X, gyk also showed an increasing trend during days 4–8 uteri in a fashion similar to that of glycerol level. These results are inconsistent with previous reports indicating that glycerol itself is a stimulator for Gyk enzymatic activation (23, 24), further supporting the hypothesis that there might be an increasing requirement in glycerol utilization for energy production during decidualization. AQP7 was first cloned from human adipose tissue and rat testis as an aquaglyceroporin by independent groups (25, 26). AQP7 is abundantly expressed in adipose tissue and is currently considered as the only glycerol channel for adipocyte, which is involved in glycerol metabolism by facilitating glycerol transport (4, 5, 23). Using AQP7 knockout mice models (8, 27–30), it has been revealed that AQP7 is responsible for glycerol exit from the adipocyte and is involved in the development of obesity (8, 23). In addition, AQP7 deletion could affect insulin production and secretion in mouse pancreatic b-cells because of dysregulated glycerol contents and Gyk activity (27). A recent discovery also showed that AQP7-mediated glycerol transport is important for cardiomyocyte function by introducing glycerol as an energy substrate (31). This evidence has reached a consensus suggesting AQP7 as a general glycerol gateway involved in energy metabolism of specific tissues and cells. In this regard, our data have added to the suggestion that AQP7 serves as a glycerol gateway providing the decidualizing uteri with increased glycerol concentration, which could be further utilized as an energy substrate for the rapid proliferation of decidual cells. However, it seems that AQP7-knockout mice are fertile, suggesting that the loss of AQP7 was not critical, or more possibly its functions were compensated by other genes involved in glycerol transport or metabolism in the uterus. The gyk knockout mice were also generated, but showed neonatal death by 3–4 days after birth (32), precluding the examination of the functional importance of glycerol metabolism in the uterus. In the future, creating gyk-loxp mice to generate a uterine-specific gyk knockout will provide further insight to the biologic functions of Gyk-mediated glycerol metabolism in uteri. Nonetheless, our data show that the process of uterine decidualization might involve AQP7-facilitated glycerol accumulation and
Vol. 95, No. 4, March 15, 2011
increased gyk expression, suggesting a possibility that uterine decidualization might use glycerol as a potential energy substrate for extensive cell growth.
Acknowledgment: The authors thank Zeng-Ming Yang, Ph.D., at Xiamen University for technical help in performing in situ hybridization experiments.
REFERENCES 1. King LS, Kozono D, Agre P. From structure to disease: the evolving tale of aquaporin biology. Nat Rev Mol Cell Biol 2004;5:687–98. 2. Rojek A, Praetorius J, Frokiaer J, Nielsen S, Fenton RA. A current view of the mammalian aquaglyceroporins. Annu Rev Physiol 2008;70: 301–27. 3. Hara-Chikuma M, Verkman AS. Aquaporin-3 facilitates epidermal cell migration and proliferation during wound healing. J Mol Med 2008;86:221–31. 4. Hara-Chikuma M, Verkman AS. Prevention of skin tumorigenesis and impairment of epidermal cell proliferation by targeted aquaporin-3 gene disruption. Mol Cell Biol 2008;28:326–32. 5. Thiagarajah JR, Zhao D, Verkman AS. Impaired enterocyte proliferation in aquaporin-3 deficiency in mouse models of colitis. Gut 2007;56:1529–35. 6. Ma T, Hara M, Sougrat R, Verbavatz JM, Verkman AS. Impaired stratum corneum hydration in mice lacking epidermal water channel aquaporin-3. J Biol Chem 2002;277: 17147–53. 7. Hara M, Ma T, Verkman AS. Selectively reduced glycerol in skin of aquaporin-3-deficient mice may account for impaired skin hydration, elasticity, and barrier recovery. J Biol Chem 2002;277: 46616–21. 8. Hara-Chikuma M, Sohara E, Rai T, Ikawa M, Okabe M, Sasaki S, et al. Progressive adipocyte hypertrophy in aquaporin-7-deficient mice: adipocyte glycerol permeability as a novel regulator of fat accumulation. J Biol Chem 2005;280:15493–6. 9. Rojek AM, Skowronski MT, Fuchtbauer EM, Fuchtbauer AC, Fenton RA, Agre P, et al. Defective glycerol metabolism in aquaporin 9 (AQP9) knockout mice. Proc Natl Acad Sci U S A 2007;104:3609–14. 10. Hara M, Verkman AS. Glycerol replacement corrects defective skin hydration, elasticity, and barrier function in aquaporin-3-deficient mice. Proc Natl Acad Sci U S A 2003;100:7360–5. 11. Verkman AS, Hara-Chikuma M, Papadopoulos MC. Aquaporins–new players in cancer biology. J Mol Med 2008;86:523–9. 12. Lim HJ, Wang H. Uterine disorders and pregnancy complications: insights from mouse models. J Clin Invest 2010;120:1004–15.
Fertility and Sterility
13. Das SK. Cell cycle regulatory control for uterine stromal cell decidualization in implantation. Reproduction 2009;137:889–99. 14. Lim HJ, Wang H. Uterine disorders and pregnancy complications: insights from mouse models. J Clin Invest 2010;120:1004–15. 15. Dey SK, Lim H, Das SK, Reese J, Paria BC, Daikoku T, et al. Molecular cues to implantation. Endocr Rev 2004;25:341–73. 16. Richard C, Gao J, Brown N, Reese J. Aquaporin water channel genes are differentially expressed and regulated by ovarian steroids during the periimplantation period in the mouse. Endocrinology 2003;144:1533–41. 17. Kuang H, Chen Q, Fan X, Zhang Y, Zhang L, Peng H, et al. CXCL14 inhibits trophoblast outgrowth via a paracrine/autocrine manner during early pregnancy in mice. J Cell Physiol 2009;221: 448–57. 18. Zhang L, Guo W, Chen Q, Fan X, Zhang Y, Duan E. Adam12 plays a role during uterine decidualization in mice. Cell Tissue Res 2009;338:413–21. 19. Tan Y, Li M, Cox S, Davis MK, Tawfik O, Paria BC, et al. HB-EGF directs stromal cell polyploidy and decidualization via cyclin D3 during implantation. Dev Biol 2004;265:181–95. 20. Ni H, Yu XJ, Liu HJ, Lei W, Rengaraj D, Li XJ, et al. Progesterone regulation of glutathione S-transferase Mu2 expression in mouse uterine luminal epithelium during preimplantation period. Fertil Steril 2009;91:2123–30. 21. Kuang H, Chen Q, Zhang Y, Zhang L, Peng H, Ning L, et al. The cytokine gene CXCL14 restricts human trophoblast cell invasion by suppressing gelatinase activity. Endocrinology 2009;150: 5596–605. 22. Gu Y, Soares MJ, Srivastava RK, Gibori G. Expression of decidual prolactin-related protein in the rat decidua. Endocrinology 1994;135:1422–7. 23. Hibuse T, Maeda N, Funahashi T, Yamamoto K, Nagasawa A, Mizunoya W, et al. Aquaporin 7 deficiency is associated with development of obesity through activation of adipose glycerol kinase. Proc Natl Acad Sci U S A 2005;102: 10993–8. 24. Yeh JI, Charrier V, Paulo J, Hou L, Darbon E, Claiborne A, et al. Structures of enterococcal glycerol kinase in the absence and presence of
25.
26.
27.
28.
29.
30.
31.
32.
glycerol: correlation of conformation to substrate binding and a mechanism of activation by phosphorylation. Biochemistry-Us 2004;43: 362–73. Ishibashi K, Kuwahara M, Gu Y, Kageyama Y, Tohsaka A, Suzuki F, et al. Cloning and functional expression of a new water channel abundantly expressed in the testis permeable to water, glycerol, and urea. J Biol Chem 1997;272: 20782–6. Kuriyama H, Kawamoto S, Ishida N, Ohno I, Mita S, Matsuzawa Y, et al. Molecular cloning and expression of a novel human aquaporin from adipose tissue with glycerol permeability. Biochem Biophys Res Commun 1997;241:53–8. Matsumura K, Chang BH, Fujimiya M, Chen W, Kulkarni RN, Eguchi Y, et al. Aquaporin 7 is a beta-cell protein and regulator of intraislet glycerol content and glycerol kinase activity, beta-cell mass, and insulin production and secretion. Mol Cell Biol 2007;27:6026–37. Skowronski MT, Lebeck J, Rojek A, Praetorius J, Fuchtbauer EM, Frokiaer J, et al. AQP7 is localized in capillaries of adipose tissue, cardiac and striated muscle: implications in glycerol metabolism. Am J Physiol Renal Physiol 2007;292:F956–65. Sohara E, Rai T, Miyazaki J, Verkman AS, Sasaki S, Uchida S. Defective water and glycerol transport in the proximal tubules of AQP7 knockout mice. Am J Physiol Renal Physiol 2005;289:F1195–200. Maeda N, Funahashi T, Hibuse T, Nagasawa A, Kishida K, Kuriyama H, et al. Adaptation to fasting by glycerol transport through aquaporin 7 in adipose tissue. Proc Natl Acad Sci U S A 2004;101:17801–6. Hibuse T, Maeda N, Nakatsuji H, Tochino Y, Fujita K, Kihara S, et al. The heart requires glycerol as an energy substrate through aquaporin 7, a glycerol facilitator. Cardiovasc Res 2009;83: 34–41. Huq AH, Lovell RS, Ou CN, Beaudet AL, Craigen WJ. X-linked glycerol kinase deficiency in the mouse leads to growth retardation, altered fat metabolism, autonomous glucocorticoid secretion and neonatal death. Hum Mol Genet 1997;6:1803–9.
1517
SUPPLEMENTAL FIGURE 1 AQP7 immunofluorescence detection in murine pseudopregnant uteri undergo oil-induced artificial decidualization on day 5 (A–D), day 6 (E–H), and day 8 (I–M), showing a similar expression pattern compared with normal pregnancy. FITC-labeled AQP7 antibody in green, propidium iodide (PI)-labeled nuclei in red. Scale bars in A, E, I, 500 mm; scale bars in D, H, L, M, 500 mm. Similar results were obtained in two to three independent mice.
Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
1517.e1
Peng et al.
AQP7 in mouse uterine decidualization
Vol. 95, No. 4, March 15, 2011
SUPPLEMENTAL FIGURE 2 Identification of uterine stromal cells undergoing in vitro decidualization. Uterine stromal cells were collected from day 4 pregnant uteri and treated with P4 and E2 to induce decidualization in vitro. (A) Immunofluorescence analysis of vimentin and cytokeratin staining in cultured stromal cells. The vimentin positive, cytokeratin-negative staining demonstrated that these cells are of stromal origin. (B) Phase contrast images showing morphologic changes of cultured stromal cells under progesterone (P4) and estrogen (E2) treatment up to 72 h (in vitro decidualization). (C, D) Quantitative RT-PCR analysis of dPRP mRNA as a sensitive marker for uterine cell decidualization during (C) day 4–8 uteri and in (D) stromal cells at different time points of in vitro decidualization (mean SE of three independent samples for each time point). *P<0.05; **P<0.01, compared with 0 h. The fold values on the y axis represent relative expression level compared with day 4 (C) or 0 hours (D). For statistics in C and D, the original fold values were converted into s log value after one-way ANOVA.
Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
Fertility and Sterility
1517.e2
SUPPLEMENTAL TABLE 1 Primers used in this study. Forward primer(50 –30 )
Reverse primer(50 –30 )
TTATGGGTGCATGGATCACTCC AAAGGTCCAAGAGGCTGTTGA TGGAATCCTGTGGCATCCATG AAAC TCGTGACTGGGATGCTGC
CCCACGTAAGGTCATCATGGAT GCCCCAGCTTTCAGGCTAT TAAAACGCAGCTCAGTAACAG TCCG ACGGGATGGGTTGATTGC
Transcript dPRP Gyk b-actin AQP7
GenBank accession number NM_010088.1 AK044308.1 NM_007393 NM_007473.4
Note: The Gyk primers were obtained from Primer Bank, PrimerBank ID: 26336352a3. The AQP7 primers for the in situ hybridization probe generated a product of 158 bp (759–917) used as a detection probe. Peng. AQP7 in mouse uterine decidualization. Fertil Steril 2011.
1517.e3
Peng et al.
AQP7 in mouse uterine decidualization
Vol. 95, No. 4, March 15, 2011