- Email: [email protected]
Arginine vasotocin neuronal development and its projection in the adult brain of the medaka
Neuroscience Letters 613 (2016) 47–53
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research paper
Arginine vasotocin neuronal development and its projection in the adult brain of the medaka Nao Kagawa a,∗ , Akira Honda a , Akiko Zenno a , Ryosuke Omoto a , Saya Imanaka a , Yusuke Takehana b , Kiyoshi Naruse b a b
Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashiosaka 577-8502, Japan Laboratory of Bioresources, National Institute for Basic Biology, Nishigonaka 38, Myodaiji, Okazaki, Aichi 444-8585, Japan
h i g h l i g h t s • • • • •
We established the transgenic medaka that enable us to observe AVT neurons by EGFP. Onset of AVT neurons occurred in two regions of embryonic brain at different stages. AVT somata were shown in preoptic area and the ventral hypothalamus in adult brain. AVT fibers projected into pituitary in main, but some into other brain regions. This fish is an intriguing model to explore AVT neuronal development and function.
a r t i c l e
i n f o
Article history: Received 9 October 2015 Received in revised form 18 December 2015 Accepted 22 December 2015 Available online 29 December 2015 Keywords: Arginine vasotocin Medaka Neuronal development Projection
a b s t r a c t The neurohypophysial peptide arginine vasotocin (AVT) and its mammalian ortholog arginine vasopressin function in a wide range of physiological and behavioral events. Here, we generated a new line of transgenic medaka (Oryzias latipes), which allowed us to monitor AVT neurons by enhanced green fluorescent protein (EGFP) and demonstrate AVT neuronal development in the embryo and the projection of AVT neurons in the adult brain of avt-egfp transgenic medaka. The onset of AVT expression manifested at 2 days postfertilization (dpf) as a pair of signals in the telencephalon of the brain. The telencephalic AVT neurons migrated and converged on the preoptic area (POA) by 4 dpf. At the same stage, another onset of AVT expression manifested in the central optic tectum (OT), and they migrated to the ventral part of the hypothalamus (VH) by 6 dpf. In the adult brain, the AVT somata with EGFP signals existed in the gigantocellular POA (gPOA), magnocellular POA (mPOA), and parvocellular POA (pPOA) and in the VH. Whereas the major projection of AVT fibers was found from the pPOA and VH to the posterior pituitary, it was also found that AVT neurons in the three POAs send their fibers into wide regions of the brain such as the telencephalon, mesencephalon and diencephalon. This study suggests that the avt-egfp transgenic medaka is a useful model to explore AVT neuronal development and function. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Arginine vasopressin (AVP) and its teleost ortholog, arginine vasotocin (AVT), are neuropeptides that have roles in regulating various physiological and behavioral events such as osmoregulation, stress response, metabolism, blood pressure, and aggressive
∗ Corresponding author. Fax: +81 6 6723 2721. E-mail addresses: [email protected] (N. Kagawa), [email protected] (A. Honda), [email protected] (A. Zenno), [email protected] (R. Omoto), [email protected] (S. Imanaka), [email protected] (Y. Takehana), [email protected] (K. Naruse). http://dx.doi.org/10.1016/j.neulet.2015.12.049 0304-3940/© 2015 Elsevier Ireland Ltd. All rights reserved.
and reproductive behaviors in vertebrates [1–3]. In mammals, AVP is primarily synthesized in the magnocellular and parvocellular neurons localized in three regions of the hypothalamus: paraventricular nuclei (PVN), supraoptic nuclei (SON), and suprachiasmatic nuclei (SCN) [4–6]. Arginine vasopressin produced by magnocellular neurons in the SON and PVN is transported through their axons, which project to the posterior pituitary, and is subsequently released into the systemic circulation and exerts its effect in the peripheral tissues [5–7]. Arginine vasopressin synthesized by parvocellular neurons in the SCN is not released into circulation via pituitary, and is thought to have a role in modulating circadian rhythms [9,10]. In the parvocellular neurons in the PVN, AVP is coexpressed with corticotropin-releasing factor (CRF) and
48
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
synergistically works with CRF to stimulate stress response via hypothalamus–pituitary–adrenal gland axis of hormones [10,11]. In many teleost, AVT neurons have been identified by soma size in three populations in the POA: gigantocellular nuclei (gPOA), magnocellular nuclei (mPOA), and parvocellular nuclei (pPOA), and they have different physiological and behavioral functions [12–14]. For example, the AVT level in the pPOA is involved in the hormonal stress response via the hypothalamus–pituitary–interrenal axis in the European eel (Anguilla anguilla) and the rainbow trout (Oncorhynchus mykiss) [12,15]. Furthermore, previous reports show that AVT expression in the mPOA and gPOA somata have a role in osmoregulation and in the mediation of aggressive behavior, respectively [1,13]. On the other hand, AVT fibers are present in wide regions of the brain (in addition to the pituitary) such as the telencephalon, hypothalamus, mesencephalon, and spinal cord [14,16,17]. The AVT neurons in the mPOA project their fibers into the pituitary in rainbow trout [18]; however it is less known which regions of the brain or pituitary that AVT neurons in the other POAs project into. The knowledge of AVT neuron projections will provide valuable information concerning the multiple functions of AVT localized in several regions of the brain. To clarify the projection of the AVT neurons from the three POAs in this study, we first established a transgenic medaka that expressed enhanced green fluorescent protein (EGFP) under the control of avt gene transcription. Using the transgenic medaka, we investigated AVT neuronal development in the embryonic brain and AVT neuron localization and projection in the adult brain.
2. Materials and methods 2.1. Animals Medaka fish of the T5 strain (strain ID, MT827) were used to establish the transgenic line. These strain were supplied by the National BioResource Project (NBRP) Medaka (Okazaki, Japan). The T5 strain lacks pigments in the melanophores, leucophores and ridocytes, which results in less auto-fluorescence, especially from the leucophores. Thus EGFP signals can be observed more clearly in this strain than in other strains. All fish and embryos were maintained at 27 ◦ C in a light:dark cycle of 14 h:10 h (light phase from 7 am to 9 pm). Fish were fed Artemia spp. (Miyako Kagaku Corporation, Tokyo, Japan) twice a day (at 10 am and 5 pm). Embryo and juvenile ages are expressed as days post fertilization (dpf) and days post hatching (dph), respectively.
EGFP 0.75kb㻌
㻌
BGHpA 0.25kb㻌
2.2. Construction of the avt-egfp vector A fosmid clone (GOLWFno393 p20) containing the medaka avt locus was obtained from NBRP Medaka (Okazaki, Japan). The targeting DNA fragment was prepared by polymerase chain reaction (PCR) amplification using the EGFP-poly(A)-Km vector [19], which was kindly gifted to us by Shin-ichi Higashijima of the National Institute for Physiological Sciences (NIPS, Okazaki, Japan) and by Minoru Tanaka of the National Institute for Basic Biology (NIBB, Okazaki, Japan). The primers used were 5 ATGAGCGGGCTGTCCGTCAGACGTCCACACCGACAGCCTGCAGCG ATGCATCCACCGGTCGCCACCATGG-3 and 5 GCAGTTCTGGATGTAACAGGCGGAGGACAGAGCGAGGAATCCCAGG GCGCGTCGACCAGTTGGTGATTTTG-3 . The target fragment was inserted at the translation initiation site of the avt gene in the fosmid clone (Fig. 1) by using a method of homologous recombination in Escherichia coli (DY380) [20]. The modified fosmid clone was purified by using the Qiagen Large-Construct Kit (Qiagen, Venlo, Netherlands), and used for microinjection. 2.3. Generation of transgenic lines The construct was microinjected into the cytoplasm of one-cell stage embryos, which were collected within 30 min after spawning. The microinjection was performed in accordance with the method described by Kinoshita et al. [21]. The fluorescence of EGFP was monitored under a fluorescent microscope (BX-51; Olympus Corporation, Tokyo, Japan) equipped with a GFP filter. Only embryos showing EGFP fluorescence in the brain were allowed to grow into adulthood as the founder candidates. Adults of the founder candidates were pair-mated with wild-type adults of the T5 strain to obtain the F1 embryos. The F1 embryos were screened to identify the germ line-transmitting founders (F0) by the acquisition of EGFP fluorescence in the brain. To obtain homozygous transgenic offspring, heterozygous transgene carriers in F1 were intercrossed. The F5 and F6 heterozygous progeny were mainly used in the present study. 2.4. Observation of the embryos, juveniles, and adult brains Live embryos (1, 2, 4 and 6 dpf) and juvenile (1 dph) were observed under a fluorescent microscope (BX-51; Olympus). For observation, juveniles were embedded in 2% methylcellulose with Yamamoto’s Ringer solution (i.e., 128.3 mM sodium chloride [NaCl], 2.7 mM potassium chloride [KCl], 1.8 mM calcium chloride [CaCl2 ],
Km 1.1kb
Medaka arginine vasotocin gene +5bp +25bp
CmR Fig. 1. The construct used to generate transgenic medaka expressing EGFP under the control of the avt promoter. Exon 1 of the avt gene in the fosmid clone (GOLWFno393 p20; NBRP Medaka, Okazaki, Japan) was modified with an EGFP fragment.
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
49
Fig. 2. The EGFP signals in the avt-egfp transgenic medaka at different developmental stages. (A–H) All images are the dorsal view, and the anterior is up. (B, D, F and H) Each image is merged composites of the bright field and fluorescence images at 2 dpf, 4 dpf, 6 dpf, and 1 dph, respectively. (A and B) The onset of EGFP expression (arrows) at 2 dpf. A pair of signals exists beside the eyes in the telencephalon. (C and D) At 4 dpf, a pair of intensified EGFP signals exists. An additional signal is slightly shown in the central OT. (E and F) At 6 dpf, a pair of telencephalon-derived signals intensifies and migrates to the junction between the telencephalon and OT. Another pair of signals converges on the central part of OT. (G and H) These pair of EGFP signals has been shown at 1 dph. (I–K) The ventral part of hypothalamus in the transverse sections of 4 dpf. (L–N) The POA in the transverse sections of 1 dph. EGFP signals (I and L) and Neurotrace signals (J and M) present in green and magenta, respectively. (K and N) Merged composites of the Neurotrace image and the EGFP image. The somata and the fibers are indicated by the arrow and arrowhead, respectively. e, eye. Scale bar = 50 m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
0.2 mM sodium bicarbonate [NaHCO3 ]; pH 7.3). Embryos and juveniles observed in this study were male and female. 4-dpf embryos, 1-dph juveniles and 5-months old males were anaesthetized with 0.1% 2-phenoxyethanol, and embryos, juveniles, and adult brains were fixed with 4% phosphatebuffered paraformaldehyde (pH7.3) for 24–48 h. After washing in phosphate-buffered saline (PBS), the fixed samples were immerged in 30% sucrose solutions, and then embedded in OCT compound
(Sakura Finetek, Tokyo, Japan). 10-m thick sections were prepared using a cryostat (CM-1850; Leica, Frankfurt, Germany). The transverse sections of embryos and juveniles were studied by red fluorescent Nissl staining (NeuroTrace 500/525, Molecular Probes, Eugene, OR, USA). After staining for 45 min with NeuroTrace (1:100 in PBS), the sections were washed in PBS, coverslipped with CC Mount (Diagnostic BioSystems, Pleasanton, CA, USA), and observed by a confocal laser scanning microscope (TCS SP8, Leica).
50
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
The sagittal sections of adult male brains were observed under a fluorescent microscope. For observation of the pituitary of adult brains, the sections were stained with 4’,6-diamidino-2phenylindole (DAPI) using VECTASHIELD Mounting Medium with DAPI (Vector Laboratories, Burlingame, CA, USA). To validate of the specificity of avt-egfp transgene expression, the adult brain sections were examined by double-color immunofluoscence. Some adult brains without fixation were sliced into 250-m transverse, oblique and horizontal sections using a vibrating blade microtome (VT1000S; Leica), and were observed under a fluorescent microscope. Animal experiments were approved by the Animal Care and Use Committee of the Faculty of Science and Technology at Kinki University (Approval no., KASE-23-002). 2.5. Double-color immunofluorescence Double-immunofluorescence staining of AVT and GFP was performed as follows. After incubation in a blocking solution with 1% normal goat serum in PBS containing 0.3% Triton X-100, the sections were treated with primary antibodies produced in rabbit against AVT (generated by Seiichiro Kawashima of the University of Tokyo (Tokyo, Japan) and in rat against GFP (Nakarai, Kyoto, Japan)) at dilutions of 1:10,000 and 1:1,000 in blocking solution, respectively, for 24 h at 4 ◦ C. After rinsing with PBS, the sections were incubated in biotinylated anti-rabbit IgG antibody (Vector Laboratories) and AlexaFluor 488 conjugated anti-rat IgG antibody (Abcam, Cambridge, UK) for 2 h. After washing, the sections were incubated in avidin and biotin solution (Vector Laboratories) for 1 h, and then the sections were treated with streptavidin-conjugated AlexaFluor 555 (Thermo Scientific, Waltham, MA, USA) for 30 min. After washing, the sections were coverslipped with CC Mount and observed by a confocal laser scanning microscope. 3. Results 3.1. Generation of the avt-egfp transgenic medaka line To observe AVT neurons in the medaka brain, we generated transgenic medaka lines that expressed EGFP under the control of the translation of the avt gene. Among approximately 100 injected embryos that grew into adulthood for the transgenic line, approximately 10 F0 founders were identified through screening of their F1 progeny by monitoring EGFP fluorescence. All founders, which were pair-mated with wild-type adults of the T5 strain, produced F1 embryos that displayed the same temporal and spatial patterns of EGFP expression in the brain. In addition, the homozygous transgenic offspring obtained from the intercross within F1 fish showed a similar level of EGFP fluorescence in comparison with the heterozygous transgene carriers in this study. We deposited the avt-egfp line used in this study at NBRP Medaka. This strain will be available with the strain name of T5-Tg(avt-egfp) (strain ID, TG976). 3.2. The neural development of AVT in avt-egfp transgenic medaka Fig. 3. The EGFP signals in the sagittal sections from the adult brains of the avtegfp transgenic medaka. (A) The schema of the brain indicates the locations of AVT populations in pPOA (open circles), mPOA (solid circles), and gPOA (solid squares). (B–D) The gPOA after the double-immunofluorescence staining of GFP (green, B) and AVT (magenta, C). These images are merged in the panel D. (E–I) The fluorescence image in the respective area, indicated by the squares with E–I in the panel A. (E and F) The EGFP-positive somata in the mPOA (m) and pPOA (p) (E) and in the gPOA (g) (F). (G) Numerous fibers with EGFP signals are present in and around the POAs (indicated by the open circle) and in the diencephalon. A few somata with EGFP expression are present in the ventral part of hypothalamus (VH). (H and I) The EGFP signals (H) and the DAPI signals (I) in the pituitary and VH. In all images, the somata and the fibers are indicated by an arrow and arrowhead, respectively. Di, Diencephalon; OT, optic tectum; PIT, pituitary; T, telencephalon. Scale bar = 50 m.
In the avt-egfp transgenic medaka, EGFP expression was first identified as a pair of signals beside the eyes in the telencephalon of the 2-dpf embryos (Fig. 2A and B), whereas it was not present at 1 dpf (data not shown). At 4 dpf, the telencephalic EGFP expression showed intensified signals (Fig. 2C and D). In addition, another slightly signal of EGFP was present in the central OT of the embryos by the same stage. The cluster of the telencephalon-derived EGFP signals intensified and migrated to the junction between the telencephalon and OT at 6 dpf (Fig. 2E and F). At the same stage, another pair of EGFP signals, which are derived from the central OT, converged on the central part the anterior OT. Similar as 6 dpf, the
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
EGFP signals were detected at 1 dph (Fig. 2G and H). In the transverse sections of the 4-dpf embryos and the 1-dph juveniles, the signals of EGFP, which were detected in the central OT at 4 dpf and in the junction between the telencephalon and OT at 1 dph, were identified to be localized in the ventral part of hypothalamus (VH) and POA, respectively (Fig. 2I and L). Additionally, the somata with EGFP signals in these sections were stained with NeuroTrace (Fig. 2I–N). Furthermore, the fibers with EGFP signals were detected at the dorsal and ventral side of the POA at 1 dph (Fig. 2L).
3.3. The projection of the AVT neurons in the adult brain Numerous somata and fibers with intense expression of EGFP were present in the POA and VH, when we observed the sagittal 10m sections (Fig. 3). We performed double-immunofluorescence staining using anti-AVT and anti-GFP antibodies, and found that all the GFP-positive somata in were AVT immunoreative as a typical result of gPOA shown in Fig. 3B–D. Although not all AVTimmunoreactive somata were GFP-positve (approximately 85%, from three individuals), it was revealed that all the GFP-positive somata in the brain of the avt-egfp transgenic medaka actually reflect the somata of AVT neurons. As shown in Fig. 3E and F, the somata with EGFP expression in the pPOA, mPOA, and gPOA were identified by their size and localization, which has been discussed in a previous report (i.e., AVT population in pPOA had small [parvocellular] somata localized in the ventral side of POA; the AVT population in the mPOA had relatively large [magnocellular] somata localized in the dorsal side of the pPOA; and the AVT population in the gPOA had extralarge [gigantocellular] somata localized in posterior mPOA) [13]. The fibers with EGFP expression were present between the somata in the pPOA or in the mPOA (Fig. 3E). In addition, the fibers with EGFP signals were detected in the posterior side of mPOA and gPOA somata (Fig. 3E and F). These presented as relatively short fibers in the sections in which the somata of mPOA and gPOA were clearly visible, however, in the section adjacent to these, the numerous long fibers were present from the mPOA and gPOA to the diencephalon (Fig. 3G). In Fig. 3G, the EGFP fibers were also detected in the ventral edge of both the anterior part of pPOA and hypothalamus. The EGFP expression was present in the posterior pituitary and VH (Fig. 3H). A few somata with both EGFP and DAPI signals were in the VH (Fig. 3H and I). The oblique sections obtained from the adult brain of avt-egfp transgenic medaka revealed that the fibers of pPOA somata projected to pituitary via the ventral part of diencephalon (Fig. 4B and C). The fibers with EGFP signals form a curved line bilaterally that connects the pPOA and pituitary. Inside these lines, another line of EGFP signals was detected between the VH and pituitary (Fig. 4C). The sections containing the mPOA and gPOA reveal that the fibers from these POAs bilaterally project to the diencephalon (Fig. 4D and E). Other sections at different angles revealed that the fibers with EGFP signals were projected bilaterally from the somata in gPOA (Fig. 4F and G) and pPOA (Fig. 4H and I) to the mesencephalon and telencephalon, respectively. In all sections, no apparent sex differences existed in the localization or distribution of the AVT neurons with EGFP signals.
4. Discussion In the present study, we have successfully established a transgenic medaka line in which AVT-expressing neurons were tagged with EGFP. This transgenic fish allowed us to monitor AVT neuronal development and the projection of multiple populations of AVT neurons in the adult brain.
51
The observation of the avt-egfp transgenic embryo led us to identify the AVT neuronal populations with two different origins: the telencephalon-derived and the OT-derived populations. The onset of these two populations occurred at different stages from 2 dpf to 4 dpf, and they subsequently migrated and converged on a distinct region of the forebrain. The results from assessing the sections of embryos and juveniles confirmed that the telencephalon-derived and the OT-derived populations develop to the POA and VH populations of AVT neurons, respectively. Little information about the development of AVT neurons is known in vertebrates, excepting zebrafish. Eaton et al. used in situ hybridization and demonstrated that AVT-expressing neurons are detected in the VH and POA at 24 h and 48 h postfertilization of zebrafish embryo, respectively, and the avt gene transcription in these two regions are separately regulated by different genes [22]. The period from fertilization to hatching differs between the medaka and zebrafish [23], however, our results are consistent with zebrafish in that the AVT expression in this distinct brain region occurs in the embryo during early developmental stages. We have been highly interested in the localization and projection of AVT neuron in the adult brain of male medaka because our previous study demonstrated that AVT expression in the distinct POAs is associated with dominant and subordinate behaviors in the male–male competition of medaka [13]. Therefore, when assessing AVT neurons in the adult brain in this study, we focused on the male brain. In this study, AVT somata were found in distinct POAs (i.e., gPOA, mPOA, and pPOA) in the adult brain of the avt-egfp transgenic medaka. We demonstrated by the double-immunofluorescence staining that all GFP-positive somata were AVT immunoreactive, although not all AVT-immunoreactive somata were GFP positive (approximately 85%). The similar facts have been also reported in the gnrh1-gfp transgenic mice and in the gnrh2-gfp transgenic medaka [24,25]. Hence the antibody for AVT used in this study has been shown to be specific for AVT in fish [1], we could not clarify the reason why AVT-immunoreactive somata without GFP exist in the transgenic line, however, the GFP transduction efficiency of the avt-egfp transgenic medaka could be sufficient to visualize the AVT neurons. AVT neurons with EGFP signals in the POA were also clearly detected in the live brain slices, therefore, the avt-egfp transgenic medaka generated in this study may be a useful model to examine the activity of AVT neurons using the live brain by a neurophysiological technique such as electrophysiology and calcium imaging. The distribution of AVT somata in the adult brain of the avtegfp transgenic medaka is consistent with the distribution noted in a previous study [17] in which the brain slices of adult male medaka were performed by in situ hybridization using AVT RNA probe. It has also been reported that a remarkable sex difference exists in the ventral hypothalamic AVT expression (i.e., which was prominent in male fish but completely absent in female fish) [17]. The present study did not determine the sex difference in the AVT expression of adult brain, whereas the embryonic expression of AVT was detected in both sexes. Future study is needed to determine whether AVT expression is absent in the VH of adult female fish in the avt-egfp transgenic line. If so, it will also be necessary to verify the possibility that embryonic AVT in that region may disappear during the development of the female brain. The avt-egfp transgenic medaka also contributed to the detection of the projection of several populations of AVT neurons in the adult brain. The present study revealed that AVT fibers are located in wide regions of the brain such as the telencephalon, mesencephalon, diencephalon, and pituitary. This fact has been well known in other fish species [15,19,26], whereas there was little information about which population of AVT neurons projects their fibers into the regions of brain or pituitary in teleosts. By using sections obtained by slicing the transgenic brain in multiple angles,
52
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
Fig. 4. The EGFP signals in the 250 m-thick sections obtained from the brains of avt-egfp adult transgenic medaka. (A) The schema of the sections obtained by slicing in the direction of lines i–iv. The open circle, solid circle, and solid square indicate the locations of the pPOA, mPOA and gPOA, respectively. The images under the bright field (B, D, F, H) and under the dark field (C, E, G, I). (B and C) In the section indicated by the square in A-i, the bilateral curved lines of the fibers with EGFP signals between the pPOA (p) and pituitary. Another line of the fibers exists between the VH and pituitary. (D and E) In the section indicated by the square in A-ii, the fibers are present from the somata in the mPOA (m) and gPOA (g) to the diencephalon. (F and G) In the section indicated by the square in A-iii, the fibers are present from the somata in the gPOA to the mesencephalon, in addition to fibers in the diencephalon. (H and I) In the section indicated by the square in A-iv, the fibers are present from the pPOA to the telencephalon, in addition to those projecting to the hypothalamus. The somata and the fibers are indicated by the arrow and arrowhead, respectively. Di, Diencephalon; OT, optic tectum; PIT, pituitary; T, telencephalon. Scale bar = 100 m.
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
this study assessed the localization and the major projection of AVT neurons. The populations of AVT somata are localized in the pPOA, mPOA, gPOA and VH, and the fibers from the pPOA and VH project into the posterior pituitary primarily. These findings suggest that AVT neurons in the pPOA and VH have a hypophysiotropic role. We also found that the fibers between the pPOA-AVT somata and the pituitary form a curved line bilaterally. In addition, this study found that the fibers of the gPOA- and mPOA-AVT neurons project into the diencephalon, those of the gPOA project into the mesencephalon, and those of the pPOA project into the telencephalon, too. In mammals, the magnocellular AVP neurons in the SON and PVN project their axons into the posterior pituitary, however, the parvocellular AVP neurons in the SCN and PVN do not project into the posterior pituitary [5–11]. Taken together, these findings suggest that the gigantocellular, magnocellular and parvocellular AVT neurons in medaka may have different functions, compared to AVP neurons in mammals. Our previous study had demonstrated that AVT expression in the gPOA and mPOA increased in dominant male medaka, whereas the pPOA increased in subordinate male after the male–male competition [13]. Further study is needed to investigate what roles AVT neurons projecting to the mesencephalon, diencephalon and telencephalon have in regulating social behaviors. In conclusion, we established a transgenic medaka line that enabled us to observe AVT neurons by using EGFP fluorescence in the embryonic and adult brain. Because disturbances in AVP influence physiological, behavioral, and psychiatric disorders [27–29], the avt-egfp transgenic medaka may be a useful model to study the mechanisms of these pathologies at the developmental and morphological levels. Conflict of interest There are no conflicts of interest to report. Acknowledgments We thank Ikuyo Hara (NIBB, Okazaki, Japan) and Mai Komori of the Kinki University (Higashiosaka, Japan) for their technical assistance in the generation of transgenic lines. We are grateful to Dr. Shinji Kanda (the University of Tokyo, Tokyo, Japan) for the helpful technical advice, Dr. Yasuhiro Kamei and Misako Taniguchi-Saida (NIBB) for their technical assistance in the confocal imaging. We also thank reviewers for their helpful comments on the manuscript. The present study is partly supported by the Grant-in-Aid for Scientific Research (No.15K07590) of the Japan Society for the Promotion of Science (Tokyo, Japan). References [1] S. Hyodo, A. Urano, Changes in expression of provasotocin and proisotocin genes during adaptation to hyper- and hypo-osmotic environments in rainbow trout, J. Comp. Physiol. B 161 (1991) 549–556. [2] J.L. Goodson, A.H. Bass, Forebrain peptides modulate sexually polymorphic vocal circuitry, Nature 403 (2000) 769–772. [3] K. Semsar, F.L.M. Kandel, J. Godwin, Manipulations of the AVT system shift social status and related courtship and aggressive behavior in the bluehead wrasse, Horm. Behav. 40 (2001) 21–31. [4] M.J. Brownstein, J.T. Russell, H. Gainer, Synthesis, transport, and release of posterior pituitary hormones, Science 207 (1980) 373–378. [5] H.H. Zingg, D. Lefebvre, G. Almazan, Regulation of vasopressin gene expression in rat hypothalamic neurons, J. Biol. Chem. 261 (1986) 12956–12959. [6] T.G. Sherman, J.F. McKelvy, S.J. Watson, Vasopressin mRNA regulation in individual hypothalamic nuclei: a northern and in situ hybridization analysis, J. Neurosci. 6 (1986) 1682–1694.
53
[7] J.P.H. Burbach, S.M. Luckman, D. Murphy, H. Gainer, Gene regulation in the magnocellular hypothalamo-neurohypophysial system, Physiol. Rev. 81 (2001) 1197–1267. [8] W.J. Schwartz, S.M. Reppert, Neural regulation of the circadian vasopressin rhythm in cerebrospinal fluid: a pre-eminent role for the suprachiasmatic nuclei, J.Neurosci. 5 (1985) 2771–2778. [9] T. Maruyama, T. Ohbuchi, H. Fujihara, M. Shibata, K. Mori, D. Murphy, G. Dayanithi, Y. Ueta, Diurnal changes of arginine vasopressin-enhanced green fluorescent protein fusion transgene expression in the rat suprachiasmatic nucleus, Peptides 31 (2010) 2089–2093. [10] T. Watabe, K. Tanaka, M. Kumagae, S. Itoh, M. Kogure, M. Hasegawa, T. Horiuchi, K. Morio, F. Takeda, E. Ubukata, S. Miyabe, N. Shimizu, Role of endogenous arginine vasopressin in potentiating corticotropin-releasing hormone-stimulated corticotropin secretion in man, J. Clin. Endocrinol. Metab. 66 (1988) 1132–1137. [11] C.A. Bondy, M.H. Whitnall, L.S. Brady, H. Gainer, Coexisting peptides in hypothalamic neuroendocrine systems: some functional implications, Cell. Mol. Neurobiol. 9 (1989) 427–446. [12] B.J. Gilchriest, D.R. Tipping, L. Hake, A. Levy, B.I. Baker, The effects of acute and chronic stresses on vasotocin gene transcripts in the brain of the rainbow trout (Oncorhynchus mykiss), J. Neuroendocrinol. 12 (2000) 795–801. [13] N. Kagawa, Social rank-dependent expression of arginine vasotocin in distinct preoptic regions in male Oryzias latipes, J. Fish Biol. 82 (2013) 354–363. [14] T. Sakamoto, Y. Nishiyama, A. Ikeda, H. Takahashi, S. Hyodo, N. Kagawa, H. Sakamoto, Neurohypophysial hormones regulate amphibious behaviour in the mudskipper goby, PLoS One (2015), http://dx.doi.org/10.1371/journal. pone.0134605. [15] M. Olivereau, J. Olivereau, Effect of pharmacological adrenalectomy on corticotropin-releasing factor-like and arginine vasotocin immunoreactivities in the brain and pituitary of the eel: immunocytochemical study, Gen. Comp. Endocrinol. 80 (1990) 199–215. [16] C.M. Foran, A.H. Bass, Preoptic AVT immunoreactive neurons of a teleost fish with alternative reproductive tactics, Gen. Comp. Endocrinol. 111 (1998) 271–282. [17] Y. Kawabata, T. Hiraki, A. Takeuchi, K. Okubo, Sex differences in the expression of vasotocin/isotocin, gonadotropin-releasing hormone, and tyrosine and tryptophan hydroxylase family genes in the medaka brain, Neuroscience 218 (2012) 65–77. [18] D. Saito, M. Komatsuda, A. Urano, Functional organization of preoptic vasotocin and isotocin neurons in the brain of rainbow trout: central and neurohypophysial projections of single neurons, Neuroscience 124 (2004) 973–984. [19] Y. Kimura, Y. Okamura, S. Higashijima, alx, a zebrafish homolog of chx10, marks ipsilateral descending excitatory interneurons that participate in the regulation of spinal locomotor circuits, J. Neurosci. 26 (2006) 5684–5697. [20] S. Nakamura, D. Saito, M. Tanaka, Generation of transgenic medaka using modified bacterial artificial chromosome, Dev. Growth Differ. 50 (2008) 415–419. [21] M. Kinoshita, Y. Kamei, Transgenesis: microinjection technique for medaka eggs, in: M. Kinoshita, K. Murata, K. Naruse, M. Tanaka (Eds.), Medaka: Biology, Management and Experimental Protocols, Wiley-Blackwell, USA, 2009, pp. 277–291. [22] J.L. Eaton, B. Holmqvist, E. Glasgow, Ontogeny of vasotocin-expressing cells in zebrafish: Selective requirement for the transcriptional regulators orthopedia and single-minded 1 in the preoptic area, Dev. Dyn. 237 (2008) 995–1005. [23] T. Deguchi, K. Naruse, History and features of medaka: advantage of medaka as a model fish. Differences from zebrafish, in: M. Kinoshita, K. Murata, K. Naruse, M. Tanaka (Eds.), Medaka: Biology, Management, and Experimental Protocols, Wiley-Blackwell, USA, 2009, pp. 9–29. [24] K.J. Suter, W.J. Song, T.L. Sampson, J.P. Wuarin, J.T. Saunders, F.E. Dudek, S.M. Moenter, Genetic targeting of green fluorescent protein to gonadotropin-releasing hormone neurons: characterization of whole-cell electrophysiological properties and morphology, Endocrinology 141 (2000) 412–419. [25] S. Kanda, K. Nishikawa, T. Karigo, K. Okubo, S. Isomae, H. Abe, D. Kobayashi, Y. Oka, Regular pacemaker activity characterizes gonadotropin-releasing hormone 2 neurons recorded from green fluorescent protein-transgenic medaka, Endocrinology 151 (2010) 695–701. [26] I.S. Parhar, H. Tosaki, Y. Sakuma, M. Kobayashi, Sex differences in the brain of goldfish: gonadotropin-releasing hormone and vasotocinergic neurons, Neuroscience 104 (2001) 1099–1110. [27] J.S. Purba, W.J. Hoogendijk, M.A. Hofman, D.F. Swaab, Increased number of vasopressin- and oxytocin-expressing neurons in the paraventricular nucleus of the hypothalamus in depression, Arch. Gen. Psychiatry 53 (1996) 137–143. [28] T.R. Insel, D.J. O’Brien, J.F. Leckman, Oxytocin, vasopressin, and autism: is there a connection? Biol. Psychiatry 45 (1999) 145–157. [29] C.S. Carter, Sex differences in oxytocin and vasopressin: implications for autism spectrum disorders? Behav. Brain Res. 176 (2007) 170–186.
Contents lists available at ScienceDirect
Neuroscience Letters journal homepage: www.elsevier.com/locate/neulet
Research paper
Arginine vasotocin neuronal development and its projection in the adult brain of the medaka Nao Kagawa a,∗ , Akira Honda a , Akiko Zenno a , Ryosuke Omoto a , Saya Imanaka a , Yusuke Takehana b , Kiyoshi Naruse b a b
Department of Life Science, Faculty of Science and Engineering, Kinki University, 3-4-1 Kowakae, Higashiosaka 577-8502, Japan Laboratory of Bioresources, National Institute for Basic Biology, Nishigonaka 38, Myodaiji, Okazaki, Aichi 444-8585, Japan
h i g h l i g h t s • • • • •
We established the transgenic medaka that enable us to observe AVT neurons by EGFP. Onset of AVT neurons occurred in two regions of embryonic brain at different stages. AVT somata were shown in preoptic area and the ventral hypothalamus in adult brain. AVT fibers projected into pituitary in main, but some into other brain regions. This fish is an intriguing model to explore AVT neuronal development and function.
a r t i c l e
i n f o
Article history: Received 9 October 2015 Received in revised form 18 December 2015 Accepted 22 December 2015 Available online 29 December 2015 Keywords: Arginine vasotocin Medaka Neuronal development Projection
a b s t r a c t The neurohypophysial peptide arginine vasotocin (AVT) and its mammalian ortholog arginine vasopressin function in a wide range of physiological and behavioral events. Here, we generated a new line of transgenic medaka (Oryzias latipes), which allowed us to monitor AVT neurons by enhanced green fluorescent protein (EGFP) and demonstrate AVT neuronal development in the embryo and the projection of AVT neurons in the adult brain of avt-egfp transgenic medaka. The onset of AVT expression manifested at 2 days postfertilization (dpf) as a pair of signals in the telencephalon of the brain. The telencephalic AVT neurons migrated and converged on the preoptic area (POA) by 4 dpf. At the same stage, another onset of AVT expression manifested in the central optic tectum (OT), and they migrated to the ventral part of the hypothalamus (VH) by 6 dpf. In the adult brain, the AVT somata with EGFP signals existed in the gigantocellular POA (gPOA), magnocellular POA (mPOA), and parvocellular POA (pPOA) and in the VH. Whereas the major projection of AVT fibers was found from the pPOA and VH to the posterior pituitary, it was also found that AVT neurons in the three POAs send their fibers into wide regions of the brain such as the telencephalon, mesencephalon and diencephalon. This study suggests that the avt-egfp transgenic medaka is a useful model to explore AVT neuronal development and function. © 2015 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Arginine vasopressin (AVP) and its teleost ortholog, arginine vasotocin (AVT), are neuropeptides that have roles in regulating various physiological and behavioral events such as osmoregulation, stress response, metabolism, blood pressure, and aggressive
∗ Corresponding author. Fax: +81 6 6723 2721. E-mail addresses: [email protected] (N. Kagawa), [email protected] (A. Honda), [email protected] (A. Zenno), [email protected] (R. Omoto), [email protected] (S. Imanaka), [email protected] (Y. Takehana), [email protected] (K. Naruse). http://dx.doi.org/10.1016/j.neulet.2015.12.049 0304-3940/© 2015 Elsevier Ireland Ltd. All rights reserved.
and reproductive behaviors in vertebrates [1–3]. In mammals, AVP is primarily synthesized in the magnocellular and parvocellular neurons localized in three regions of the hypothalamus: paraventricular nuclei (PVN), supraoptic nuclei (SON), and suprachiasmatic nuclei (SCN) [4–6]. Arginine vasopressin produced by magnocellular neurons in the SON and PVN is transported through their axons, which project to the posterior pituitary, and is subsequently released into the systemic circulation and exerts its effect in the peripheral tissues [5–7]. Arginine vasopressin synthesized by parvocellular neurons in the SCN is not released into circulation via pituitary, and is thought to have a role in modulating circadian rhythms [9,10]. In the parvocellular neurons in the PVN, AVP is coexpressed with corticotropin-releasing factor (CRF) and
48
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
synergistically works with CRF to stimulate stress response via hypothalamus–pituitary–adrenal gland axis of hormones [10,11]. In many teleost, AVT neurons have been identified by soma size in three populations in the POA: gigantocellular nuclei (gPOA), magnocellular nuclei (mPOA), and parvocellular nuclei (pPOA), and they have different physiological and behavioral functions [12–14]. For example, the AVT level in the pPOA is involved in the hormonal stress response via the hypothalamus–pituitary–interrenal axis in the European eel (Anguilla anguilla) and the rainbow trout (Oncorhynchus mykiss) [12,15]. Furthermore, previous reports show that AVT expression in the mPOA and gPOA somata have a role in osmoregulation and in the mediation of aggressive behavior, respectively [1,13]. On the other hand, AVT fibers are present in wide regions of the brain (in addition to the pituitary) such as the telencephalon, hypothalamus, mesencephalon, and spinal cord [14,16,17]. The AVT neurons in the mPOA project their fibers into the pituitary in rainbow trout [18]; however it is less known which regions of the brain or pituitary that AVT neurons in the other POAs project into. The knowledge of AVT neuron projections will provide valuable information concerning the multiple functions of AVT localized in several regions of the brain. To clarify the projection of the AVT neurons from the three POAs in this study, we first established a transgenic medaka that expressed enhanced green fluorescent protein (EGFP) under the control of avt gene transcription. Using the transgenic medaka, we investigated AVT neuronal development in the embryonic brain and AVT neuron localization and projection in the adult brain.
2. Materials and methods 2.1. Animals Medaka fish of the T5 strain (strain ID, MT827) were used to establish the transgenic line. These strain were supplied by the National BioResource Project (NBRP) Medaka (Okazaki, Japan). The T5 strain lacks pigments in the melanophores, leucophores and ridocytes, which results in less auto-fluorescence, especially from the leucophores. Thus EGFP signals can be observed more clearly in this strain than in other strains. All fish and embryos were maintained at 27 ◦ C in a light:dark cycle of 14 h:10 h (light phase from 7 am to 9 pm). Fish were fed Artemia spp. (Miyako Kagaku Corporation, Tokyo, Japan) twice a day (at 10 am and 5 pm). Embryo and juvenile ages are expressed as days post fertilization (dpf) and days post hatching (dph), respectively.
EGFP 0.75kb㻌
㻌
BGHpA 0.25kb㻌
2.2. Construction of the avt-egfp vector A fosmid clone (GOLWFno393 p20) containing the medaka avt locus was obtained from NBRP Medaka (Okazaki, Japan). The targeting DNA fragment was prepared by polymerase chain reaction (PCR) amplification using the EGFP-poly(A)-Km vector [19], which was kindly gifted to us by Shin-ichi Higashijima of the National Institute for Physiological Sciences (NIPS, Okazaki, Japan) and by Minoru Tanaka of the National Institute for Basic Biology (NIBB, Okazaki, Japan). The primers used were 5 ATGAGCGGGCTGTCCGTCAGACGTCCACACCGACAGCCTGCAGCG ATGCATCCACCGGTCGCCACCATGG-3 and 5 GCAGTTCTGGATGTAACAGGCGGAGGACAGAGCGAGGAATCCCAGG GCGCGTCGACCAGTTGGTGATTTTG-3 . The target fragment was inserted at the translation initiation site of the avt gene in the fosmid clone (Fig. 1) by using a method of homologous recombination in Escherichia coli (DY380) [20]. The modified fosmid clone was purified by using the Qiagen Large-Construct Kit (Qiagen, Venlo, Netherlands), and used for microinjection. 2.3. Generation of transgenic lines The construct was microinjected into the cytoplasm of one-cell stage embryos, which were collected within 30 min after spawning. The microinjection was performed in accordance with the method described by Kinoshita et al. [21]. The fluorescence of EGFP was monitored under a fluorescent microscope (BX-51; Olympus Corporation, Tokyo, Japan) equipped with a GFP filter. Only embryos showing EGFP fluorescence in the brain were allowed to grow into adulthood as the founder candidates. Adults of the founder candidates were pair-mated with wild-type adults of the T5 strain to obtain the F1 embryos. The F1 embryos were screened to identify the germ line-transmitting founders (F0) by the acquisition of EGFP fluorescence in the brain. To obtain homozygous transgenic offspring, heterozygous transgene carriers in F1 were intercrossed. The F5 and F6 heterozygous progeny were mainly used in the present study. 2.4. Observation of the embryos, juveniles, and adult brains Live embryos (1, 2, 4 and 6 dpf) and juvenile (1 dph) were observed under a fluorescent microscope (BX-51; Olympus). For observation, juveniles were embedded in 2% methylcellulose with Yamamoto’s Ringer solution (i.e., 128.3 mM sodium chloride [NaCl], 2.7 mM potassium chloride [KCl], 1.8 mM calcium chloride [CaCl2 ],
Km 1.1kb
Medaka arginine vasotocin gene +5bp +25bp
CmR Fig. 1. The construct used to generate transgenic medaka expressing EGFP under the control of the avt promoter. Exon 1 of the avt gene in the fosmid clone (GOLWFno393 p20; NBRP Medaka, Okazaki, Japan) was modified with an EGFP fragment.
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
49
Fig. 2. The EGFP signals in the avt-egfp transgenic medaka at different developmental stages. (A–H) All images are the dorsal view, and the anterior is up. (B, D, F and H) Each image is merged composites of the bright field and fluorescence images at 2 dpf, 4 dpf, 6 dpf, and 1 dph, respectively. (A and B) The onset of EGFP expression (arrows) at 2 dpf. A pair of signals exists beside the eyes in the telencephalon. (C and D) At 4 dpf, a pair of intensified EGFP signals exists. An additional signal is slightly shown in the central OT. (E and F) At 6 dpf, a pair of telencephalon-derived signals intensifies and migrates to the junction between the telencephalon and OT. Another pair of signals converges on the central part of OT. (G and H) These pair of EGFP signals has been shown at 1 dph. (I–K) The ventral part of hypothalamus in the transverse sections of 4 dpf. (L–N) The POA in the transverse sections of 1 dph. EGFP signals (I and L) and Neurotrace signals (J and M) present in green and magenta, respectively. (K and N) Merged composites of the Neurotrace image and the EGFP image. The somata and the fibers are indicated by the arrow and arrowhead, respectively. e, eye. Scale bar = 50 m. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
0.2 mM sodium bicarbonate [NaHCO3 ]; pH 7.3). Embryos and juveniles observed in this study were male and female. 4-dpf embryos, 1-dph juveniles and 5-months old males were anaesthetized with 0.1% 2-phenoxyethanol, and embryos, juveniles, and adult brains were fixed with 4% phosphatebuffered paraformaldehyde (pH7.3) for 24–48 h. After washing in phosphate-buffered saline (PBS), the fixed samples were immerged in 30% sucrose solutions, and then embedded in OCT compound
(Sakura Finetek, Tokyo, Japan). 10-m thick sections were prepared using a cryostat (CM-1850; Leica, Frankfurt, Germany). The transverse sections of embryos and juveniles were studied by red fluorescent Nissl staining (NeuroTrace 500/525, Molecular Probes, Eugene, OR, USA). After staining for 45 min with NeuroTrace (1:100 in PBS), the sections were washed in PBS, coverslipped with CC Mount (Diagnostic BioSystems, Pleasanton, CA, USA), and observed by a confocal laser scanning microscope (TCS SP8, Leica).
50
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
The sagittal sections of adult male brains were observed under a fluorescent microscope. For observation of the pituitary of adult brains, the sections were stained with 4’,6-diamidino-2phenylindole (DAPI) using VECTASHIELD Mounting Medium with DAPI (Vector Laboratories, Burlingame, CA, USA). To validate of the specificity of avt-egfp transgene expression, the adult brain sections were examined by double-color immunofluoscence. Some adult brains without fixation were sliced into 250-m transverse, oblique and horizontal sections using a vibrating blade microtome (VT1000S; Leica), and were observed under a fluorescent microscope. Animal experiments were approved by the Animal Care and Use Committee of the Faculty of Science and Technology at Kinki University (Approval no., KASE-23-002). 2.5. Double-color immunofluorescence Double-immunofluorescence staining of AVT and GFP was performed as follows. After incubation in a blocking solution with 1% normal goat serum in PBS containing 0.3% Triton X-100, the sections were treated with primary antibodies produced in rabbit against AVT (generated by Seiichiro Kawashima of the University of Tokyo (Tokyo, Japan) and in rat against GFP (Nakarai, Kyoto, Japan)) at dilutions of 1:10,000 and 1:1,000 in blocking solution, respectively, for 24 h at 4 ◦ C. After rinsing with PBS, the sections were incubated in biotinylated anti-rabbit IgG antibody (Vector Laboratories) and AlexaFluor 488 conjugated anti-rat IgG antibody (Abcam, Cambridge, UK) for 2 h. After washing, the sections were incubated in avidin and biotin solution (Vector Laboratories) for 1 h, and then the sections were treated with streptavidin-conjugated AlexaFluor 555 (Thermo Scientific, Waltham, MA, USA) for 30 min. After washing, the sections were coverslipped with CC Mount and observed by a confocal laser scanning microscope. 3. Results 3.1. Generation of the avt-egfp transgenic medaka line To observe AVT neurons in the medaka brain, we generated transgenic medaka lines that expressed EGFP under the control of the translation of the avt gene. Among approximately 100 injected embryos that grew into adulthood for the transgenic line, approximately 10 F0 founders were identified through screening of their F1 progeny by monitoring EGFP fluorescence. All founders, which were pair-mated with wild-type adults of the T5 strain, produced F1 embryos that displayed the same temporal and spatial patterns of EGFP expression in the brain. In addition, the homozygous transgenic offspring obtained from the intercross within F1 fish showed a similar level of EGFP fluorescence in comparison with the heterozygous transgene carriers in this study. We deposited the avt-egfp line used in this study at NBRP Medaka. This strain will be available with the strain name of T5-Tg(avt-egfp) (strain ID, TG976). 3.2. The neural development of AVT in avt-egfp transgenic medaka Fig. 3. The EGFP signals in the sagittal sections from the adult brains of the avtegfp transgenic medaka. (A) The schema of the brain indicates the locations of AVT populations in pPOA (open circles), mPOA (solid circles), and gPOA (solid squares). (B–D) The gPOA after the double-immunofluorescence staining of GFP (green, B) and AVT (magenta, C). These images are merged in the panel D. (E–I) The fluorescence image in the respective area, indicated by the squares with E–I in the panel A. (E and F) The EGFP-positive somata in the mPOA (m) and pPOA (p) (E) and in the gPOA (g) (F). (G) Numerous fibers with EGFP signals are present in and around the POAs (indicated by the open circle) and in the diencephalon. A few somata with EGFP expression are present in the ventral part of hypothalamus (VH). (H and I) The EGFP signals (H) and the DAPI signals (I) in the pituitary and VH. In all images, the somata and the fibers are indicated by an arrow and arrowhead, respectively. Di, Diencephalon; OT, optic tectum; PIT, pituitary; T, telencephalon. Scale bar = 50 m.
In the avt-egfp transgenic medaka, EGFP expression was first identified as a pair of signals beside the eyes in the telencephalon of the 2-dpf embryos (Fig. 2A and B), whereas it was not present at 1 dpf (data not shown). At 4 dpf, the telencephalic EGFP expression showed intensified signals (Fig. 2C and D). In addition, another slightly signal of EGFP was present in the central OT of the embryos by the same stage. The cluster of the telencephalon-derived EGFP signals intensified and migrated to the junction between the telencephalon and OT at 6 dpf (Fig. 2E and F). At the same stage, another pair of EGFP signals, which are derived from the central OT, converged on the central part the anterior OT. Similar as 6 dpf, the
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
EGFP signals were detected at 1 dph (Fig. 2G and H). In the transverse sections of the 4-dpf embryos and the 1-dph juveniles, the signals of EGFP, which were detected in the central OT at 4 dpf and in the junction between the telencephalon and OT at 1 dph, were identified to be localized in the ventral part of hypothalamus (VH) and POA, respectively (Fig. 2I and L). Additionally, the somata with EGFP signals in these sections were stained with NeuroTrace (Fig. 2I–N). Furthermore, the fibers with EGFP signals were detected at the dorsal and ventral side of the POA at 1 dph (Fig. 2L).
3.3. The projection of the AVT neurons in the adult brain Numerous somata and fibers with intense expression of EGFP were present in the POA and VH, when we observed the sagittal 10m sections (Fig. 3). We performed double-immunofluorescence staining using anti-AVT and anti-GFP antibodies, and found that all the GFP-positive somata in were AVT immunoreative as a typical result of gPOA shown in Fig. 3B–D. Although not all AVTimmunoreactive somata were GFP-positve (approximately 85%, from three individuals), it was revealed that all the GFP-positive somata in the brain of the avt-egfp transgenic medaka actually reflect the somata of AVT neurons. As shown in Fig. 3E and F, the somata with EGFP expression in the pPOA, mPOA, and gPOA were identified by their size and localization, which has been discussed in a previous report (i.e., AVT population in pPOA had small [parvocellular] somata localized in the ventral side of POA; the AVT population in the mPOA had relatively large [magnocellular] somata localized in the dorsal side of the pPOA; and the AVT population in the gPOA had extralarge [gigantocellular] somata localized in posterior mPOA) [13]. The fibers with EGFP expression were present between the somata in the pPOA or in the mPOA (Fig. 3E). In addition, the fibers with EGFP signals were detected in the posterior side of mPOA and gPOA somata (Fig. 3E and F). These presented as relatively short fibers in the sections in which the somata of mPOA and gPOA were clearly visible, however, in the section adjacent to these, the numerous long fibers were present from the mPOA and gPOA to the diencephalon (Fig. 3G). In Fig. 3G, the EGFP fibers were also detected in the ventral edge of both the anterior part of pPOA and hypothalamus. The EGFP expression was present in the posterior pituitary and VH (Fig. 3H). A few somata with both EGFP and DAPI signals were in the VH (Fig. 3H and I). The oblique sections obtained from the adult brain of avt-egfp transgenic medaka revealed that the fibers of pPOA somata projected to pituitary via the ventral part of diencephalon (Fig. 4B and C). The fibers with EGFP signals form a curved line bilaterally that connects the pPOA and pituitary. Inside these lines, another line of EGFP signals was detected between the VH and pituitary (Fig. 4C). The sections containing the mPOA and gPOA reveal that the fibers from these POAs bilaterally project to the diencephalon (Fig. 4D and E). Other sections at different angles revealed that the fibers with EGFP signals were projected bilaterally from the somata in gPOA (Fig. 4F and G) and pPOA (Fig. 4H and I) to the mesencephalon and telencephalon, respectively. In all sections, no apparent sex differences existed in the localization or distribution of the AVT neurons with EGFP signals.
4. Discussion In the present study, we have successfully established a transgenic medaka line in which AVT-expressing neurons were tagged with EGFP. This transgenic fish allowed us to monitor AVT neuronal development and the projection of multiple populations of AVT neurons in the adult brain.
51
The observation of the avt-egfp transgenic embryo led us to identify the AVT neuronal populations with two different origins: the telencephalon-derived and the OT-derived populations. The onset of these two populations occurred at different stages from 2 dpf to 4 dpf, and they subsequently migrated and converged on a distinct region of the forebrain. The results from assessing the sections of embryos and juveniles confirmed that the telencephalon-derived and the OT-derived populations develop to the POA and VH populations of AVT neurons, respectively. Little information about the development of AVT neurons is known in vertebrates, excepting zebrafish. Eaton et al. used in situ hybridization and demonstrated that AVT-expressing neurons are detected in the VH and POA at 24 h and 48 h postfertilization of zebrafish embryo, respectively, and the avt gene transcription in these two regions are separately regulated by different genes [22]. The period from fertilization to hatching differs between the medaka and zebrafish [23], however, our results are consistent with zebrafish in that the AVT expression in this distinct brain region occurs in the embryo during early developmental stages. We have been highly interested in the localization and projection of AVT neuron in the adult brain of male medaka because our previous study demonstrated that AVT expression in the distinct POAs is associated with dominant and subordinate behaviors in the male–male competition of medaka [13]. Therefore, when assessing AVT neurons in the adult brain in this study, we focused on the male brain. In this study, AVT somata were found in distinct POAs (i.e., gPOA, mPOA, and pPOA) in the adult brain of the avt-egfp transgenic medaka. We demonstrated by the double-immunofluorescence staining that all GFP-positive somata were AVT immunoreactive, although not all AVT-immunoreactive somata were GFP positive (approximately 85%). The similar facts have been also reported in the gnrh1-gfp transgenic mice and in the gnrh2-gfp transgenic medaka [24,25]. Hence the antibody for AVT used in this study has been shown to be specific for AVT in fish [1], we could not clarify the reason why AVT-immunoreactive somata without GFP exist in the transgenic line, however, the GFP transduction efficiency of the avt-egfp transgenic medaka could be sufficient to visualize the AVT neurons. AVT neurons with EGFP signals in the POA were also clearly detected in the live brain slices, therefore, the avt-egfp transgenic medaka generated in this study may be a useful model to examine the activity of AVT neurons using the live brain by a neurophysiological technique such as electrophysiology and calcium imaging. The distribution of AVT somata in the adult brain of the avtegfp transgenic medaka is consistent with the distribution noted in a previous study [17] in which the brain slices of adult male medaka were performed by in situ hybridization using AVT RNA probe. It has also been reported that a remarkable sex difference exists in the ventral hypothalamic AVT expression (i.e., which was prominent in male fish but completely absent in female fish) [17]. The present study did not determine the sex difference in the AVT expression of adult brain, whereas the embryonic expression of AVT was detected in both sexes. Future study is needed to determine whether AVT expression is absent in the VH of adult female fish in the avt-egfp transgenic line. If so, it will also be necessary to verify the possibility that embryonic AVT in that region may disappear during the development of the female brain. The avt-egfp transgenic medaka also contributed to the detection of the projection of several populations of AVT neurons in the adult brain. The present study revealed that AVT fibers are located in wide regions of the brain such as the telencephalon, mesencephalon, diencephalon, and pituitary. This fact has been well known in other fish species [15,19,26], whereas there was little information about which population of AVT neurons projects their fibers into the regions of brain or pituitary in teleosts. By using sections obtained by slicing the transgenic brain in multiple angles,
52
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
Fig. 4. The EGFP signals in the 250 m-thick sections obtained from the brains of avt-egfp adult transgenic medaka. (A) The schema of the sections obtained by slicing in the direction of lines i–iv. The open circle, solid circle, and solid square indicate the locations of the pPOA, mPOA and gPOA, respectively. The images under the bright field (B, D, F, H) and under the dark field (C, E, G, I). (B and C) In the section indicated by the square in A-i, the bilateral curved lines of the fibers with EGFP signals between the pPOA (p) and pituitary. Another line of the fibers exists between the VH and pituitary. (D and E) In the section indicated by the square in A-ii, the fibers are present from the somata in the mPOA (m) and gPOA (g) to the diencephalon. (F and G) In the section indicated by the square in A-iii, the fibers are present from the somata in the gPOA to the mesencephalon, in addition to fibers in the diencephalon. (H and I) In the section indicated by the square in A-iv, the fibers are present from the pPOA to the telencephalon, in addition to those projecting to the hypothalamus. The somata and the fibers are indicated by the arrow and arrowhead, respectively. Di, Diencephalon; OT, optic tectum; PIT, pituitary; T, telencephalon. Scale bar = 100 m.
N. Kagawa et al. / Neuroscience Letters 613 (2016) 47–53
this study assessed the localization and the major projection of AVT neurons. The populations of AVT somata are localized in the pPOA, mPOA, gPOA and VH, and the fibers from the pPOA and VH project into the posterior pituitary primarily. These findings suggest that AVT neurons in the pPOA and VH have a hypophysiotropic role. We also found that the fibers between the pPOA-AVT somata and the pituitary form a curved line bilaterally. In addition, this study found that the fibers of the gPOA- and mPOA-AVT neurons project into the diencephalon, those of the gPOA project into the mesencephalon, and those of the pPOA project into the telencephalon, too. In mammals, the magnocellular AVP neurons in the SON and PVN project their axons into the posterior pituitary, however, the parvocellular AVP neurons in the SCN and PVN do not project into the posterior pituitary [5–11]. Taken together, these findings suggest that the gigantocellular, magnocellular and parvocellular AVT neurons in medaka may have different functions, compared to AVP neurons in mammals. Our previous study had demonstrated that AVT expression in the gPOA and mPOA increased in dominant male medaka, whereas the pPOA increased in subordinate male after the male–male competition [13]. Further study is needed to investigate what roles AVT neurons projecting to the mesencephalon, diencephalon and telencephalon have in regulating social behaviors. In conclusion, we established a transgenic medaka line that enabled us to observe AVT neurons by using EGFP fluorescence in the embryonic and adult brain. Because disturbances in AVP influence physiological, behavioral, and psychiatric disorders [27–29], the avt-egfp transgenic medaka may be a useful model to study the mechanisms of these pathologies at the developmental and morphological levels. Conflict of interest There are no conflicts of interest to report. Acknowledgments We thank Ikuyo Hara (NIBB, Okazaki, Japan) and Mai Komori of the Kinki University (Higashiosaka, Japan) for their technical assistance in the generation of transgenic lines. We are grateful to Dr. Shinji Kanda (the University of Tokyo, Tokyo, Japan) for the helpful technical advice, Dr. Yasuhiro Kamei and Misako Taniguchi-Saida (NIBB) for their technical assistance in the confocal imaging. We also thank reviewers for their helpful comments on the manuscript. The present study is partly supported by the Grant-in-Aid for Scientific Research (No.15K07590) of the Japan Society for the Promotion of Science (Tokyo, Japan). References [1] S. Hyodo, A. Urano, Changes in expression of provasotocin and proisotocin genes during adaptation to hyper- and hypo-osmotic environments in rainbow trout, J. Comp. Physiol. B 161 (1991) 549–556. [2] J.L. Goodson, A.H. Bass, Forebrain peptides modulate sexually polymorphic vocal circuitry, Nature 403 (2000) 769–772. [3] K. Semsar, F.L.M. Kandel, J. Godwin, Manipulations of the AVT system shift social status and related courtship and aggressive behavior in the bluehead wrasse, Horm. Behav. 40 (2001) 21–31. [4] M.J. Brownstein, J.T. Russell, H. Gainer, Synthesis, transport, and release of posterior pituitary hormones, Science 207 (1980) 373–378. [5] H.H. Zingg, D. Lefebvre, G. Almazan, Regulation of vasopressin gene expression in rat hypothalamic neurons, J. Biol. Chem. 261 (1986) 12956–12959. [6] T.G. Sherman, J.F. McKelvy, S.J. Watson, Vasopressin mRNA regulation in individual hypothalamic nuclei: a northern and in situ hybridization analysis, J. Neurosci. 6 (1986) 1682–1694.
53
[7] J.P.H. Burbach, S.M. Luckman, D. Murphy, H. Gainer, Gene regulation in the magnocellular hypothalamo-neurohypophysial system, Physiol. Rev. 81 (2001) 1197–1267. [8] W.J. Schwartz, S.M. Reppert, Neural regulation of the circadian vasopressin rhythm in cerebrospinal fluid: a pre-eminent role for the suprachiasmatic nuclei, J.Neurosci. 5 (1985) 2771–2778. [9] T. Maruyama, T. Ohbuchi, H. Fujihara, M. Shibata, K. Mori, D. Murphy, G. Dayanithi, Y. Ueta, Diurnal changes of arginine vasopressin-enhanced green fluorescent protein fusion transgene expression in the rat suprachiasmatic nucleus, Peptides 31 (2010) 2089–2093. [10] T. Watabe, K. Tanaka, M. Kumagae, S. Itoh, M. Kogure, M. Hasegawa, T. Horiuchi, K. Morio, F. Takeda, E. Ubukata, S. Miyabe, N. Shimizu, Role of endogenous arginine vasopressin in potentiating corticotropin-releasing hormone-stimulated corticotropin secretion in man, J. Clin. Endocrinol. Metab. 66 (1988) 1132–1137. [11] C.A. Bondy, M.H. Whitnall, L.S. Brady, H. Gainer, Coexisting peptides in hypothalamic neuroendocrine systems: some functional implications, Cell. Mol. Neurobiol. 9 (1989) 427–446. [12] B.J. Gilchriest, D.R. Tipping, L. Hake, A. Levy, B.I. Baker, The effects of acute and chronic stresses on vasotocin gene transcripts in the brain of the rainbow trout (Oncorhynchus mykiss), J. Neuroendocrinol. 12 (2000) 795–801. [13] N. Kagawa, Social rank-dependent expression of arginine vasotocin in distinct preoptic regions in male Oryzias latipes, J. Fish Biol. 82 (2013) 354–363. [14] T. Sakamoto, Y. Nishiyama, A. Ikeda, H. Takahashi, S. Hyodo, N. Kagawa, H. Sakamoto, Neurohypophysial hormones regulate amphibious behaviour in the mudskipper goby, PLoS One (2015), http://dx.doi.org/10.1371/journal. pone.0134605. [15] M. Olivereau, J. Olivereau, Effect of pharmacological adrenalectomy on corticotropin-releasing factor-like and arginine vasotocin immunoreactivities in the brain and pituitary of the eel: immunocytochemical study, Gen. Comp. Endocrinol. 80 (1990) 199–215. [16] C.M. Foran, A.H. Bass, Preoptic AVT immunoreactive neurons of a teleost fish with alternative reproductive tactics, Gen. Comp. Endocrinol. 111 (1998) 271–282. [17] Y. Kawabata, T. Hiraki, A. Takeuchi, K. Okubo, Sex differences in the expression of vasotocin/isotocin, gonadotropin-releasing hormone, and tyrosine and tryptophan hydroxylase family genes in the medaka brain, Neuroscience 218 (2012) 65–77. [18] D. Saito, M. Komatsuda, A. Urano, Functional organization of preoptic vasotocin and isotocin neurons in the brain of rainbow trout: central and neurohypophysial projections of single neurons, Neuroscience 124 (2004) 973–984. [19] Y. Kimura, Y. Okamura, S. Higashijima, alx, a zebrafish homolog of chx10, marks ipsilateral descending excitatory interneurons that participate in the regulation of spinal locomotor circuits, J. Neurosci. 26 (2006) 5684–5697. [20] S. Nakamura, D. Saito, M. Tanaka, Generation of transgenic medaka using modified bacterial artificial chromosome, Dev. Growth Differ. 50 (2008) 415–419. [21] M. Kinoshita, Y. Kamei, Transgenesis: microinjection technique for medaka eggs, in: M. Kinoshita, K. Murata, K. Naruse, M. Tanaka (Eds.), Medaka: Biology, Management and Experimental Protocols, Wiley-Blackwell, USA, 2009, pp. 277–291. [22] J.L. Eaton, B. Holmqvist, E. Glasgow, Ontogeny of vasotocin-expressing cells in zebrafish: Selective requirement for the transcriptional regulators orthopedia and single-minded 1 in the preoptic area, Dev. Dyn. 237 (2008) 995–1005. [23] T. Deguchi, K. Naruse, History and features of medaka: advantage of medaka as a model fish. Differences from zebrafish, in: M. Kinoshita, K. Murata, K. Naruse, M. Tanaka (Eds.), Medaka: Biology, Management, and Experimental Protocols, Wiley-Blackwell, USA, 2009, pp. 9–29. [24] K.J. Suter, W.J. Song, T.L. Sampson, J.P. Wuarin, J.T. Saunders, F.E. Dudek, S.M. Moenter, Genetic targeting of green fluorescent protein to gonadotropin-releasing hormone neurons: characterization of whole-cell electrophysiological properties and morphology, Endocrinology 141 (2000) 412–419. [25] S. Kanda, K. Nishikawa, T. Karigo, K. Okubo, S. Isomae, H. Abe, D. Kobayashi, Y. Oka, Regular pacemaker activity characterizes gonadotropin-releasing hormone 2 neurons recorded from green fluorescent protein-transgenic medaka, Endocrinology 151 (2010) 695–701. [26] I.S. Parhar, H. Tosaki, Y. Sakuma, M. Kobayashi, Sex differences in the brain of goldfish: gonadotropin-releasing hormone and vasotocinergic neurons, Neuroscience 104 (2001) 1099–1110. [27] J.S. Purba, W.J. Hoogendijk, M.A. Hofman, D.F. Swaab, Increased number of vasopressin- and oxytocin-expressing neurons in the paraventricular nucleus of the hypothalamus in depression, Arch. Gen. Psychiatry 53 (1996) 137–143. [28] T.R. Insel, D.J. O’Brien, J.F. Leckman, Oxytocin, vasopressin, and autism: is there a connection? Biol. Psychiatry 45 (1999) 145–157. [29] C.S. Carter, Sex differences in oxytocin and vasopressin: implications for autism spectrum disorders? Behav. Brain Res. 176 (2007) 170–186.