Assessment of bluetongue viraemia in sheep by real-time PCR and correlation with viral infectivity

Journal of Virological Methods 169 (2010) 305–315

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Assessment of bluetongue viraemia in sheep by real-time PCR and correlation with viral infectivity E. Chatzinasiou a , C.I. Dovas a,∗ , M. Papanastassopoulou a , M. Georgiadis c , V. Psychas b , I. Bouzalas a , M. Koumbati a , G. Koptopoulos a , O. Papadopoulos a a b c

Laboratory of Microbiology and Infectious Diseases, Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece Laboratory of Pathology, Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece Laboratory of Animal Production and Economics, Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, 54124 Thessaloniki, Greece

a b s t r a c t Article history: Received 3 March 2010 Received in revised form 9 July 2010 Accepted 29 July 2010 Available online 5 August 2010 Keywords: Bluetongue virus RNA extraction dsRNA denaturation qRT-PCR EHDV amplification control dsRNA viruses

Inoculation of embryonated chicken eggs is the standard method for the titration of infectious Bluetongue virus (BTV). Here, six RNA extraction methods coupled with optimised dsRNA denaturation and real-time RT-PCR were evaluated for the quantitation of BTV in blood samples from experimentally infected sheep and results were correlated to infectious virus titres. An exogenous dsRNA internal control (IC) from the closely related Epizootic hemorrhagic disease virus (EHDV) was used to assess the efficiency of BTV genome extraction, dsRNA denaturation, RT, and PCR amplification. Recovery rates of IC and BTV dsRNA copies from extracted blood samples were highly correlated. Adjustment of BTV concentrations according to the IC recovery reduced variation in sample analyses among the different extraction methods and improved the accuracy of BTV quantitation. The EID50 /ml titre, determined in blood samples from sheep infected experimentally with BTV-1 or BTV-9, correlated highly with the assessed concentration of BTV dsRNA copies. However, this correlation was consistent only during the first 28 days post-infection. The optimised extraction methods and quantitative RT-PCR could be useful for experimental studies of BTV transmission, pathogenesis and vaccine efficacy, or adapted further for the detection and quantitation of EHDV, African horse sickness virus and other dsRNA viruses. © 2010 Elsevier B.V. All rights reserved.

1. Introduction Bluetongue (BT) is an arthropod-borne viral disease of wild and domestic ruminants, particularly sheep (Verwoerd and Erasmus, 2004), caused by an arbovirus and transmitted by haematophagous midges of the genus Culicoides (MacLachlan et al., 1994). The BT virus (BTV) is the prototype of the genus Orbivirus, family Reoviridae. The viral genome is composed of 10 segments of doublestranded RNA (dsRNA), seven of which (Seg-1 to Seg-4, Seg-6, Seg-9 and Seg-7) encode the structural proteins (VP1–VP7, respectively), while the remaining three segments (Seg-5, Seg-8 and Seg-10) encode the non-structural proteins (NS1, NS2, NS3/NS3A, respectively) (Mertens et al., 1984). Twenty-four distinct BTV serotypes have been detected worldwide (Walton, 2004). In Europe, a series of BT outbreaks started in 1998, involving several serotypes (for review see Mellor et al., 2009). Between 1998 and 2007, BTV serotypes 1, 2, 4, 9 and 16 have been circulating in southern Europe. In recent years, four more serotypes have appeared in Europe for the first time, including BTV

∗ Corresponding author. Tel.: +30 2310999870; fax: +30 2310999959. E-mail address: [email protected] (C.I. Dovas). 0166-0934/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2010.07.033

serotype 8, which has spread across north Europe inflicting severe economic damage to the sheep and cattle industries (Conraths et al., 2009), serotypes 6 and 11 (De Clercq et al., 2009; Eschbaumer et al., 2010) and a virus isolated from goats in Switzerland (Toggenburg orbivirus), provisionally identified as a new, 25th distinct serotype (BTV-25) (Hofmann et al., 2008). After the incursion of bluetongue into Europe, vaccination was applied in an effort to minimise direct economic losses to the livestock industry, reduce virus circulation and allow safe movement of animals from endemic areas, initially with live attenuated vaccines and more recently with inactivated whole virus vaccines (Savini et al., 2008, http://www.ema.europa.eu/htms/vet/epar/ eparintro.htm). In addition, other candidate protein-based and pox-virus-based vaccines have emerged (for review see Noad and Roy, 2009); these include virus-like particles (VLPs) using baculovirus expression strategies (Stewart et al., 2010) and canarypox virus vectored vaccines (Boone et al., 2007), respectively. The isolation and titration of infectious BTV in clinical samples is performed by embryonated chicken egg (ECE) inoculation (Goldsmit and Barzilai, 1968; Clavijo et al., 2000) or cell culture inoculation (White, 1987; Wechsler and McHolland, 1988; Wechsler and Luedke, 1991). Both techniques are also used for assessing viraemia levels following a virus challenge, considered

306

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

to be the most objective approach to assessing the efficacy of vaccine-induced immunity (Savini et al., 2008; Veronesi et al., 2009). Titration of infectious viruses has also been used for the rapid assessment of the attenuation level of live attenuated vaccines (Franchi et al., 2008). The most sensitive and reliable titration for BTV is achieved by ECE intravenous inoculation, although it is a laborious and time-consuming method that does not allow largescale implementation. Molecular assays have been used extensively for the detection, serotyping and phylogenetic analysis of BTV isolates, including RTPCR (Billinis et al., 2001; Maan et al., 2007; Mertens et al., 2007), sequencing (Nikolakaki et al., 2005; Maan et al., 2008; Nomikou et al., 2009) and real-time PCR (Jiménez-Clavero et al., 2006; Orrù et al., 2006; Shaw et al., 2007; Toussaint et al., 2007; Elia et al., 2008; Vandenbussche et al., 2009). Real-time PCR is used in diagnostic routine for the broad or the specific detection of BTV serotypes, because it is efficient, less labour intensive, rapid, sensitive and has a lower risk of cross-contamination in the laboratory. It is also used for virus quantitation; however the correlation between the number of copies detected and virus infectivity in the corresponding samples has not been investigated. In this study, the development of a quantitative real-time RTPCR (qRT-PCR) for the assessment of bluetongue viraemia in sheep is described. In the qRT-PCR developed, the efficiency of dsRNA purification and denaturation, cDNA synthesis, and PCR amplification were monitored in each individual sample. For this reason dsRNA from a closely related Orbivirus, Epizootic hemorrhagic disease virus (EHDV), was used as an internal control (IC). Six different RNA extraction protocols were evaluated for their performance in the absolute quantitation of BTV Seg-5 in blood samples. The evaluation was based on the levels and variation of dsRNA recovery achieved, on the sensitivity of detection, and on the presence of inhibitors. The correlation between the detected BTV dsRNA copy number and infectious virus levels during viraemia in experimentally infected animals was also assessed. 2. Materials and methods 2.1. Virus isolates BTV-1 (strain GR1472/01LS) and BTV-9 (strain GR199/98RS), isolated from naturally infected sheep (Nikolakaki et al., 2005), were inoculated in donor sheep. Blood was collected from each sheep, 8 days post-infection, washed twice in equal volume of PBS (pH 7.2), aliquoted and stored at −80 ◦ C for use as inoculum. The infectious blood titre was 104.3 and 107 EID50 (50% egg infectious doses)/ml) for BTV-1 and BTV-9 respectively. EHDV type 6, strain 318 (Mohammed and Mellor, 1990; Mohammed et al., 1996) was used as internal control, kindly supplied by Dr. K. Nomikou and Dr. O. Mangana (Institute of Infectious and Parasitic Diseases, Ministry of Rural Development and Food, Athens, Greece). 2.2. Experimental animals and sampling Two groups (6 animals each) of 1.5-year-old female Karagouniko sheep (a Greek breed) were used. Group I was infected with BTV-1 and group II with BTV-9. Animals were inoculated with infectious blood from the donor sheep, 1 ml subcutaneously in the neck and 1 ml intradermally on the lateral surface of the left thigh. Two animals were kept as uninfected controls in each group. Group I and II animals were kept for 28 and 93 days post-infection, respectively, and were euthanased thereafter. Whole blood samples were collected in EDTA on days 0, 3, 5, 7, 8, 10, 12, 17, 24 and 28, postinfection from group I, and on days 0, 5, 8, 12, 17, 28, 48, 68 and 93 post-infection from group II. From each sample, red blood cells

(RBC) were isolated, washed three times with sterile PBS and stored at −80 ◦ C. All animal experiments were approved by the relevant institutional animal ethics committee and carried out in accordance with approved guidelines (National Health and Medical Research Council, Greece, 2009). 2.3. Virus titration using embryonated chicken egg (ECE) inoculation Serial 10-fold dilutions of washed RBC were inoculated into five 11- to 12-day-old embryonated chicken eggs each (Goldsmit and Barzilai, 1968; Clavijo et al., 2000; Bréard et al., 2003). All chicken embryos that died between 2 and 7 days post-inoculation showed subcutaneous haemorrhages and were considered as infected with BTV. For confirmation, tissues from embryos of the highest positive dilution were frozen, homogenised in 10 volumes of Eagles medium (Invitrogen, Breda, The Netherlands) and inoculated onto BHK-21 cells for virus detection (Goldsmit and Barzilai, 1968; Clavijo et al., 2000; Bréard et al., 2003). Virus titre was calculated by the Reed–Muench method (Reed and Muench, 1938). 2.4. Comparative evaluation of six viral RNA extraction methods from blood samples Blood samples from five group I animals were obtained on days 8 and 22 post-infection and used for the evaluation of six RNA extraction protocols (four commercial modified and two in-house). RNA was extracted in triplicates from washed RBC with input volumes ranging from 100 ␮l to 1 ml depending on the method used, as described below. Method A was developed in-house following modifications of procedures described previously (Rasool et al., 2002; Borodina et al., 2003). Specimen lysis was achieved with guanidine hydrochloride (GuHCl), while nucleic acid purification was achieved by selective binding on a silica membrane. Briefly, 600 ␮l of ‘lysis buffer A’ (8 M GuHCl, 25 mM EDTA, 1% Sarcosyl, 2% Triton X-100, 25 mM sodium citrate, 0.2 M sodium acetate, pH adjusted to 5.2 with acetic acid) were added to 100 ␮l of washed RBC. Three ␮g of RNA carrier was added and the lysate was incubated at 70 ◦ C for 10 min. Then, 875 ␮l of absolute ethanol was added (to obtain 55.5% final concentration) and the mixture was passed through a silica column (FT-2.0 Filter-Tube Spin-Column System, G. Kisker GbR, Steinfurt, Germany) by centrifugation at 8000 × g. The column was washed once with 700 ␮l “wash buffer 1” (4 M GuHCl, 50 mM Tris–HCl pH 6.6, and 60% ethanol) and twice with “wash buffer 2” (2 mM Tris–HCl pH 7.0, 20 mM NaCl, and 80% ethanol), using 900 and 500 ␮l respectively. RNA was finally recovered in 50 ␮l of preheated (80 ◦ C) nuclease-free elution buffer (10 mM Tris–HCl, pH 8.0). Method B was based on method A, with the addition of a phenol–chloroform extraction step. Following the incubation step at 70 ◦ C for 10 min, each lysate was extracted once with 600 ␮l equilibrated acid phenol (pH 4.1–4.5) and 200 ␮l chloroform isoamyl alcohol (24:1). The tubes were mixed at room temperature using a rotator at 5 rpm for 10 min followed by incubation at −20 ◦ C for 20 min. The extract was centrifuged (14,000 × g, 15 min, 4 ◦ C), and 400 ␮l of the aqueous phase were mixed with 500 ␮l absolute ethanol to obtain a 55.5% final concentration, and finally transferred to a silica column as in method A. Method C employed the QIAamp Viral RNA Mini Kit (Qiagen, Hilden, Germany) to extract RNA, according to the manufacturer’s instructions; 140 ␮l of washed RBC was used. Method D was a modification of method C that included an additional stage of phenol–chloroform extraction. Similar to method B, following the phenol–chloroform extraction step, 400 ␮l of the

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

307

Table 1 BTV and EHDV primers used in quantitative real-time PCR. Primer/probe designation

Sequence 5 → 3 a

Locationb

Concentration in PCR

Estimated Tm c

BTV-S5F BTV-S5R EHDV-S5F EHDV-S5R

CTAGTTGGCAACYACCAAACATGGA CCAAAAAAGTYCTCGTGGCATTWGC CTTCGTCGACTGCCATCGAGA CGTCCACTGTGGTGATAATGCTTG

7–31 93–68 13–33 119–95

200 nM 400 nM 200 nM 200 nM

64.3–66.4 ◦ C 64.2–66.4 ◦ C 65.6 ◦ C 65.4 ◦ C

a b c

IUPAC ambiguity codes: W = A or T; Y = C or T. Primer annealing positions corresponding to Seg-5 of BTV-9 and EHDV-6 based on accession nos. DQ017959 and L27647, respectively. The melting temperatures were estimated using the OligoAnalyzer 3.1 software (http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/).

removed aqueous phase was mixed with 500 ␮l absolute ethanol before being transferred to a silica column. Method E included the application of the NucleoSpin® RNA virus kit (Macherey-Nagel, Düren, Germany) for RNA extraction, according to the manufacturer’s instructions, using 150 ␮l of washed RBC. Method F included the application of the NucleoSpin® RNA virus F kit (Macherey-Nagel, Düren, Germany) for RNA extraction from 1 ml of washed RBC, modified by including a phenol–chloroform extraction step, as in methods B and D. Briefly, the lysate was subjected to RNA extraction with 6 ml phenol–chloroform (2:1). Five ml of the aqueous phase was mixed with 6 ml absolute ethanol and then transferred to a silica funnel column. In all protocols, RNA was eluted in a final volume of 50 ␮l and stored at −80 ◦ C until use. To assess qRT-PCR inhibition, all RNA extracts from each of the five samples from day 8 post-infection were also tested at a 1:10 dilution in elution buffer containing RNA carrier. The linearity of BTV quantitation range using methods B and F was evaluated by testing RNA extracts from a BTV-1 viraemic sheep (No. 5, 8 days post-infection); RBC were washed and serially diluted with washed RBC from a non-infected animal. 2.5. Preparation of BTV DNA/dsRNA standards and EHDV dsRNA internal control An 87 bp BTV Seg-5 specific amplicon was produced by RT-PCR using the BTV-S5F and BTV-S5R primers (Table 1) and the RNA extract from the BTV-9 (GR199/98RS) isolate. Purified PCR products were cloned in the pCR2.1 vector using the TA cloning kit (Invitrogen, Breda, The Netherlands). Plasmid DNA was extracted using the ‘Nucleobond’ plasmid purification system (MachereyNagel, Düren, Germany) and linearised. The Seg-5 of BTV-9 was purified from infected C6/36 cells, cultured in 225 cm2 flasks. More specifically, 10 days post-inoculation, the culture media was discarded, the infected cell layer was harvested in 2 ml lysis buffer A and dsRNA was isolated according to extraction method B. Total RNA was eluted in 92 ␮l of 10 mM Tris–HCl (pH 8.0) and 5 mM EDTA. 7.5 ␮l of 4 M NaCl was then added, followed by the addition of 0.1 ␮g of RNase A (AppliChem, Darmstadt, Germany) and incubation at 37 ◦ C for 30 min to degrade the single-stranded RNA. The dsRNA was purified again using extraction method B, and subjected to 1.5% agar gel electrophoresis. The gel slice containing Seg-5 was excised and dsRNA was isolated using the QIAquick® Gel Extraction kit (Qiagen, Hilden, Germany) protocol, modified by using one volume of buffer QG to one volume of gel slice. The linearised plasmid and the purified Seg-5 dsRNA were quantified by spectrophotometry and stored in aliquots in siliconised polypropylene tubes at −80 ◦ C in the presence of 50 ng/␮l RNA carrier (Qiagen). Dilutions of these DNA and dsRNA standards prepared in DEPC-treated water containing 50 ng/␮l RNA carrier were used to determine the amplification efficiency, the variation and dynamic range of quantitation and the detection limit of the BTV qRT-PCR assays employed. Probit regression was used to model the relation

between the number of dsRNA copies present in the RT reaction and the production of a positive test result by qRT-PCR. For this purpose, ten replicates were tested at each of the following BTV standard concentrations: 320, 160, 80, 40, 20 and 10 dsRNA copies per RT reaction. Using the resulting model, the 95% detection limit of the qRT-PCR was calculated. The EHDV Seg-5 encoding the NS1 protein was used as an exogenous IC. Infected monolayers of BHK-21 cell cultures (3 days post-inoculation) were used and dsRNA was extracted from the pelleted cells using the extraction procedure applied for the BTV dsRNA standard. Approximately 137,500 dsRNA copies of EHDV IC were added to the lysis buffer of each blood sample at the extraction stage. 2.6. Design of primers Two pairs of BTV and EHDV specific primers were selected from highly conserved regions of Seg-5 for each virus, following multiple alignments of all sequences available in GenBank. The selected genomic region for BTV primers was similar to that identified previously by Toussaint et al. (2007) for the detection of all BTV serotypes. Both primers were slightly modified by adding nucleotides at the 5 end in order to compensate for conditions that reduced their melting temperature in the PCR mix, such as lower magnesium concentration and the presence of residual betaine from the reverse transcription (RT) step. The primers designed for the detection of EHDV, EHDV-S5F and EHDV-S5R (Table 1), amplify a 107 bp genomic region homologous to the BTV amplicon. 2.7. dsRNA denaturation and cDNA synthesis Optimisation of dsRNA denaturation for both BTV and EHDV was performed prior to cDNA synthesis by evaluating the effect of four additives like betaine, DMSO, trehalose and tetramethylene sulfoxide (TMS) in various concentrations (Table 2). Twelve combinations of additive and concentration were evaluated, and measurements of qRT-PCR Ct values were obtained. Analysis of Variance (ANOVA) was performed to compare the mean Ct values among these 12 groups for each virus (BTV and EHDV) and virus concentration (104.6 and 103.6 copies). In cases where one or more replicates tested negative, all samples subjected to the corresponding additive treatment were excluded from the analysis. Mean Ct values were compared among the study groups applying a Bonferroni adjustment for multiple comparisons, and using an alpha level of statistical significance of 0.05. All analyses were performed using the SPSS statistical package. Optimal reaction conditions for dsRNA denaturation and RT were determined as follows; the dsRNA denaturation mixture contained 4 ␮l of dsRNA, 1 ␮l of MMLV (5×) first strand buffer (Invitrogen, Breda, The Netherlands), 1.35 ␮M random hexamers (100 ␮M), 3 units Recombinant Ribonuclease Inhibitor (RNaseOUTTM , Invitrogen, Breda, The Netherlands) and 1.25 M betaine from a 5 M stock solution (Sigma–Aldrich Chemie GmbH, Taufkirchen, Germany). The mixture was heated at 95 ◦ C for 5 min to denature the nucleic acids and subsequently chilled on a PCR-

308

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

Table 2 Comparison of the effect of additives on the BTV and EHDV dsRNA denaturation and reverse transcription (RT) efficiency, revealed by the respective real-time PCR Ct values. Mean Ct and standard deviation (SD) values are presented. Additive

None Betaine 1.5 M Betaine 2 M Betaine 2.5 M Betaine 3 M DMSO 5% DMSO 10% DMSO 15% Trehalose 0.5M Trehalose 1 M TMS 0.5 M TMS 1 M

Positive detection ratio of three independent assays (mean Ct ± SD) 104.6 copies/RT BTV EHDV

103.6 copies/RT BTV

EHDV

3/3 (36.55 ± 0.91)c 3/3 (31.94 ± 0.22)a,b 3/3 (31.56 ± 0.37)a 3/3 (31.57 ± 0.37)a 3/3 (31.69 ± 0.27)a 3/3 (34.11 ± 0.39)b 3/3 (33.69 ± 1.28)b 3/3 (32.31 ± 0.17)a,b 3/3 (34.26 ± 0.34)b 3/3 (33.89 ± 0.99)b 3/3 (33.79 ± 0.42)b 3/3 (32.49 ± 0.09)a,b

1/3 (38.18) 3/3 (35.24 ± 0.21)a 3/3 (35.04 ± 0.43)a 3/3 (35.01 ± 0.44)a 3/3 (35.94 ± 0.71)a 1/3 (38.32) 3/3 (35.88 ± 0.47)a 3/3 (36.60 ± 0.33)a 0/3 3/3 (37.14 ± 3.47)a 3/3 (36.82 ± 0.76)a 3/3 (35.69 ± 0.73)a

0/3 3/3 (35.13 ± 0.94)a 3/3 (34.14 ± 0.10)a 3/3 (34.66 ± 0.59)a 3/3 (34.78 ± 1.17)a 0/3 3/3 (36.36 ± 0.76)a 3/3 (36.17 ± 1.26)a 0/3 0/3 1/3 (40.11) 3/3 (37.15 ± 1.67)a

0/3 3/3 (31.43 ± 0.23)a,b 3/3 (30.92 ± 0.07)a 3/3 (31.09 ± 0.49)a 3/3 (31.21 ± 0.17)a 3/3 (36.81 ± 1.49)c 2/3 (35.49 ± 0.88) 3/3 (32.82 ± 0.45)a,b 0/3 2/3 (35.78 ± 0.74) 2/3 (35.99 ± 0.01) 3/3 (33.53 ± 1.17)b

a–c

Comparison of values within each combination of virus and concentration in the RT assay; values with the same superscript are not statistically significantly different (P > 0.05) from each other but they differ significantly (P < 0.05) from values with a different superscript. In cases where one or more replicates tested negative, the additive treatment was excluded from the analysis.

cooler rack (−20 ◦ C) (Eppendorf) for 3 min, to allow fast cooling and hybridisation of hexamers. The RT was subsequently performed following the addition of 10 ␮l of a reaction buffer containing 3 ␮l of MMLV (5×) first strand buffer, 1 ␮l of a solution containing 10 mM each of dATP, dCTP, dGTP, and dTTP, 10 mM DTT (0.1 M), 10 units RNaseOUTTM , 50 units MMLV Reverse Transcriptase (Invitrogen, Breda, The Netherlands), and 3.5 ␮l DEPC-treated water. RT reactions were performed with the following thermal conditions; 22 ◦ C for 10 min, 25 ◦ C for 10 min, 37 ◦ C for 30 min, 42 ◦ C for 10 min, 95 ◦ C for 10 min to inactivate the MMLV, and a final cooling down to 4 ◦ C step. 2.8. Quantitative real-time PCR Amplification reactions were ran in a total volume of 50 ␮l using 2 ␮l of cDNA or plasmid DNA. Two independent real-time PCR assays were performed simultaneously for the detection of BTV and EHDV using each cDNA sample, respectively. The assays were optimised using the Mx3005P QRT-PCR system (Stratagene, La Jolla, CA, USA). Standard cycling conditions included an initial denaturation step at 92 ◦ C (3 min), followed by 45 cycles of denaturation at 95 ◦ C (30 s), and annealing-elongation at 58 ◦ C (40 s). Fluorescence levels were measured at the end of each cycle. Optimal reaction conditions for real-time PCR were determined as follows; 2 units of Platinum® Taq DNA polymerase (Invitrogen, Breda, The Netherlands), 1× PCR buffer, 200 ␮M each dATP, dCTP, dGTP, and dTTP, 2.5 mM MgCl2 , 1× DNA-specific fluorescent dye EvaGreenTM (Biotium, Hayward, CA, USA), the BTV or EHDV specific primers in the concentrations described in Table 1, and nuclease free water up to 50 ␮l. Following amplification, melting curve analysis was performed to verify the correct product by its specific melting temperature. The analysis of fluorescence data was conducted using the MxPro-Mx3005P software (Version 4.00; Stratagene, La Jolla, CA, USA). In each RT and respective real-time PCR run, a BTV external standard and an EHDV recovery control (RC) were added together in triplicate reactions as calibrator samples for assessing the performance of the BTV amplification run and the EHDV IC recovery from the samples tested. They were both used in quantities equivalent to approximately 11,000 dsRNA copies per RT. The EHDV RC copies in the RT corresponded to a 100% recovery for the IC spike from each sample. The dsRNA recovery (R) from each sample was calculated from the differences between the Ct values of the RC and the spiked IC using the formula: R = 1/2(Ct IC−Ct RC) . The BTV copy numbers were determined by extrapolating the Ct values to the standard curve of BTV. BTV concentrations were adjusted to the

recovery of EHDV by dividing the observed concentration by the recovery. 2.9. Comparison of virus titration using ECE inoculation and qRT-PCR In order to compare the titration results obtained using qRT-PCR and ECE inoculation, all blood samples obtained from the group I and II BTV infected animals were tested in parallel using both methods. Extraction method B and the qRT-PCR described above were applied. Calculation of the BTV dsRNA copies was adjusted for the EHDV IC recovery. The relationship of the logarithm of dsRNA copies and titres, determined by qRT-PCR and ECE inoculation respectively, was assessed separately for each virus (BTV-1 and BTV-9) using simple linear regression analysis. Subsequently, the following linear regression model was used to test the equality of the two regression functions, namely of the logarithm of dsRNA copies and the titre of infectious virus, for each virus. Specifically, in this model, the dependent variable was log10 (virus titre determined by ECE inoculation) and independent variables were the log10 (dsRNA copies determined by qRT-PCR) and the type of virus used (0 = BTV9, 1 = BTV-1), while the interaction term between log10 dsRNA copies and the type of virus was also included in the model. The linear regression model that was fitted had the following response function: E{log10 (virus titre by ECE inoculation)} = ˛ + ˇ1 {log10 (dsRNA copies by qRT-PCR)} + ˇ2 (virus) + ˇ3 {virus × log10 (dsRNA copies by qRT-PCR)} By assessing the significance of appropriate regression coefficients and groups of regression coefficients, it could be assessed whether the two lines describing the relationship between the log10 titres obtained by ECE inoculation and qRT-PCR for each of the two viruses could be considered to be coincident, parallel or none of the two (Neter et al., 1990). 3. Results 3.1. Optimisation of dsRNA denaturation Genomic Seg-5 dsRNA from both BTV-9 and EHDV-6 was successfully isolated and quantified (Fig. 1). Comparison of the various additives tested for the denaturation efficiency of dsRNA before RT showed that only protocols in which

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

Fig. 1. Electrophoretic analysis of genomic dsRNAs from EHDV-6 (strain 318) and BTV-9 (strain GR199/7a/98RS). Lanes L: 2-Log DNA Ladder (New England Biolabs GmbH, Frankfurt am Main, Germany). Base pairs for Seg-5 which encodes protein NS1 for EHDV and BTV are indicated according to accession nos. L27647 and DQ017959, respectively.

1.5–3 M betaine, 15% DMSO or 1 M TMS was added detected all replicates of the different BTV and EHDV concentrations (Table 2). Although in all dsRNA templates tested differences in mean Ct values between the betaine concentrations and 15% DMSO were not significant, they all resulted in significantly lower mean Ct values compared to the other concentrations of additives tested (Table 2). The use of betaine 2–2.5 M resulted in the lowest Ct values in real-time PCR and reduced the variation of repeated qRT-PCR amplifications compared to 15% DMSO and 1 M TMS. 3.2. Amplification efficiency, dynamic range and sensitivity of the qRT-PCR The real-time PCR amplification efficiency calculated using the synthetic BTV DNA plasmid and the BTV dsRNA standard was 100.31 and 100.9% respectively, showing optimal amplification conditions. The linear range of BTV dsRNA detection ranged from 106 to 100 RNA copies per RT reaction (Fig. 2). The 95% detection limit, as estimated by probit regression modelling, was 83.26 RNA copies per RT. The amplification efficiency determined using dilutions of the purified EHDV dsRNA standard was 102.3%. 3.3. Specificity The melting curves showed a single specific peak at 82 ◦ C expected for BTV, only in the case of BTV-1 and BTV-9 infected animals. Amplification for up to 43 cycles, using RNA extracted from the healthy animals or the EHDV culture supernatant, did not show any non-specific fluorescence. For both BTV positive and BTV negative, spiked samples, the expected peak at 82.5 ◦ C specific for the EHDV IC was obtained.

309

Variation was higher in methods A and C compared to the corresponding modified methods B and D that involved in addition of the phenol–chloroform step (Table 3). In methods A, C and F that did not involve the phenol–chloroform extraction step, the CV values for BTV concentration measurements were reduced after the adjustment to recovery rates (Table 3). For each individual sample, the BTV concentration measurements of all six methods were in agreement only after adjusting each value to the respective recovery (Fig. 3). All RNA extracts from each of the five samples from day 8 post-infection, were additionally tested at 1:10 dilution to assess the presence of inhibitors (data are shown in Table 3). A 10fold reduction in the calculated numbers is expected following the dilution of the extracts in case no inhibitors are present. This condition was fulfilled in methods A, B, C, D, and E which showed a 14.2 ± 3.59, 13.92 ± 3.23, 12.53 ± 1.29, 11.43 ± 2.06 and 11.06 ± 3.22 (mean ± SD) fold reduction of template detected, respectively. In method F, the 1:10 dilution resulted in only 3.73 ± 1.30 fold reduction. This suggests that inhibitors present in the undiluted sample decreased the level of amplification and that this effect could be diminished by diluting. The highest dsRNA recovery rates were obtained by methods A and B (Table 3). The Ct values of EHDV IC depended on the recovery rate of each extraction protocol and were typically between 32.4–35.1 cycles for methods A, B and D, 33.7–38.0 cycles for methods C and E, and 35.6–36.6 cycles for method F (Fig. 4). Method B, that showed low variation and high recovery, and method F, that showed high sensitivity (Table 3), were further tested for their linearity. Testing of washed RBC from a BTV-1 viraemic sheep serially diluted with washed RBC from a noninfected animal revealed a linear range of detection from 107.1 down to 104.1 dsRNA copies/ml RBC for the in-house methods B and F, respectively (Fig. 4). Regression analysis of EHDV IC and BTV percent recovery rates calculated from these RNA extracts showed linear correspondence and high correlation (Fig. 4). 3.5. Inter- and intra-experimental variation of BTV dsRNA quantitation Different concentrations of BTV dsRNA standard were used to assess the variation of qRT-PCR. The inter-experimental CV% (based on calculated dsRNA concentration in copies per RT mixture) was assessed by testing 10 replicates. For concentrations of 106 , 105 , 104 , 103 , 320, 160, 80 and 40 dsRNA copies per RT mixture, CV was 7.53, 12.80, 7.46, 9.58, 30.71, 35.55, 49.56 and 90.55%, respectively. The intra-experimental CV was evaluated by amplifying a sample containing 104 copies BTV per reverse transcription reaction in eight different runs and was found to be 19.77%. The experimental variation of qRT-PCR employing extraction method B was assessed using RBC from BTV-1 viraemic sheep (No. 5, 8 days post-infection) serially diluted in RBC from a non-infected animal. The inter- and intra-experimental variation (CV% based on calculated dsRNA concentration in copies per ml of RBC) was calculated from 10 replicates and four consecutive repeats, respectively, and is shown in Table 4.

3.4. Comparison of nucleic acid extraction protocols RNA was extracted successfully from blood samples from BTV-1 infected Karagouniko sheep, on days 8 and 22 post-infection, with all six extraction methods compared. All methods that involved a phenol–chloroform extraction modification step (B, D and F) showed reduced variation of dsRNA recovery rates as indicated by the respective coefficient of variation (CV) values calculated from the recovered EHDV IC (Table 3), as well as the CV of BTV dsRNA copies calculated before adjustment to dsRNA recovery.

3.6. Comparison of virus titration using ECE inoculation and qRT-PCR To elucidate whether there was a correlation between the quantitative results of qRT-PCR and the titration using ECE inoculation, samples taken from sheep infected by BTV-1 and BTV-9 over a 28and a 93-day period, respectively, were tested by both assays. The log values of dsRNA copies/ml for samples tested over the first 28 days post-infection were approximately 2.09 times higher

310 Table 3 Comparison of six different RNA extraction methods using washed red blood cells (RBC) from five BTV infected animals on day 8 and 22 post-infection. BTV Seg-5 concentration and coefficient of variation (CV% based on calculated dsRNA concentration in copies per ml of RBC) were calculated from triplicates. No of animal (days post-infection)

Log BTV copies/ml RBC (CV %) Method A (100 ␮l)a

Method B (100 ␮l) 1:10b

Undiluted RNA

d

Not adjusted

Not adjusted

Adjusted

Not adjusted

Not adjustedd

1 (d8) 2 (d8) 3 (d8) 4 (d8) 5 (d8) 1 (d22) 2 (d22) 3 (d22) 4 (d22) 5 (d22) Recoverye Log LODf

6.90 (12.76) 6.89 (17.56) 6.47 (16.59) 6.79 (32.80) 6.93 (15.86) 5.81 (4.32) 5.63 (16.77) 5.39 (14.51) 6.19 (9.06) 5.92 (18.64)

7.10 (30.64) 6.78 (8.50) 6.40 (56.75) 6.54 (54.77) 6.91 (38.01) 5.79 (58.42) 5.58 (38.39) 5.21 (47.01) 6.25 (40.20) 5.98 (34.80) 90.01 (45.22) 4.06

6.01 (21.88) 5.76 (12.03) 5.10 (57.66) 5.41 (38.44) 5.74 (50.43) NT NT NT NT NT

7.07 (5.76) 7.03 (21.86) 6.61 (9.40) 7.10 (12.21) 7.10 (18.83) 6.01 (20.90) 5.88 (14.63) 5.48 (12.01) 6.46 (3.56) 6.03 (28.46)

6.87 (6.91) 6.90 (16.86) 6.40 (12.17) 6.82 (9.08) 7.01 (16.07) 5.81 (12.45) 5.74 (21.18) 5.40 (12.46) 6.33 (17.63) 5.77 (3.52) 68.5 (18.63) 4.18

5.85 (22.58) 5.71 (24.44) 5.24 (44.60) 5.56 (18.02) 5.97 (21.18) NT NT NT NT NT

6.94 (15.20) 7.06 (33.40) 6.59 (10.66) 7.00 (32.56) 7.05 (11.52) 5.92 (3.18) 5.72 (14.82) 5.66 (58.67) 6.45 (47.24) 5.91 (40.21)

6.66 (49.99) 6.38 (13.77) 6.50 (4.00) 6.48 (70.71) 6.62 (58.08) 5.46 (56.34) 4.95 (15.70) 4.75 (57.13) 5.61 (9.56) 5.11 (42.94) 31.98 (73.53) 4.37

5.55 (69.55) 5.32 (16.70) 5.46 (30.51) 5.33 (49.39) 5.50 (60.58) NT NT NT NT NT

No of animal (days post-infection)

Log BTV copies/ml RBC (CV %) Method E (150 ␮l)

Undiluted RNA

a

c d e f

c

d

Method F (1000 ␮l)

1:10

Undiluted RNA

1:10

Undiluted RNA

Adjustedc

Not adjustedd

Not adjustedd

Adjustedc

Not adjustedd

Not adjustedd

Adjustedc

Not adjustedd

Not adjustedd

7.09 (23.14) 7.09 (29.97) 6.63 (37.17) 7.09 (8.04) 7.16 (10.33) 5.85 (15.26) 5.83 (26.87) 5.57 (17.18) 6.40 (30.15) 5.90 (37.78)

6.76 (40.51) 6.85 (11.52) 6.37 (18.27) 6.80 (5.59) 6.86 (8.70) 5.58 (12.03) 5.56 (27.26) 5.27 (24.42) 6.14 (23.17) 5.61 (35.63) 53.34 (23.28) 4.14

5.82 (49.22) 5.73 (46.55) 5.25 (35.68) 5.71 (33.23) 5.87 (23.78) NT NT NT NT NT

6.96 (20.81) 7.09 (26.59) 6.59 (14.00) 7.02 (53.68) 7.10 (16.04) 5.88 (21.85) 5.86 (23.42) 5.62 (31.33) 6.35 (24.42) 5.78 (23.99)

6.68 (33.52) 6.24 (56.24) 6.02 (35.02) 6.20 (31.25) 6.48 (6.91) 5.10 (42.24) 5.14 (40.08) 4.90 (20.50) 5.30 (45.53) 5.02 (59.47) 21.34 (52.59) 4.51

5.79 (10.42) 5.03 (47.69) 4.99 (31.06) 5.14 (31.83) 5.52 (19.28) NT NT NT NT NT

6.96 (20.18) 7.06 (15.18) NT NT 6.91 (35.27) 5.80 (30.62) 5.82 (44.73) 5.58 (9.85) NT NT

6.24 (22.31) 6.46 (15.51) NT NT 6.32 (22.98) 5.10 (13.44) 5.14 (33.71) 4.81 (28.33) NT NT 22.91 (19.70) 3.66

5.89 (24.23) 5.83 (17.14) NT NT 5.81 (19.12 4.61 (5.42) 4.59 (26.89) 4.03 (33.99) NT NT

Extracted volume of RBC. RNA extract diluted 1:10. BTV Seg-5 copies adjusted to recovery of spiked EHDV dsRNA. BTV Seg-5 copies before adjustment to dsRNA recovery. Mean dsRNA recovery (%) and CV% of each method, calculated from the recovery of spiked EHDV dsRNA from all samples tested. Calculated log of detection limit, assuming 83.26 copies as the 95% detection limit of qRT-PCR (probit analysis), the extracted RBC volume and the method’s mean recovery.

1:10

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

Adjusted

b

d

1:10

Not adjusted

1 (d8) 2 (d8) 3 (d8) 4 (d8) 5 (d8) 1 (d22) 2 (d22) 3 (d22) 4 (d22) 5 (d22) Recoverye Log LODf

d

Undiluted RNA

Not adjusted

Method D (140 ␮l)

c

1:10

Adjusted

c

d

Method C (140 ␮l)

Undiluted RNA

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

311

Fig. 2. Amplification plots of BTV dsRNA detection. (A) FAM fluorescent signals and (B) corresponding standard curves generated from a 10-fold dilution series of BTV Seg-5 dsRNA. The 95% confidence limits for the standard curve are shown as hashed lines. From left to right, the curves represent dsRNA from 106 to 100 copies per reverse transcription reaction done in four replicates. Table 4 Experimental variation of the real-time RT-PCR with extraction method B. Results are based on calculated BTV Seg-5 copies per ml of washed red blood cells before and after adjustment to recovery of spiked EHDV dsRNA. Variation

Copies/ml

Coefficient of variation (%) Before adjustment After adjustment

Intra-experimental

107.1 106.1 105.1 104.1 107.1 106.1 105.1

20.43 14.11 16.79 47.79 24.82 35.87 30.15

Inter-experimental

12.16 8.33 23.62 43.72 8.72 22.34 12.60

than the respective log values of EID50 /ml (2.07 ± 0.49 for BTV1 and 2.11 ± 0.57 for BTV-9). Based on that, the mean ratio of infectious units/total BTV-1 or BTV-9 particles was calculated to 1/123. For all samples that were taken over the first 28 days postinfection, linear regression analysis showed a significant linear relation between the log10 EID50 /ml and log10 dsRNA copies/ml, determined for both BTV-1 and BTV-9 (R2 = 0.79 and 0.73 respectively, Fig. 5). It should be noted that for BTV-9, data from days 48 to 93 were excluded from the analysis, because although EID50 /ml titres decreased and remained near the ECE detection limit, the corresponding dsRNA copies/ml values calculated

Fig. 3. BTV Seg-5 concentration in red blood cells from five BTV-1 infected animals on day 8 and 22 post-infection, determined by qRT-PCR and six different RNA extraction methods. Symbol (+) indicates columns with values adjusted to recovery of spiked EHDV dsRNA and symbol (−) indicates columns with values not adjusted to recovery. The mean of adjusted concentration values from all methods is indicated by symbol (↔).

312

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

Fig. 4. qRT-PCR results from BTV-1 viraemic sheep (No 5, 8 days post-infection) washed RBC, 10-fold serially diluted in washed RBC from a non-infected animal. The initial concentration of BTV Seg-5 was 107.1 dsRNA copies per ml washed RBC. EHDV internal control (IC) and two different extraction methods were applied. (A) Analysis of the BTV qRT-PCR linearity. The linear regression curves are indicated. The dashed line with open triangles, squares and rhombuses indicates 1 ml washed RBC samples extracted using method F. The solid line with black triangles, squares, rhombuses and circles indicates 0.1 ml washed RBC samples extracted using method B. (B) Regression analysis of EHDV IC and BTV percent recoveries calculated from samples extracted with methods F (rhombuses) and B (triangles). (C) Respective FAM fluorescent signals generated from the EHDV dsRNA recovery control (RC) and the recovered IC spike, indicating a mean recovery of dsRNA of 62.43% with 24.57% CV for method B, whereas the respective values for method F were 9.45 and 19.52%.

showed high variation and did not show similar reduction (Fig. 5B). Regarding the linear regression analysis that was conducted to test the equality of the two regression functions (log10 EID50 /ml

and log10 dsRNA copies/ml) for each of the two viruses (BTV-1 and BTV-9), the statistical test of the null hypothesis ␤2 = ␤3 = 0, was non-significant (p = 0.58), failing, thus to reject the hypothesis that the two regression functions are identical. Given this result, one

Fig. 5. Regression analysis of BTV log10 50% egg infectious dose (EID50 )/ml RBC and Seg-5 log dsRNA copies/ml RBC, calculated from samples taken from infected sheep over (A) a 28-day period for BTV-1, and (B) a 93-day period for BTV-9 post-infection (PI). Linear regression lines were calculated using sample data from days 3 to 28 PI for both viruses. In the case of BTV-9, data from days 48–93 were excluded from the analysis.

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

could fit one regression line to the data for both viruses, with the following regression function: E{log10 (virus titre by ECE)} = 2.7 + 1.109{log10 (dsRNA copies by qRT-PCR)}

4. Discussion In the present work, the initial evaluation of real-time RTPCR was performed using homologous dsRNA genomic segments of EHDV and BTV as standards. The dsRNA standards were considered as more appropriate than synthetic plasmid expressed ssRNAs because they can also be used to assess the efficiency of the denaturation step. In addition, they can provide high stability and therefore better accuracy and reproducibility compared to ssRNAs, which can be easily degraded leading to inconsistencies in results obtained in different experiments and laboratories. Both BTV and EHDV real-time RT-PCR assays showed optimum amplification efficiency using the Mx3005P QRT-PCR system. Both assays showed high specificity and low experimental variation. Similar results were also obtained using a MiniOpticonTM real-time system (BioRad, Hercules, CA, USA), with which the derived BTV calibration curve had a regression coefficient of 0.999 and a slope of −3.315 (efficiency 100.31%) (data not shown). Inclusion of an internal control in each sample from the lysis step onwards is very important for obtaining consistently accurate qRTPCR results, because each sample is monitored for the efficiency of nucleic acid purification as well as the presence of PCR inhibitors (Dovas et al., 2010). In the case of BTV, endogenous internal controls that target housekeeping genes have been used, such as ␤-actin (Billinis et al., 2001; Toussaint et al., 2007) or 18S RNA (Vanbinst et al., 2009). The most accurate method for minimising errors during RNA extraction, denaturation and qRT-PCR, and correcting sample to sample variation is to amplify, simultaneously with the target, an exogenous IC that serves as an internal reference against which the BTV RNA values can be adjusted. Canine distemper virus has been used as an exogenous IC for BTV detection (Elia et al., 2008). However, this is an ssRNA IC and cannot assess the efficiency of the dsRNA denaturation step, necessary for the detection of dsRNA viruses. Ideally the IC should have physical properties similar to those of the target of interest. In this study, EHDV was selected as an exogenous IC that could mimic the performance of BTV dsRNA extraction, denaturation and RT. EHDV is a dsRNA virus, genetically closely related to BTV. Genomic Seg-5 exhibits high nucleotide identity (66–74%) among these viruses. The results indicate that the recovery of EHDV correlates highly with that of BTV (Fig. 3). The use of EHDV as an IC for the adjustment of the calculation of the BTV copies obtained in each individual sample led to the reduction of variation and improvement of quantitation accuracy, especially when the unmodified commercial extraction kits were used, as in methods C or E. The stability of IC during storage or handling is also important for the accuracy and repeatability of qRT-PCR. The dsRNA IC has increased stability compared to an ssRNA IC and therefore is expected to provide higher accuracy and long-term reproducibility of qRT-PCR applications. Furthermore, intact EHDV virions from infected cell cultures, instead of purified dsRNA, could be used to monitor the efficiency of the viral lysis step itself. However, the risk of infection has to be considered when animal pathogenic viruses are involved, rendering their applicability problematic for routine analysis in a laboratory. Alternatively, EHDV could be stored in the lysis buffer as a non-infectious material. A number of commercial RNA extraction kits have been used for the diagnosis of BTV in blood samples. The Trizol-LS reagent (Gibco-BRL) which is a mono-phasic phenol and guanidine isothiocyanate solution based on a method developed by Chomczynski

313

and Sacchi (1987), has been used extensively (Billinis et al., 2001; Zientara et al., 2002; Orrù et al., 2006; Toussaint et al., 2007; Vandenbussche et al., 2008). In recent years, many investigators have extracted RNA from blood using kits such as the QIAamp Viral RNA mini kit (Qiagen) (Anthony et al., 2007; Shaw et al., 2007; Elia et al., 2008; Eschbaumer et al., 2010) or the Nucleospin RNA virus kit (Macherey-Nagel) (Vandenbussche et al., 2009) that are based on the lysing and nuclease-inactivating properties of a guanidine chaotropic agent, and selective binding of RNA on a silica membrane. However, no data have been presented to date regarding the recovery rates, linearity, reproducibility, and avoidance of PCR inhibitors achieved by the RNA extraction methods applied for BTV detection in blood. Absolute quantitation requires thorough evaluation of the RNA extraction method for the virus and sample type being examined. In the present study, all methods resulted in the extraction of amplifiable dsRNA and can be used for diagnostic purposes. However, the method of choice for absolute quantitation purposes should present high RNA recovery, reduced variation and high linearity. Methods B, D, and F are essentially combinations of a modification of the guanidinium thiocyanate–phenol–chloroform extraction technique (Chomczynski and Sacchi, 1987) with selective binding isolation on a silica membrane. In the guanidinium thiocyanate–phenol–chloroform technique, the RNA is extracted using an acidic solution that contains a chaotropic agent (guanidinium thiocyanate), sodium acetate, phenol, and chloroform (Chomczynski and Sacchi, 2006). In acidic conditions, total RNA remains in the upper aqueous phase of the mixture, while DNA and proteins remain in the inter-phase or the lower organic phase. Recovery of the total RNA is then achieved by precipitation with isopropanol. However, this last step can increase the variation of RNA recovery rates and is thus not suitable for absolute quantitation protocols. This problem was alleviated here by replacing the RNA precipitation step with a silica-based isolation protocol. In methods B, D, and F, this first phenol–chloroform extraction step reduces the impurities and lowers the viscosity of the aqueous solution that is added in the silica columns. These effects can explain the reduced variation of dsRNA recovery achieved by these methods compared to methods A, C, and E as well as the higher recovery of method D compared to method C. Methods B and D achieved both high recovery and low variation compared to the respective non-modified methods A and C (Table 3). These modifications would presumably be advantageous in cases where higher volumes of RBC, containing higher quantities of impurities, have to be processed. On the other hand, the use of commercial kits without modifications is less time consuming. Therefore, the method of choice for RNA extraction from blood samples depends on the requirements of sample volume and subsequent intended applications following the extraction. Based on the overall performance, the in-house method B, which showed low variation and high recovery rates, was selected to be further evaluated using serial dilutions of RBC, and presented linearity up to the limit of detection. Unfortunately, method F, which showed the highest sensitivity did not exhibit acceptable linearity (Fig. 4), possibly due to the mild PCR inhibition detected that may in turn be attributed to the high volume (1 ml) of extracted RBC, and is therefore not proposed for absolute quantitation protocols using RBC. Methods A and B, developed in-house, were able to detect and quantify BTV at concentrations as low as 104.06 and 104.18 copies/ml RBC, respectively (Table 3). Considering a 101.625 EID50 /ml detection limit for the titration assay with ECE (using 5 replicates per dilution) and the determined overall regression function E{log10 (virus titre by ECE inoculation)} = 2.7 + 1.109{log10 (dsRNA copies by qRT-PCR)}, it is concluded that qRT-PCR using methods A and B is 0.16 and 0.28 log, or 1.45- and 1.91-fold, less sensitive respectively. This means that in order for the qRT-PCR described

314

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315

to be as sensitive as ECE inoculation, the volume of extracted RBC should be increased to 145–191 ␮l, instead of 100 ␮l, with proportionate increase of the lysis buffer and ethanol. This was demonstrated in this study by the fact that one BTV-1 sample examined, taken on day 5 post-infection, was found negative by RT-PCR but positive by ECE inoculation at the limit of detection. When this sample was extracted using 200 ␮l RBC, quantitation was possible by RT-PCR and showed the expected correlation with the virus titre determined by ECE inoculation (data not shown). Efficient RT-PCR detection of BTV and EHDV requires dsRNA denaturation prior to the RT step. DMSO is presently the most widely used additive in PCR reactions for BTV detection (Toussaint et al., 2007; Vandenbussche et al., 2008). It is considered to be the most effective and versatile additive, as opposed to the reference method that is based on the highly toxic methyl mercuric hydroxide (MMOH) (Anthony et al., 2007; OIE, 2008). Both DMSO and MMOH are additives that facilitate denaturation of double-stranded DNA or RNA molecules. Additional additives with similar properties that are also used commonly as enhancers of GC-rich template transcription and amplification are trehalose (Spiess et al., 2004), TMS (Chakrabarti and Schutt, 2002) and betaine (Spiess and Ivell, 2002). The latter reduces secondary structure formation caused by GCrich regions, eliminates base pair composition dependence of DNA thermal melting, and shifts the melting point to lower temperature (Rees et al., 1993; Henke et al., 1997). In this study, qRT-PCR performed best when dsRNA was denatured with betaine, followed by DMSO, TMS and trehalose. Betaine was effective at a broad range of concentrations tested (1.5–3 M) and gave positive amplification results in all replicates of different BTV and EHDV concentrations (Table 2). DMSO and TMS were effective only at the highest concentrations examined, 15% and 1 M respectively. Both additives, as well as trehalose, failed to give positive results in lower concentrations in all the replicates tested, especially for EHDV, while they gave higher Ct values and SDs compared to betaine. Betaine, at 2–2.5 M concentration, is therefore proposed to achieve the highest sensitivity and reduced variation of repeated qRT-PCR measurements for both BTV and EHDV (Table 2). Currently, the standard method for the isolation and titration of BTV in the blood of infected animals is ECE inoculation (OIE, 2008). It has been reported that this method can detect infectious BTV in the blood of infected sheep for a long period that can reach up to 47 or 54 days post-infection (Katz et al., 1993; Hamblin et al., 1998; Koumbati et al., 1999). On the other hand, BTV genomic RNA can be detected by RT-PCR in the blood of infected sheep and calves for at least an additional 30 (in some instances 90) days after the point where the virus cannot be isolated by ECE inoculation (Katz et al., 1993; MacLachlan et al., 1994; Bonneau et al., 2002; OIE, 2008). It has been suggested that erythrocytes harbouring infectious virions have a reduced lifespan or that virus particles associated with erythrocytes gradually lose their infectivity over time (MacLachlan et al., 1994). Unfortunately, real-time PCR detects viral genomes from both infectious and non-infectious viral particles, and does not allow direct conclusions to be drawn regarding the infectious potential of a virus detected in a sample. The duration and level of viraemia as determined by virus isolation remains the most important criterion of vaccine efficiency and this is the first study in which the correlation between the ECE titration method and qRT-PCR was assessed for BTV. Furthermore, this correlation was studied using two BTV serotypes showing a coincident regression line for both viruses up to day 28 post-infection. From this study, the finding that the regression function is common can be used for the assessment of the infectious virus concentration in the blood during that period. Compared to the ECE isolation methods, the optimised qRTPCR method coupled with extraction method B and EHDV IC is rapid, reduces the handling of infectious material, is not vulnerable

to inhibition and can be used as an alternative validated method for the assessment of post-challenge BTV viraemia. However, the qRT-PCR results reflect the animal’s status as an active reservoir of infectious virus only up to day 28 post-infection. After this period, although the EID50 /ml titres decreased, remaining near the limit of ECE detection, the corresponding dsRNA copies/ml values showed high variation and did not decrease proportionately (Fig. 5B). Therefore, the presence of virus specific nucleic acid does not correlate with the presence of an infectious virus during this period. A possible explanation for that could be the fact that the degradation rates of the virion and its dsRNA genome are different. In summary, a number of different RNA extraction methods coupled with a real-time PCR assay were described that provide accurate quantitation of BTV as well as a wide dynamic range and good reproducibility. The RNA extraction methods A, B and D, the inclusion of exogenous dsRNA IC and the optimised dsRNA denaturation step could be adopted for the improvement of existing real-time PCR protocols for BTV detection. Moreover, the ability to quantify accurately virus loads and correlate them with infectious virus titres is useful for experimental studies concerning BTV viraemia, transmission, pathogenesis and evaluation of vaccine efficacy. Finally, the methods suggested may also be adapted for the sensitive detection and quantitation of EHDV, African horse sickness virus (AHSV) or other dsRNA viruses. Acknowledgements This work was carried out as part of the BTVAC project ‘Improved vaccines for Bluetongue Disease’. This project has received research funding from the European Community’s Sixth Framework Programme, Project Number: SSPE-CT-2006-044211. The authors thank Dr. Kyriaki Nomikou and Dr. Olga Mangana (Virus Laboratory, Institute of Infectious and Parasitic Diseases, Ministry of Rural Development and Food, Athens, Greece) for providing the BTV and EHDV strains, Kostas Efthimiou for technical support, and Dr Panayiotis Loukopoulos for reading this manuscript. References Anthony, S., Jones, H., Darpel, K.E., Elliott, H., Maan, S., Samuel, A., Mellor, P.S., Mertens, P.P.C., 2007. A duplex RT-PCR assay for detection of genome segment 7 (VP7 gene) from 24 BTV serotypes. J. Virol. Methods 141, 188–197. Billinis, C., Koumbati, M., Spyrou, V., Nomikou, K., Mangana, O., Panagiotidis, C.A., Papadopoulos, O., 2001. Bluetongue virus diagnosis of clinical cases by a duplex reverse transcription-PCR: a comparison with conventional methods. J. Virol. Methods 98, 77–89. Bonneau, K.R., DeMaula, C.D., Mullens, B.A., MacLachlan, N.J., 2002. Duration of viraemia infectious to Culicoides sonorensis in bluetongue virus-infected cattle and sheep. Vet. Microbiol. 88, 115–125. Boone, J.D., Balasuriya, U.B., Karaca, K., Audonnet, J.C., Yao, J., He, L., Nordgren, R., Monaco, F., Savini, G., Gardner, I.A., MacLachlan, N.J., 2007. Recombinant canarypox virus vaccine co-expressing genes encoding the VP2 and VP5 outer capsid proteins of bluetongue virus induces high level protection in sheep. Vaccine 25, 672–678. Borodina, T., Lehrach, H., Soldator, A., 2003. DNA purification on homemade silica spin-columns. Anal. Biochem. 321, 135–137. Bréard, E., Sailleau, C., Coupier, H., Mure-Ravaud, K., Hammoumi, S., Gicquel, B., Hamblin, C., Dubourget, P., Zientara, S., 2003. Comparison of genome segments 2, 7 and 10 of bluetongue viruses serotype 2 for differentiation between field isolates and the vaccine strain. Vet. Res. 34, 777–789. Chakrabarti, R., Schutt, C.E., 2002. Novel sulfoxides facilitate GC-rich template amplification. Biotechniques 32, 866–874. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid quanidinium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Chomczynski, P., Sacchi, N., 2006. The single-step method of RNA isolation by acid guanidinium thiocyanate–phenol–chloroform extraction: twenty-something years on. Nat. Protoc. 1, 581–585. Clavijo, A., Heckert, R.A., Dulac, G.C., Afshar, A., 2000. Isolation and identification of bluetongue virus. J. Virol. Methods 87, 13–23. Conraths, F.J., Gethmann, J.M., Staubach, C., Mettenleiter, T.C., Beer, M., Hoffmann, B., 2009. Epidemiology of bluetongue virus serotype 8, Germany. Emerg. Infect. Dis. 15, 433–435.

E. Chatzinasiou et al. / Journal of Virological Methods 169 (2010) 305–315 De Clercq, K., Mertens, P., De Leeuw, I., Oura, C., Houdart, P., Potgieter, A.C., Maan, S., Hooyberghs, J., Batten, C., Vandemeulebroucke, E., Wright, I.M., Maan, N., Riocreux, F., Sanders, A., Vanderstede, Y., Nomikou, K., Raemaekers, M., Bin-Tarif, A., Shaw, A., Henstock, M., Bréard, E., Dubois, E., Gastaldi-Thiéry, C., Zientara, S., Verheyden, B., Vandenbussche, F., 2009. Emergence of bluetongue serotypes in Europe, Part 2: The occurrence of a BTV-11 strain in Belgium. Transbound. Emerg. Dis. 59, 355–361. Dovas, C.I., Papanastassopoulou, M., Georgiadis, M.P., Chatzinasiou, E., Maliogka, V.I., Georgiades, G.K., 2010. Detection and quantification of infectious avian influenza A (H5N1) virus in environmental water using real-time RT-PCR. Appl. Environ. Microbiol. 76, 2165–2174. Elia, G., Savini, G., Decaro, N., Martella, V., Teodori, L., Casaccia, C., Gialleonardo, L., Lorusso, E., Caporale, C., Buonavoglia, C., 2008. Use of real-time PCR as a rapid molecular approach for differentiation of field and vaccine strains of bluetongue virus serotypes 2 and 9. Mol. Cell. Probes 22, 38–46. Eschbaumer, M., Hoffmann, B., Moss, A., Savini, G., Leone, A., König, P., Zemke, J., Conraths, F., Beer, M., 2010. Emergence of bluetongue virus serotype 6 in EuropeGerman field data and experimental infection of cattle. Vet. Microbiol. 143, 189–195. Franchi, P., Mercante, M.T., Ronchi, G.F., Armillotta, G., Ulisse, S., Molini, U., Di Ventura, M., 2008. Laboratory tests for evaluating the level of attenuation of bluetongue virus. J. Virol. Methods 153, 263–265. Goldsmit, L., Barzilai, E., 1968. An improved method for the isolation and identification of bluetongue virus by intravenous inoculation of embryonating chicken eggs. J. Comp. Path. 78, 477–487. Hamblin, C., Salt, J.S., Graham, S.D., Hopwood, K., Wade-Evans, A.M., 1998. Bluetongue virus serotypes 1 and 3 infection in Poll Dorset sheep. Aust. Vet. J. 76, 622–629. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S.A., 1997. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957–3958. Hofmann, M.A., Renzullo, S., Mader, M., Chaignat, V., Worwa, G., Thuer, B., 2008. Genetic characterization of Toggenburg orbivirus, a new bluetongue virus, from goats, Switzerland. Emerg. Infect. Dis. 12, 1855–1861. Jiménez-Clavero, M.A., Agüero, M., San Miguel, E., Mayoral, T., López, M.C., Ruano, M.J., Romero, E., Monaco, F., Polci, A., Savini, G., Gómez-Tejedor, C., 2006. High throughput detection of bluetongue virus by a new real-time fluorogenic reverse transcription-polymerase chain reaction: application on clinical samples from current Mediterranean outbreaks. J. Vet. Diagn. Invest. 18, 7–17. Katz, J.B., Gustafson, G.A., Alstad, A.D., Moser, K.M., 1993. Colorimetric diagnosis of prolonged bluetongue viremia in sheep, using an enzyme linked oligonucleotide sorbent assay of amplified viral nucleic acids. Am. J. Vet. Res. 54, 2021–2026. Koumbati, M., Mangana, O., Nomikou, K., Mellor, P.S., Papadopoulos, O., 1999. Duration of bluetongue viraemia and serological responses in experimentally infected European breeds of sheep and goats. Vet. Microbiol. 64, 277–285. Maan, S., Rao, S., Maan, N.S., Anthony, S.J., Attoui, H., Samuel, A.R., Mertens, P.P.C., 2007. Rapid cDNA synthesis and sequencing techniques for the genetic study of bluetongue and other dsRNA viruses. J. Virol. Methods 143, 132–139. Maan, S., Maan, N.S., Ross-Smith, N., Batten, C.A., Shaw, A.E., Anthony, S.J., Samuel, A.R., Darpel, K.E., Veronesi, E., Oura, C.A.L., Singh, K.P., Nomikou, K., Potgieter, A.C., Attoui, H., Rooij, E., Rijn, P., De Clercq, K., Vandenbussche, F., Zientara, S., Bréard, E., Sailleau, C., Beer, M., Hoffman, B., Mellor, P.S., Mertens, P.P.C., 2008. Sequence analysis of bluetongue virus serotype 8 from the Netherlands 2006 and comparison to other European strains. Virology 377, 308–318. MacLachlan, N.J., Nunamaker, R.A., Katz, J.B., Sawyer, M.M., Akita, G.Y., Osburn, B.I., Tabachnick, W.J., 1994. Detection of bluetongue virus in the blood of inoculated calves: comparison of virus isolation, PCR assay, and in vitro feeding of Culicoides variipennis. Arch. Virol. 136, 1–8. Mellor, P., Carpenter, S., Harrup, L., Baylis, M., Wilson, A., Mertens, P.P.C., 2009. Bluetongue in Europe and the Mediterranean Basin. In: Mellor, P., Baylis, M., Mertens, P. (Eds.), Bluetongue. Academic Press, Paris, pp. 233–264. Mertens, P.P.C., Brown, F., Sangar, D.V., 1984. Assignment of the genome segments of Bluetongue virus type 1 to the proteins which they encode. Virology 135, 207–217. Mertens, P.P.C., Maan, M.N., Prasad, G., Samuel, A.R., Shaw, A.E., Potgieter, A.C., Anthony, S.J., Maan, S., 2007. Design of primers and use of RT-PCR assays for typing European bluetongue virus isolates: differentiation of field and vaccine strains. J. Gen. Virol. 88, 2811–2823. Mohammed, M.E., Mellor, P.S., 1990. Further studies on bluetongue and bluetonguerelated Orbiviruses in the Sudan. Epidemiol. Infect. 105, 619–632. Mohammed, M.E.H., Aradaid, I.E., Mukhtar, M.M., Ghalib, H.W., Riemann, H.P., Oyejide, O., Osburn, B.I., 1996. Application of molecular biological techniques for detection of epizootic haemorrhagic disease virus (EHDV-318) recovered from a sentinel calf in central Sudan. Vet. Microbiol. 52, 201–208. Neter, J., Wasserman, W., Kutner, M.H., 1990. Applied Linear Statistical Models. Regression Analysis of Variance and Experimental Designs, 3rd Edition. IRWIN, IL.

315

Nikolakaki, S.V., Nomikou, K., Koumbati, M., Mangana, O., Papanastasopoulou, M., Mertens, P.P.C., Papadopoulos, O., 2005. Molecular analysis of the NS3/NS3A gene of Bluetongue virus isolates from the 1979 and 1998–2001 epizootics in Greece and their segregation into two distinct groups. Virus Res. 114, 6–14. Noad, R., Roy, P., 2009. Bluetongue vaccines. Vaccine 27, D86–D89. Nomikou, K., Dovas, C.I., Maan, S., Anthony, S.J., Samuel, A.R., Papanastasopoulou, M., Maan, N., Mangana, O., Mertens, P.P.C., 2009. Evolution and phylogenetic analysis of full-length VP3 genes of Eastern Mediterranean bluetongue virus isolates. Plos One 4, e6437 (1–12). OIE, 2008. Bluetongue. OIE Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, 6th Edition. Office International des Épizooties, Paris, Chapter 2.1.3. Orrù, G., Ferrando, M.L., Meloni, M., Liciardi, M., Savini, G., Santis, P., De Santis, P., 2006. Rapid detection and quantitation of Bluetongue virus (BTV) using a Molecular Beacon fluorescent probe assay. J. Virol. Methods 137, 34–42. Rasool, N.B.G., Monroe, S.S., Glass, R.I., 2002. Determination of a universal nucleic acid extraction procedure for PCR detection of gastroenteritis viruses in faecal specimens. J. Virol. Methods 100, 1–16. Reed, L.J., Muench, H., 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27, 493–497. Rees, W.A., Yager, T.D., Korte, J., von Hippel, P.H., 1993. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry 32, 137– 144. Savini, G., MacLachlan, N.J., Sanchez-Vizcaino, J.M., Zientara, S., 2008. Vaccines against bluetongue in Europe. Com. Immunol. Microbiol. Infect. Dis. 31, 101– 120. Shaw, A.E., Monaghan, P., Alpar, H.O., Anthony, S., Darpel, K.E., Batten, C.A., Guercio, A., Alimena, G., Vitale, M., Bankowska, K., Carpenter, S., Jones, H., Oura, C.A.L., King, D.P., Elliott, H., Mellor, P.S., Mertens, P.P.C., 2007. Development and initial evaluation of a real-time RT-PCR assay to detect bluetongue virus genome segment 1. J. Virol. Methods 145, 115–126. Spiess, A.N., Ivell, R., 2002. A highly efficient method for long-chain cDNA synthesis using trehalose and betaine. Anal. Biochem. 301, 168–174. Spiess, A.N., Mueller, N., Ivell, R., 2004. Trehalose is a potent PCR enhancer: lowering of DNA melting temperature and thermal stabilization of Taq polymerase by the disaccharide trehaslose. Clin. Chem. 50, 1256–1259. Stewart, M., Bhatia, Y., Athmaran, T.N., Noad, R., Gastaldi, C., Dubois, E., Russo, P., Thiéry, R., Sailleau, C., Bréard, E., Zientara, S., Roy, P., 2010. Validation of a novel approach for the rapid production of immunogenic virus-like particles for bluetongue virus. Vaccine 28, 3047–3054. Toussaint, J.F., Sailleau, C., Bréard, E., Zientara, S., De Clercq, K., 2007. Bluetongue virus detection by two real-time RT-qRT-PCRs targeting two different genomic segments. J. Virol. Methods 140, 115–123. Vanbinst, T., Vandenbussche, F., Vandemeulebroucke, E., De Leeuw, I., Deblauwe, I., De Deken, G., Madder, M., Haubruge, E., Losson, B., De Clercq, K., 2009. Bluetongue virus detection by real-time RT-PCR in Culicoides captured during the 2006 epizootic in Belgium and development of an internal control. Transbound. Emerg. Dis. 56, 170–177. Vandenbussche, F., Vanbinst, T., Verheyden, B., Van Dessel, W., Demeestere, L., Houdart, P., Bertels, G., Praet, N., Berkvens, D., Mintiens, K., Goris, N., De Clercq, K., 2008. Evaluation of antibody-ELISA and real-time RT-PCR for the diagnosis and profiling of bluetongue virus serotype 8 during the epidemic in Belgium in 2006. Vet. Microbiol. 129, 15–27. Vandenbussche, F., De Leeuw, I., Vandemeulebroucke, E., De Clercq, K., 2009. Emergence of bluetongue serotypes in Europe, Part 1: Description and validation of four real-time PCR assays for the serotyping of bluetongue viruses BTV-1, BTV-6, BTV-8 and BTV-11. Transbound. Emerg. Dis. 56, 346–354. Veronesi, E., Darpel, K.E., Hamblin, C., Carpenter, S., Takamatsu, H.H., Anthony, S.J., Elliott, H., Mertens, P.P.C., Mellor, P.S., 2009. Viraemia and clinical disease in Dorset Poll sheep following vaccination with live attenuated bluetongue virus vaccines serotypes 16 and 4. Vaccine 28, 1397–1403. Verwoerd, D.W., Erasmus, B.J., 2004. Bluetongue. In: Tustin, R.C., Coetzer, J.A. (Eds.), Infectious Diseases of Livestock. Oxford University Press, Cape Town, pp. 1201–1220. Walton, T.E., 2004. The history of bluetongue and a global overview. Vet. Ital. 40 (3), 31–38. Wechsler, S.L., McHolland, L.E., 1988. Susceptibilities of 14 cell lines to bluetongue virus infection. J. Clin. Microbiol. 26, 2324–2327. Wechsler, S.L., Luedke, A.J., 1991. Detection of bluetongue virus by using bovine endothelial cells and embryonated chicken eggs. J. Clin. Microbiol. 29, 212–214. White, L.A., 1987. Suspeptibility of Aedes albopictus C6/36 cells to viral infection. J. Clin. Microbiol. 25, 1221–1224. Zientara, S., Sailleau, C., Dauphin, G., Roquier, C., Rémond, E.M., Lebreton, F., Hammoumi, S., Dubois, E., Agier, C., Merle, G., Bréard, E., 2002. Identification of bluetongue virus serotype 2 (Corsican strain) by reverse-transcriptase PCR reaction analysis of segment 2 of the genome. Vet. Rec. 150, 598–601.