- Email: [email protected]
Assessment of population genetic diversity of Derris elliptica (Fabaceae) in China using microsatellite markers
Industrial Crops and Products 73 (2015) 9–15
Contents lists available at ScienceDirect
Industrial Crops and Products journal homepage: www.elsevier.com/locate/indcrop
Assessment of population genetic diversity of Derris elliptica (Fabaceae) in China using microsatellite markers He Li, Shilei Geng ∗ College of Life Sciences, South China Agricultural University, Guangzhou 510642, China
a r t i c l e
i n f o
Article history: Received 12 December 2014 Received in revised form 6 March 2015 Accepted 13 April 2015 Keywords: Genetic diversity Microsatellite markers Population differentiation Derris elliptica
a b s t r a c t Derris elliptica (Fabaceae) is one of the most important sources of the insecticide rotenone. This plant was first introduced from different Southeast Asian countries to China in the early decades of last century. The purpose of this study is to assess genetic diversity of D. elliptica in China for the conservation of its germplasm resources and for future breeding programs. Genetic diversity and population structure of 14 cultivated populations of D. elliptica in China were detected using 25 microsatellite markers. A moderate level of genetic diversity was found across the whole sample (expected heterozygosity, He = 0.529), indicating a history of multiple sources of introduction and a broad genetic base for the crop cultivated by cuttings. The genetic diversity at the population level (Mean He = 0.31) was relatively lower. Repeated bottlenecks or founder effects in its short cultivated history and also its vegetative reproduction mode may explain the results. FST (Wright F-statistic) values and AMOVA (analysis of the molecular variance) indicated large genetic differentiation among populations (FST = 0.461; 44.1%, AMOVA), while the cluster analysis showed that the collections belong to two major groups of genotypes. The initial difference in the introduced germplasm from the primary center of origin and the limited gene flows among populations may have played important roles in shaping the genetic variation pattern in D. elliptica of China. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Derris elliptica (Wall.) Benth. (Fabaceae) is commonly used in traditional medicine (Sukrong et al., 2006). Juice from its stems and roots is used as an insecticide (Andrea et al., 2007), molluscicide (Dos Santos and Sant’Ana, 2000) and fish poison (Lu et al., 2008). Some other bioactive properties, such as antifungal (Fang et al., 2010), antihypertension effect (Dos Santos and Sant’Ana, 2000) and antitumor activity (Chun et al., 2003) have also been confirmed. The plant is mainly cultivated in the tropics for its roots, a source of the botanical insecticide rotenone (Andrea et al., 2007; Lu et al., 2008; Wu et al., 2012b). In China, D. elliptica was introduced from different Southeast Asian countries beginning in the early decades of the last century (Li and Wang, 2010), and was mainly cultivated in Guangdong and Guangxi Provinces as a raw material for the commercial manufacture of rotenone. However, due to the wide use of chemical insecticides since the 1970s, its cultivation has drastically declined and some cultivars have gradually assumed a semi-wild status (The plant was cultivated as a crop many years ago, but grow naturally near a farmland or orchard now) in China. At present, with the
∗ Corresponding author. Tel.: +86 20 85280193; fax: +86 20 85282180. E-mail address: [email protected] (S. Geng). http://dx.doi.org/10.1016/j.indcrop.2015.04.023 0926-6690/© 2015 Elsevier B.V. All rights reserved.
market for botanical insecticides gradually expanding due to food safety requirements, the need for rotenone has increased markedly. Developing genetic materials with higher rotenone content and productivity is imperative for D. elliptica. Thus, characterization of genetic diversity in D. elliptica cultivated populations is required, not only for conserving its genetic diversity but also for future breeding programs. D. elliptica is a woody vine distributed in some Southeast Asian countries, such as Cambodia, India, Indonesia, Laos, Malaysia, Philippines, Thailand, and Vietnam (Chen et al., 2006; Wu et al., 2012b). In their native range, the plants can produce flowers and fruits every year, and are propagated naturally by seeds. Unfortunately, information about their pollination and seed dispersal is limited up to now. However, in their introduced range of China, the plants rarely flower and set fruit. When the plants were cultivated in plantations for three to five years, they were usually harvested for the juice of the stems and roots, and propagated vegetatively by cuttings for the next generations. Under the reproduction mode with generations to generations, these cultivated populations have been suffering from decrease in genetic diversity since they were introduced in China from their native range. On the contrary, those populations in semi-wild status may have maintained higher level of genetic diversity than the cultivated populations, due to the lacking of effective individual renewal in populations. In such
10
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
Fig. 1. The locations of the 14 cultivated populations of D. elliptica. Population abbreviations are given in Table 1.
populations, individual reproductions by nature seeds or by artificial cuttings were limited, the chance for breeding the next generation was rare. In recent years, reports about the genetic diversity and relationships in some Derris spp. using molecular markers have increased. DNA fingerprinting of seven Derris species including D. elliptica was successively performed using random amplified polymorphic DNA (Jena et al., 2004; Sukrong et al., 2006). Genetic diversity in 31 mangroves species including two Derris species was assessed through random amplified polymorphic DNA and amplified fragment length polymorphism (Mukherjee et al., 2006). Genetic variation of D. trifoliata was detected by inter-simple sequence repeat (ISSR) (Wu et al., 2012a). However, there have been few studies of the genetic diversity of Derris species using microsatellite markers. In this paper, we assessed the genetic diversity of cultivated D. elliptica populations in China using microsatellite markers developed in our previous research (Li and Geng, 2013). Genetic variation within and among populations was explored to provide crucial information for establishing a strategy for the conservation of germplasm resources and future breeding programs in D. elliptica. 2. Materials and methods 2.1. Plant materials A total of 210 individuals of D. elliptica were collected from 14 geographical populations in Guangdong Province, China (Fig. 1 and Table 1). Eight populations (DP, FS1, FS2, FS3, JL, JY, ST and WH)
were collected from the eastern region, three populations (HZ, SG and ZS) from the central region, and three populations (MM, YF and YJ) from the western region of Guangdong Province. Leaf materials were collected from 6 to 30 randomly selected individuals in each population at intervals of at least 10 m and stored with silica gel in zip-lock plastic bags until DNA isolation. 2.2. DNA extraction and microsatellite amplification Total genomic DNA was extracted from leaf tissues using a modified cetyltrimethyl ammonium bromide (CTAB) method (Doyle and Doyle, 1987). The quality and concentration of DNA extracted were checked by electrophoresis on 1% agarose gels and spectrophotometry. DNA samples were diluted to 50 ng/l and stored at –20 ◦ C. All samples were analyzed using 25 microsatellite primers (Table 2) that were previously reported to be highly polymorphic (Li and Geng, 2013). Polymerase chain reaction (PCR) was carried out in 20 l of total volume containing 1 l of genomic DNA (50 ng/l), 0.2 l of each forward and reverse primers (100 pmol/l), 2 l of 10 × PCR buffer (RealTimer, Beijing, China), 1.6 l of dNTP (2.5 mM) and 0.2 l of Taq DNA polymerase (TaKaRa, Dalian, China; 5 U/l). PCR was performed in a Bio-Rad MyCycler Peltier thermal cycler. PCR cycling conditions were as follows: after 5 min at 94 ◦ C, 35 cycles were carried out with 30 s at 94 ◦ C, 30 s at 50–60 ◦ C (depending on the primers), and 30 s at 72 ◦ C, with final extension at 72 ◦ C for 8 min. PCR products were separated on 8% denaturing polyacrylamide gel using DL500 marker (TaKaRa, Dalian, China) as size standards.
Table 1 Derris elliptica populations evaluated from Guangdong Province. The sample size and geographical location are listed. Region
Population
Abbreviation
Geographical coordinate
Sample size
Eastern
Dapu Fengshun-1 Fengshun-2 Fengshun-3 Jiaoling Jieyang Shantou Wuhua Huizhou Shaoguan Zhongshan Maoming Yunfu Yangjiang
DP FS1 FS2 FS3 JL JY ST WH HZ SG ZS MM YF YJ
24◦ 39 23◦ 74 23◦ 41 23◦ 39 24◦ 39 23◦ 30 23◦ 26 23◦ 47 22◦ 58 24◦ 21 22◦ 17 22◦ 24 22◦ 40 21◦ 35
11 30 15 30 10 30 10 12 12 7 6 10 21 6
Central
Western
Mean Total
N, 116◦ 47 N, 116◦ 18 N, 116◦ 08 N, 116◦ 07 N, 116◦ 14 N, 116◦ 17 N, 116◦ 59 N, 115◦ 27 N, 114◦ 14 N, 113◦ 59 N, 113◦ 24 N, 110◦ 53 N, 111◦ 54 N, 111◦ 51
E E E E E E E E E E E E E E
15 210
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
11
Table 2 List of microsatellite loci used. Locus
Forward primer (5 –3 )
Reverse primers (5 –3 )
Ta (◦ C)a
DE01 DE02 DE03 DE04 DE05 DE08 DE09 DE10 DE11 DE12 DE16 DE18 DE22 DE23 DE25 DE27 DE28 DE30 DE31 DE32 DE33 DE34 DE35 DE36 DE37
F: CTTTGATGCTTCCTACTT F: CATAGGGTTAGAATCCGTTGA F: CTAACGCAAGTATTTATG F: TCCTGCTCCATCAAGTCATC F:TTGTGCAGTATGGGTTAGAG F: GTTGGCAATACCATTTCATC F: CATAGGTGGTAAGCATAGAA F: GTGTTCATAGTCTAGCAGTT F: AGTATTTGGGCCAGAGGGTT F: CAACTAAGTAACGAAATCAGA F: GGTTCACCCCTTTCCCTC F: CTAACCACTTACTTATCTTT F: ATTTCATCCGTGATTCCAGA F: ATCAAACACGCTACTCAG F: TCCCCAAGACAAGAGCAACT F: TTTGCGAAACTCTGTACTTG F: GCATTGATTTGGTTTATTTG F: TGGCTTCAAAACGCATCACT F: GGTTTTCTACTTTTCTTTCA F:AGAACAAACAAGCCTTAGCAG F:ATAAAGCCCAGGTATGTAG F:GTCGCCAGCACTGACATAA F:CATGGAGTCGGTAGCAAA F:GGAAGAAGAAAAATGAAACCC F:ATAGAACTTGGCCAAATTAGA
R:ATTTCTACTCCTGTTTGG R: GATCGCGTCGCTGGTAAA R: GAGCTGCTAGTTTGTATT R: CTTTCCAGCCACTTCCCTTT R:GCTTCCTTCCTTACCTTTGA R: CTTCCTAATTCGTCCAGTCA R: TACCCTCACATTCATACATC R: CTCCCATATTTTCAGTAC R: TGGTAGTGAAGTCTTGAGGG R: TTACATACCCAATAGTTCACC R: CTTCAAAACGCATCACTA R: GACAGCATCATCATCTACAG R: ATTGTCAAGACCAAGAGTAT R: GTCAAGTGATGGTAGGAGGT R: TTAAAACGCCAAAAGGAATT R: GAGGATTTGACGGTGAGG R: CGGTTTAGGATGCCAGTA R: GTTCACCCCTTTCCCTCT R: ATGGGACAACTCATAGGTAC R:TAACCAAACCAACTCAACGAC R:AAGTTTGACTGAGAGAGGA R:CTTCGTTCATCACACACCA R:GAGAAAACTGGAAGAAGAG R:CCCTCAGAAATATGAAAACAC R:GACTCTCAGCATAGTGATTAC
54 60 50 58 58 55 55 50 60 58 54 54 50 59 54 55 57 62 50 56 54 56 54 56 52
Electrophoresis was conducted for 3 h at 80 W. After electrophoresis, PCR products were visualized by silver staining (Bassam et al., 1991). Negative controls, in which template DNA was replaced with ddH2 O in a PCR reaction, were included with each PCR run to verify that the samples were not contaminated. 2.3. Data analysis DNA banding patterns generated by the markers were scored for the presence (1) or the absence (0) of each amplified bands. Alleles were alphabetically coded (e.g., A, B and C for each band) in decreasing size order. Samples with single bands were assumed to be homozygous. In order to estimate the genetic diversity within and among populations, we calculated the number of distinct genotypes detected per population (G) as well as the genotypic richness (R), R = (G – 1)/(N – 1), which varies from 0 when all N plants in a population possess the same genotype, to 1.0, when all plants possess a different genotype. The observed proportion of asexual propagation (Rate of clonal reproduction, AR) in populations was calculated as 1–(G / N), where G is the number of different genotypes and N the number of individuals (Dorken and Eckert, 2001). The allelic richness (AR) was calculated using the software FSTAT 2.9.3.2 (Goudet, 2002). The effective number of alleles (Ne), the observed heterozygosity (Ho ), the expected heterozygosity (He ) and Shannon Information index (I) were calculated using POPGENE 32 (Yeh and Boyle, 1997). Wright F-statistic (FST) was used to estimate the variance among the populations using 1000 times permutation of the genotypes. Gene flow (Nm ) or the number of migrants per generation among populations was also estimated by POPGENE 32. The binary dataset was used to calculate the Nei’s genetic distance between the 14 populations using the program POPGENE version 32 (Nei, 1978; Yeh and Boyle, 1997) and a distance matrix was generated. Corresponding cluster analysis was performed based on the Nei’s genetic distances, employing the unweighted pair-group method with arithmetic average (UPGMA) algorithm provided in the computer program NTSYS version 2.10 (Rohlf, 1994). Finally, SAHN module plot of NTSYS was used for plotting the dendrogram and the robustness of the tree was tested using bootstrap analysis (1000 iterations). Hierarchical analysis of the
molecular variance (AMOVA) was performed after 1000 permutations to determine how the genetic diversity was partitioned within and between populations using GenAlEx version 6.3 (Peakall and Smouse, 2006). Principal component analysis (PCA) was also carried out by GenAlEx version 6.3 (Peakall and Smouse, 2006), assessing the diversity relationship among all individuals. Spearman’s correlation analysis was used to assess correlations between the genetic diversity estimates and sample size by using SPSS 11.0 software (D’Amico et al., 2001). A Mantel test was carried out to examine whether the genetic distances between population pairs were linearly related to their geographical distances using GenAlEx version 6.3 (Peakall and Smouse, 2006). 3. Results 3.1. Genetic diversity There were 25 loci detected in the 210 D. elliptica individuals from the 14 cultivated populations using 25 SSR primer pairs. All the loci were polymorphic in all populations. A total of 109 SSR alleles were identified with an average of 4.36 per locus (range of 2–8). The size of the amplified bands was in the range of 100–250 bp. The summary of genetic diversity analyzed for the 14 populations of D. elliptica is given in Table 3. At the species level, there were G = 70, CR = 0.667, R = 0.330, AR = 2.832, Ne = 2.28, He = 0.5286 and I = 0.9367. At population level, there was a wide range of variation: G was in the range of 1–21 with average of 5; CR was in the range of 0–0.960 with average of 0.55; R was in the range of 0.138–1.0 with average of 0.451; AR and Ne per population were in the ranges 1.56–2.682 and 1.280–1.897, respectively; He and Ho for each population were in the range of 0.147–0.446 and 0.280–0.549, with an average of 0.310 and 0.446, respectively; and I had an average of 0.451 and range of 0.194–0.763. Genetic diversity for the YF population was the highest of the 14 populations (R = 1.0, AR = 2.682, Ne = 1.882, He = 0.428, I = 0.763). The lowest genetic diversity was in the JL population (R = 0, AR = 1.282, Ne = 1.28, He = 0.147, I = 0.194). On the contrary, the rate of clonal reproduction for the YF population (0) and the JL population (0.960) was respectively the lowest and the highest of the 14 populations. The results showed that
12
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
Table 3 Genetic variation of the 14 Derris elliptica populations. Populations
Na
Gb
CRc
Rd
ARe
Ne f
He g
Ho h
Ii
FS3 YF FS1 FS2 DP JL MM JY WH SG ST YJ HZ ZS Mean Overall
30 21 30 15 11 25 10 25 12 7 10 6 12 6 15 210
5 21 8 4 7 1 8 5 3 7 3 5 5 4 5 70
0.833 0 0.733 0.733 0.364 0.96 0.2 0.8 0.75 0 0.7 0.167 0.583 0.333 0.551 0.667
0.138 1 0.241 0.214 0.6 0 0.778 0.167 0.182 1 0.222 0.8 0.367 0.6 0.451 0.33
1.570 ± 0.485 2.682 ± 0.764 1.581 ± 0.499 1.560 ± 0.496 1.920 ± 0.823 1.280 ± 0.449 2.233 ± 0.726 1.57 ± 0.508 1.547 ± 0.489 2.094 ± 0.858 1.560 ± 0.496 1.840 ± 0.833 2.160 ± 0.784 1.920 ± 0.688 1.823 2.832 ± 0.629
1.54 1.882 1.559 1.559 1.548 1.28 1.76 1.546 1.512 1.6 1.543 1.52 1.897 1.68 1.602 2.281
0.282 0.428 0.287 0.29 0.278 0.147 0.405 0.282 0.276 0.292 0.29 0.28 0.446 0.353 0.31 0.529
0.534 0.354 0.539 0.549 0.302 0.28 0.39 0.534 0.507 0.326 0.536 0.34 0.54 0.507 0.446 0.462
0.385 0.763 0.394 0.388 0.442 0.194 0.611 0.386 0.365 0.466 0.383 0.414 0.632 0.492 0.451 0.937
a b c d e f g h i
The number of individuals sampled. The number of distinct genotypes detected. Rate of clonal reproduction, CR = 1 – (G / N). A measure of genotypic richness, R = (G – 1)/(N – 1). Allelic richness. Effective number of alleles. Expected heterozygosity. Observed heterozygosity. Shannon information index.
genetic diversity at species level was higher than at population level. There were no significant correlations between the genetic diversity parameters and sample size (r = 0.071, P = 0.810 for G; r = –0.341, P = 0.232 for AR; r = 0.001, P = 0.996 for Ne ; r = –0.026, P = 0.929 for He ; r = 0.301, P = 0.295 for Ho ; and r = –0.032, P = 0.914 for I, Spearman’s correlation test), although the sample size varied among populations (6–30 individuals per population). 3.2. Genetic differentiation The mean FST among the 14 populations of D. elliptica was estimated as 0.461, indicating a relatively high level of overall genetic differentiation. Based on FST , the Nm was 0.292. AMOVA of the microsatellite data also showed significant (P < 0.05) genetic differences among the 14 populations of D. elliptica (Table 4). Of the total genetic diversity, 44.1% resided among populations, and the remainder (55.9%) was within populations (Table 4). When the populations were grouped into three regions (Eastern, Central and Western), hierarchical AMOVA indicated that 24.0% of the total variation was accounted for by differentiation among regions, with a further 26.6% among populations within regions and the remainder (49.4%) partitioned among individuals within populations (Table 4). The results showed significant differences in genetic differentiation among the Eastern, Central and Western regions.
3.3. Genetic relationships among populations To elucidate the genetic relationship among 14 cultivated populations of D. elliptica, cluster analysis (UPGMA) was used to generate a dendrogram based on Nei’s genetic distances. The similarity coefficients among all populations were in the range of 0.4–1.0. The 14 populations were clustered into two main clusters: I and II (Fig. 2). Cluster I was divided into two subclusters: Ia and Ib. HZ and ZS populations were located in subcluster Ib. Subcluster Ia contained JY, ST and the most populations from Meizhou (FS1, FS2, FS3 and WH populations). The six populations were very closely associated with each other (Fig. 2) and their similarity coefficients were very high. For example, the similarity coefficient between JY and ST populations was 1.00. Cluster II consisted of DP, JL, SG, YF, YJ and MM populations. Interestingly, the DP and JL populations from Meizhou were included in this cluster and were genetically more related to SG and YF populations rather than the other populations from Meizhou (which were geographically closer). The Mantel test of data for all 14 populations showed no significant correlation between genetic distances and corresponding geographical distances (r = –0.105, P = 0.614). Genetic relationships among 210 individuals of D. elliptica were also investigated by PCA analysis (Fig. 3). All individuals were mainly gathered into two groups. One group included all individuals from populations located in cluster II. The other group was mainly composed of all individuals from populations located in
Table 4 Analysis of molecular variance (AMOVA) for 210 Derris elliptica individuals from 14 populations using SSR data. Source of variation
d.f.a
SSDb
Variance components
%Totalc
p-value
Geographic location One group Among populations Within populations
13 161
1014.678 1298.602
3.02802 3.84108
44.1 55.9
<0.001 <0.001
Three regions Among regions Among populations within regions Within populations
2 11 161
411.06 603.611 1290.602
1.86524 2.06469 3.84108
24 26.6 49.4
<0.001 <0.001 <0.001
a b c
Degrees of freedom. Sum of squared deviations. The percentage of the total variance.
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
13
Fig. 2. UPGMA dendrogram showing genetic relationships among 14 cultivated populations of D. elliptica using 25 SSR markers. Population abbreviations are given in Table 1.
Fig. 3. Principal Coordinate Analysis (PCA) of all 210 individuals of D. elliptica. The first axis accounts 72.94% of the genetic variation while the second axis 7.89%.
cluster I, and was divided into two subgroups. The results confirmed the UPGMA clustering.
4. Discussion 4.1. Genetic diversity At the species level, there was a moderate level of variation in D. elliptica cultivated in China (Table 3), but the level of variation was relatively higher compared with other cultivated species previously studied using SSR markers, such as bermudagrass (Cynodon dactylon, He = 0.27, I = 0.43) (Wang et al., 2013) and barley (Hordeum vulgare, He = 0.1512) (Hajmansoor et al., 2013). Considering the relatively short history of D. elliptica introduction in China, the results were unexpected. For a newly introduced species, genetic variation within and among populations is determined to some extent by the history of introduction (Kishore et al., 2012). In general, recently introduced species would be expected to experience a series of population bottlenecks and genetic drift during colonization, which would result in reductions in both allelic richness and genetic diversity (Hassel et al., 2005; Ma et al., 2011). Thus, multiple locations from different Southeast Asian countries may have served as sources for the introduction of D. elliptica in China, which gave it a broad genetic base. However, the genetic diversity levels
of cultivated D. elliptica in China were also higher than that in wild D. trifoliata using ISSR markers (PPB = 89.7%, He = 0.3065, I = 0.4571) (Wu et al., 2012a). This may be due to the nature of markers derived from both systems (i.e., SSR and ISSR) (Parvaresh et al., 2012). It is possible that SSR markers are superior for assessing genetic diversity in Derris. At the population level, genetic diversity (He = 0.1474–0.4455) was lower than that at the species level. This result may be because most populations have been subjected to repeated bottlenecks or founder effects in their short cultivated history. Reproduction mode is an important factor affecting population genetic structure, and the low level of genetic variability of most populations may also be related to the reproduction mode of this species (Dong et al., 2006). The plant was cultivated by vegetative propagation in China, which would greatly decrease the genetic diversity and lead to genetic drift in cultivated populations over generations (Piquot et al., 1998 Zhou et al., 2008). Furthermore, clonal propagation in cultivated population may strengthen the trend. The values for R (0–1.0) and for CR (0–0.96) are quite variable among populations, and most populations have a low R value and high CR value, especially for JL where R and CR close to zero and 0.96 respectively. The facts indicate a considerable extent of clonality in the samples. Ho values are higher than He in most populations, again suggesting clonality (multiple ramets of a heterozygous individual will artificially increase Ho above He ). The observed low diversity and
14
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
heterozygosity within most populations and the high FST estimates suggest that genetic drift had a major influence on the study populations (Mengesha et al., 2013). Interestingly, some populations showed a high level of genetic variability, such as the YF population (He = 0.4278), which was in a semi-wild state for a long time. Due to lack of artificial selection and natural reproduction, the semi-wild growing state may have helped retain the genetic variability of this population.
4.2. Genetic structure Based on both FST (FST = 0.4614, p < 0.01) and AMOVA analysis data (44.1%), significant genetic structure was observed among all D. elliptica populations in China. This level of population differentiation is greater than that of some other cultivated species (Ganeva et al., 2010; Keneni et al., 2012; Parvaresh et al., 2012). Reasonable explanations for this phenomenon are as follows: firstly, the genetic dissimilarities among populations analyzed may result from an initial difference in the introduced germplasm from the primary center of origin. All cultivated populations of D. elliptica in China were introduced from different Southeast Asian countries beginning in the early decades of the last century (Li and Wang, 2010). Similar inferences can be drawn from the cluster analysis, in which 14 populations of D. elliptica were clustered into two main clusters I and II, and two subclusters in cluster I. The result implied that the germplasm of D. elliptica in China evolved from different lines of ancestry that separated them into different gene pools (Keneni et al., 2012). Secondly, the high level of differentiation among populations could result from gene flow being limited among populations. In general, gene flow can reduce the genetic differences between populations and increase the genetic variation within populations (Allendorf and Luikart, 2007; Mengesha et al., 2013). In population genetics, the doorstep quantity of a value of gene flow (Nm ) is regarded as 1.0, the values below 1.0 would cause population differentiation (Kishore et al., 2012). In this study, the effective gene flow for D. elliptica (Nm = 0.2919) was much lower than one successful migrant per generation (Kishore et al., 2012; Wang et al., 2008). This extremely low gene flow can facilitate the genetic differentiation among populations. Because D. elliptica rarely flower and set fruit in China, propagation by cutting is the only manner of vegetative propagation for genetic exchange and gene flow between populations. Vegetative propagation is considered unsuited for long-distance dispersal, so successful gene migration would almost only occur locally or between adjacent populations (Zhou et al., 2008). Assuming propagules are always carried away from the donor population and redistributed by farmers, high within population variation should be expected (Dodd et al., 2002; Wu et al., 2012a). However, in our samples, only 55.9 and 49.4% of the genetic variation was attributed to variation within populations for total and regional samples, respectively. The results indicate that propagule dispersal was somewhat restricted among D. elliptica populations in China. Thus, the limited gene flow could be attributed to the vegetative propagation manner and the lack of exchange of planting materials between farmers. This interpretation was supported by the results of the PCoA analysis in which individuals from the same populations were often grouped together, and much less than 210 dots are distinguished in the first two axes of the PCoA (Fig. 3). The observations suggest that there must be many individuals with identical multilocus genotypes. For example, the 10 plants of JL are represented by a single dot in Fig. 3, suggesting that all, or almost all, of the 10 plants are genotypically identical. Likewise, all (>100) plants from populations FS1, FS2, FS3, JY, ST and WH are clustered in a very narrow area in the PCoA, again indicating that many of the samples are genotypically identical. The interpretation was also supported by the results of the Mantel test
that showed no significant relationship between geographical and genetic distances for all 14 populations. 4.3. Implications for breeding program and conservation The rich genetic diversity at the species level of D. elliptica in China provides great value for a breeding program. They could be potentially used to broaden the genetic base of D. elliptica cultivars and could be explored for novel genes to improve economically important traits. Especially the semi-wild populations, such as YF and HZ populations, which had higher genetic diversity than cultivated populations, would have greater value in a breeding program. However, strong and marked genetic differentiation among the observed populations implies the need for management and conservation of D. elliptica germplasm resources in China (Allendorf and Luikart, 2007; Sherwin and Moritz, 2000; Wu et al., 2012a). Each population has a certain conservation value. The magnitude and pattern of genetic diversity shown in the present study should be considered in future germplasm collection and utilization strategies (Keneni et al., 2012). Core collections should be set up, in which a subset of accessions should contain most of the genetic diversity of each population. Acknowledgements The authors wish to thank the Science and Technology Planning Project of Guangdong Province (No. 2010B020303007) and the 211 Project of South China Agriculture University for financial support. We also gratefully acknowledge Professor Feipeng Chen (College of Life Sciences, South China Agricultural University) for collecting samples, Professor Gang Hao (College of Life Sciences, South China Agricultural University) for support in supply of instruments, and Dr. Wei Gong, Dr. Zhizhan Chu Quan Chen, Siyin Tao and Peiran Li (College of Life Sciences, South China Agriculture University) for technical assistance. References Allendorf, F.W., Luikart, G., 2007. Conservation and the Genetics of Populations. Blackwell Publishing, Malden, pp. 641–$9. Andrea, A.D., Aliboni, A., De Santis, A., Mariani, S., Gorgoglione, D., Ritieni, A., 2007. SFE of Derris elliptica (Wallich) Benth. roots: influence of process parameters on yield and purity of rotenone. J. Supercrit. Fluids 42, 330–333. Bassam, B.J., Caetano-Anolles, G., Gresshoff, P.M., 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem. 196, 80–83. Chen, T., Chen, P., Fang, Y., Zheng, C., Chang, R., Ding, C., Li, J., Ma, C., Wei, Z., 2006. Leguminosae. In: Editorial Committee of Flora of China (Ed.), Flora of China. Science Press, Beijing, pp. 207–208. Chun, K.H., Kosmeder, J.W., Sun, S.H., Pezzuto, J.M., Lotan, R., Hong, W.K., Lee, H.Y., 2003. Effects of deguelin on the phosphatidylinositol 3-kinase/Akt pathway and apoptosis in premalignant human bronchial epithelial cells. J. Nat. Cancer Inst. 95, 291–302. D’Amico, E.J., Neilands, T.B., Zambarano, R., 2001. Power analysis for multivariate and repeated measures designs: a flexible approach using the SPSS MANOVA procedure. Beh. Res. Methods Inst. Comput. 33, 479–484. Dorken, M.E., Eckert, C.G., 2001. Severely reduced sexual reproduction in northern populations of a clonal plant, Decodon verticillatus (Lythraceae). J. Ecol. 89, 339–350. Dodd, R.S., Afzal-Rafii, Z., Kashani, N., Budrick, J., 2002. Land barriers and open oceans: effects on gene diversity and population structure in Avicennia germinans L. (Avicenniaceae). Mol. Ecol. 11, 1327–1338. Dong, M., Lu, B.R., Zhang, H.B., Chen, J.K., Li, B., 2006. Role of sexual reproduction in the spread of an invasive clonal plant Solidago canadensis revealed using intersimple sequence repeat markers. Plant Spec. Biol. 21, 13–18. Dos Santos, A.F., Sant’Ana, A.E., 2000. The molluscicidal activity of plants used in Brazilian folk medicine. Phytomed. Inter. J. Phytother. Phytophar. 6, 431–438. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phyt. Bull. 15, 11–15. Fang, Y., Li, L., Hao, S., Lan, X., Shi, G., 2010. Antifungal and antitumor constituents in Derris elliptica (Roxb.) Benth. waste. Agrochemicals, 874–875+884 (In Chinese with English abstract). Ganeva, G., Korzun, V., Landjeva, S., Popova, Z., Christov, N.K., 2010. Genetic diversity assessment of Bulgarian durum wheat (Triticum durum Desf.)
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15 landraces and modern cultivars using microsatellite markers. Genet. Resour. Crop Evol. 57, 273–285. Goudet, J., 2002. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3.2). Free available at . Hajmansoor, S., Bihamta, M.R., Alisoltani, A., 2013. Genetic diversity among and within Iranian and non-Iranian barely (Hordeum vulgare L.) genotypes using SSR and storage proteins markers. Biochem. Syst. Ecol. 46, 7–17. Hassel, K., Sastad, S.M., Gunnarsson, U., Soderstrom, L., 2005. Genetic variation and structure in the expanding moss Pogonatum dentatum (Polytrichaceae) in its area of origin and in a recently colonized area. Am. J. Bot. 92, 1684–1690. Jena, S., Sahoo, P., Mohanty, S., Das, A.B., 2004. Identification of RAPD markers, in situ DNA content and structural chromosomal diversity in some legumes of the mangrove flora of Orissa. Genetica 122, 217–226. Keneni, G., Bekele, E., Imtiaz, M., Dagne, K., Getu, E., Assefa, F., 2012. Genetic diversity and population structure of Ethiopian chickpea (Cicer arietinum L.) germplasm accessions from different geographical origins as revealed by microsatellite markers. Plant Mol. Biol. Rep. 30, 654–665. Kishore, G., Gupta, S., Pandey, A., 2012. Assessment of population genetic diversity of Fagopyrum tataricum using SSR molecular marker. Biochem. Syst. Ecol. 43, 32–41. Li, H., Geng, S., 2013. Development and characterization of microsatellite markers for Derris elliptica (Fabaceae), an insecticide-producing plant. Sci. Hortic. 154, 54–60. Li, Y., Wang, Z., 2010. The application and analisis progress of rotenone. Guangxi J. Light Indus. 11, 9–10 (In Chinese with English abstract). Lu, H.Y., Liang, J.Y., Yu, P., Qu, W., Zhao, L., 2008. Two new rotenoids from the root of Derris elliptica. Chin. Chem. Lett. 19, 1218–1220. Ma, J.W., Geng, S.L., Wang, S.B., Zhang, G.L., Fu, W.D., Shu, B., 2011. Genetic diversity of the newly invasive weed Flaveria bidentis (Asteraceae) reveals consequences of its rapid range expansion in northern China. Weed Res. 51, 363–372. Mengesha, W.A., Demissew, S., Fay, M.F., Smith, R.J., Nordal, I., Wilkin, P., 2013. Genetic diversity and population structure of Guinea yams and their wild relatives in South and South West Ethiopia as revealed by microsatellite markers. Genet. Resour. Crop Evol. 60, 529–541.
15
Mukherjee, A.K., Acharya, L., Panda, P.C., Mohapatra, T., 2006. Assessment of genetic diversity in 31 species of mangroves and their associates through RAPD and AFLP markers. J. Biosci. 61, 413–420. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Parvaresh, M., Talebi, M., Sayed-Tabatabaei, B.-E., 2012. Molecular diversity and genetic relationship of pomegranate (Punica granatum L.) genotypes using microsatellite markers. Sci. Hortic. 138, 244–252. Peakall, R., Smouse, P.E., 2006. GENALEX 6: genetic analysis in Excel: Population genetic software for teaching and research. Mol. Ecol. Not. 6, 288–295. Piquot, Y., Petit, D., Valero, M., Cuguen, J., De Laguerie, P., Vernet, P., 1998. Variation in sexual and asexual reproduction among young and old populations of the perennial macrophyte Sparganium erectum. Oikos 82, 139–148. Rohlf, F.J., 1994. Ntsys-pc: Numerical Taxonomy and Multivariate Analysis System. Exeter Software, New York. Sherwin, W.B., Moritz, C., 2000. Managing and monitoring genetic erosion. Conserv. Biol. Ser. 4, 9–34. Sukrong, S., Phadungcharoen, T., Ruangrungsi, N., 2006. DNA fingerprinting of medicinally used Derris species by RAPD molecular markers. Planta Med. 72, 1031. Wang, T., Su, Y., Chen, G., 2008. Population genetic variation and structure of the invasive weed Mikania micrantha in southern China: consequences of rapid range expansion. J. Hered. 99, 22–33. Wang, Z., Liao, L., Yuan, X., Guo, H., Guo, A., Liu, J., 2013. Genetic diversity analysis of Cynodon dactylon (bermudagrass) accessions and cultivars from different countries based on ISSR and SSR markers. Biochem. Syst. Ecol. 46, 108–115. Wu, B., Geng, S., Shu, B., 2012a. Genetic variation and the conservation of isolated populations of Derris trifoliata (Leguminosae) a mangrove-associated vine in southern China. Biochem. Syst. Ecol. 40, 118–125. Wu, X., Song, Z., Xu, H., Zhang, H., Chen, W., Liu, H., 2012b. Chemical constituents of the aerial part of Derris elliptica. Fitoterapia 83, 732–736. Yeh, F.C., Boyle, T.J.B., 1997. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Bel. J. Bot. 129, 157. Zhou, H., Chen, J., Zhang, S., 2008. Genetic and clonal diversity of Globba racemosa, a herb with a mixed reproductive mode. Zhiwu Shengtai Xuebao 32, 751–759 (In Chinese with English abstract).
Contents lists available at ScienceDirect
Industrial Crops and Products journal homepage: www.elsevier.com/locate/indcrop
Assessment of population genetic diversity of Derris elliptica (Fabaceae) in China using microsatellite markers He Li, Shilei Geng ∗ College of Life Sciences, South China Agricultural University, Guangzhou 510642, China
a r t i c l e
i n f o
Article history: Received 12 December 2014 Received in revised form 6 March 2015 Accepted 13 April 2015 Keywords: Genetic diversity Microsatellite markers Population differentiation Derris elliptica
a b s t r a c t Derris elliptica (Fabaceae) is one of the most important sources of the insecticide rotenone. This plant was first introduced from different Southeast Asian countries to China in the early decades of last century. The purpose of this study is to assess genetic diversity of D. elliptica in China for the conservation of its germplasm resources and for future breeding programs. Genetic diversity and population structure of 14 cultivated populations of D. elliptica in China were detected using 25 microsatellite markers. A moderate level of genetic diversity was found across the whole sample (expected heterozygosity, He = 0.529), indicating a history of multiple sources of introduction and a broad genetic base for the crop cultivated by cuttings. The genetic diversity at the population level (Mean He = 0.31) was relatively lower. Repeated bottlenecks or founder effects in its short cultivated history and also its vegetative reproduction mode may explain the results. FST (Wright F-statistic) values and AMOVA (analysis of the molecular variance) indicated large genetic differentiation among populations (FST = 0.461; 44.1%, AMOVA), while the cluster analysis showed that the collections belong to two major groups of genotypes. The initial difference in the introduced germplasm from the primary center of origin and the limited gene flows among populations may have played important roles in shaping the genetic variation pattern in D. elliptica of China. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Derris elliptica (Wall.) Benth. (Fabaceae) is commonly used in traditional medicine (Sukrong et al., 2006). Juice from its stems and roots is used as an insecticide (Andrea et al., 2007), molluscicide (Dos Santos and Sant’Ana, 2000) and fish poison (Lu et al., 2008). Some other bioactive properties, such as antifungal (Fang et al., 2010), antihypertension effect (Dos Santos and Sant’Ana, 2000) and antitumor activity (Chun et al., 2003) have also been confirmed. The plant is mainly cultivated in the tropics for its roots, a source of the botanical insecticide rotenone (Andrea et al., 2007; Lu et al., 2008; Wu et al., 2012b). In China, D. elliptica was introduced from different Southeast Asian countries beginning in the early decades of the last century (Li and Wang, 2010), and was mainly cultivated in Guangdong and Guangxi Provinces as a raw material for the commercial manufacture of rotenone. However, due to the wide use of chemical insecticides since the 1970s, its cultivation has drastically declined and some cultivars have gradually assumed a semi-wild status (The plant was cultivated as a crop many years ago, but grow naturally near a farmland or orchard now) in China. At present, with the
∗ Corresponding author. Tel.: +86 20 85280193; fax: +86 20 85282180. E-mail address: [email protected] (S. Geng). http://dx.doi.org/10.1016/j.indcrop.2015.04.023 0926-6690/© 2015 Elsevier B.V. All rights reserved.
market for botanical insecticides gradually expanding due to food safety requirements, the need for rotenone has increased markedly. Developing genetic materials with higher rotenone content and productivity is imperative for D. elliptica. Thus, characterization of genetic diversity in D. elliptica cultivated populations is required, not only for conserving its genetic diversity but also for future breeding programs. D. elliptica is a woody vine distributed in some Southeast Asian countries, such as Cambodia, India, Indonesia, Laos, Malaysia, Philippines, Thailand, and Vietnam (Chen et al., 2006; Wu et al., 2012b). In their native range, the plants can produce flowers and fruits every year, and are propagated naturally by seeds. Unfortunately, information about their pollination and seed dispersal is limited up to now. However, in their introduced range of China, the plants rarely flower and set fruit. When the plants were cultivated in plantations for three to five years, they were usually harvested for the juice of the stems and roots, and propagated vegetatively by cuttings for the next generations. Under the reproduction mode with generations to generations, these cultivated populations have been suffering from decrease in genetic diversity since they were introduced in China from their native range. On the contrary, those populations in semi-wild status may have maintained higher level of genetic diversity than the cultivated populations, due to the lacking of effective individual renewal in populations. In such
10
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
Fig. 1. The locations of the 14 cultivated populations of D. elliptica. Population abbreviations are given in Table 1.
populations, individual reproductions by nature seeds or by artificial cuttings were limited, the chance for breeding the next generation was rare. In recent years, reports about the genetic diversity and relationships in some Derris spp. using molecular markers have increased. DNA fingerprinting of seven Derris species including D. elliptica was successively performed using random amplified polymorphic DNA (Jena et al., 2004; Sukrong et al., 2006). Genetic diversity in 31 mangroves species including two Derris species was assessed through random amplified polymorphic DNA and amplified fragment length polymorphism (Mukherjee et al., 2006). Genetic variation of D. trifoliata was detected by inter-simple sequence repeat (ISSR) (Wu et al., 2012a). However, there have been few studies of the genetic diversity of Derris species using microsatellite markers. In this paper, we assessed the genetic diversity of cultivated D. elliptica populations in China using microsatellite markers developed in our previous research (Li and Geng, 2013). Genetic variation within and among populations was explored to provide crucial information for establishing a strategy for the conservation of germplasm resources and future breeding programs in D. elliptica. 2. Materials and methods 2.1. Plant materials A total of 210 individuals of D. elliptica were collected from 14 geographical populations in Guangdong Province, China (Fig. 1 and Table 1). Eight populations (DP, FS1, FS2, FS3, JL, JY, ST and WH)
were collected from the eastern region, three populations (HZ, SG and ZS) from the central region, and three populations (MM, YF and YJ) from the western region of Guangdong Province. Leaf materials were collected from 6 to 30 randomly selected individuals in each population at intervals of at least 10 m and stored with silica gel in zip-lock plastic bags until DNA isolation. 2.2. DNA extraction and microsatellite amplification Total genomic DNA was extracted from leaf tissues using a modified cetyltrimethyl ammonium bromide (CTAB) method (Doyle and Doyle, 1987). The quality and concentration of DNA extracted were checked by electrophoresis on 1% agarose gels and spectrophotometry. DNA samples were diluted to 50 ng/l and stored at –20 ◦ C. All samples were analyzed using 25 microsatellite primers (Table 2) that were previously reported to be highly polymorphic (Li and Geng, 2013). Polymerase chain reaction (PCR) was carried out in 20 l of total volume containing 1 l of genomic DNA (50 ng/l), 0.2 l of each forward and reverse primers (100 pmol/l), 2 l of 10 × PCR buffer (RealTimer, Beijing, China), 1.6 l of dNTP (2.5 mM) and 0.2 l of Taq DNA polymerase (TaKaRa, Dalian, China; 5 U/l). PCR was performed in a Bio-Rad MyCycler Peltier thermal cycler. PCR cycling conditions were as follows: after 5 min at 94 ◦ C, 35 cycles were carried out with 30 s at 94 ◦ C, 30 s at 50–60 ◦ C (depending on the primers), and 30 s at 72 ◦ C, with final extension at 72 ◦ C for 8 min. PCR products were separated on 8% denaturing polyacrylamide gel using DL500 marker (TaKaRa, Dalian, China) as size standards.
Table 1 Derris elliptica populations evaluated from Guangdong Province. The sample size and geographical location are listed. Region
Population
Abbreviation
Geographical coordinate
Sample size
Eastern
Dapu Fengshun-1 Fengshun-2 Fengshun-3 Jiaoling Jieyang Shantou Wuhua Huizhou Shaoguan Zhongshan Maoming Yunfu Yangjiang
DP FS1 FS2 FS3 JL JY ST WH HZ SG ZS MM YF YJ
24◦ 39 23◦ 74 23◦ 41 23◦ 39 24◦ 39 23◦ 30 23◦ 26 23◦ 47 22◦ 58 24◦ 21 22◦ 17 22◦ 24 22◦ 40 21◦ 35
11 30 15 30 10 30 10 12 12 7 6 10 21 6
Central
Western
Mean Total
N, 116◦ 47 N, 116◦ 18 N, 116◦ 08 N, 116◦ 07 N, 116◦ 14 N, 116◦ 17 N, 116◦ 59 N, 115◦ 27 N, 114◦ 14 N, 113◦ 59 N, 113◦ 24 N, 110◦ 53 N, 111◦ 54 N, 111◦ 51
E E E E E E E E E E E E E E
15 210
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
11
Table 2 List of microsatellite loci used. Locus
Forward primer (5 –3 )
Reverse primers (5 –3 )
Ta (◦ C)a
DE01 DE02 DE03 DE04 DE05 DE08 DE09 DE10 DE11 DE12 DE16 DE18 DE22 DE23 DE25 DE27 DE28 DE30 DE31 DE32 DE33 DE34 DE35 DE36 DE37
F: CTTTGATGCTTCCTACTT F: CATAGGGTTAGAATCCGTTGA F: CTAACGCAAGTATTTATG F: TCCTGCTCCATCAAGTCATC F:TTGTGCAGTATGGGTTAGAG F: GTTGGCAATACCATTTCATC F: CATAGGTGGTAAGCATAGAA F: GTGTTCATAGTCTAGCAGTT F: AGTATTTGGGCCAGAGGGTT F: CAACTAAGTAACGAAATCAGA F: GGTTCACCCCTTTCCCTC F: CTAACCACTTACTTATCTTT F: ATTTCATCCGTGATTCCAGA F: ATCAAACACGCTACTCAG F: TCCCCAAGACAAGAGCAACT F: TTTGCGAAACTCTGTACTTG F: GCATTGATTTGGTTTATTTG F: TGGCTTCAAAACGCATCACT F: GGTTTTCTACTTTTCTTTCA F:AGAACAAACAAGCCTTAGCAG F:ATAAAGCCCAGGTATGTAG F:GTCGCCAGCACTGACATAA F:CATGGAGTCGGTAGCAAA F:GGAAGAAGAAAAATGAAACCC F:ATAGAACTTGGCCAAATTAGA
R:ATTTCTACTCCTGTTTGG R: GATCGCGTCGCTGGTAAA R: GAGCTGCTAGTTTGTATT R: CTTTCCAGCCACTTCCCTTT R:GCTTCCTTCCTTACCTTTGA R: CTTCCTAATTCGTCCAGTCA R: TACCCTCACATTCATACATC R: CTCCCATATTTTCAGTAC R: TGGTAGTGAAGTCTTGAGGG R: TTACATACCCAATAGTTCACC R: CTTCAAAACGCATCACTA R: GACAGCATCATCATCTACAG R: ATTGTCAAGACCAAGAGTAT R: GTCAAGTGATGGTAGGAGGT R: TTAAAACGCCAAAAGGAATT R: GAGGATTTGACGGTGAGG R: CGGTTTAGGATGCCAGTA R: GTTCACCCCTTTCCCTCT R: ATGGGACAACTCATAGGTAC R:TAACCAAACCAACTCAACGAC R:AAGTTTGACTGAGAGAGGA R:CTTCGTTCATCACACACCA R:GAGAAAACTGGAAGAAGAG R:CCCTCAGAAATATGAAAACAC R:GACTCTCAGCATAGTGATTAC
54 60 50 58 58 55 55 50 60 58 54 54 50 59 54 55 57 62 50 56 54 56 54 56 52
Electrophoresis was conducted for 3 h at 80 W. After electrophoresis, PCR products were visualized by silver staining (Bassam et al., 1991). Negative controls, in which template DNA was replaced with ddH2 O in a PCR reaction, were included with each PCR run to verify that the samples were not contaminated. 2.3. Data analysis DNA banding patterns generated by the markers were scored for the presence (1) or the absence (0) of each amplified bands. Alleles were alphabetically coded (e.g., A, B and C for each band) in decreasing size order. Samples with single bands were assumed to be homozygous. In order to estimate the genetic diversity within and among populations, we calculated the number of distinct genotypes detected per population (G) as well as the genotypic richness (R), R = (G – 1)/(N – 1), which varies from 0 when all N plants in a population possess the same genotype, to 1.0, when all plants possess a different genotype. The observed proportion of asexual propagation (Rate of clonal reproduction, AR) in populations was calculated as 1–(G / N), where G is the number of different genotypes and N the number of individuals (Dorken and Eckert, 2001). The allelic richness (AR) was calculated using the software FSTAT 2.9.3.2 (Goudet, 2002). The effective number of alleles (Ne), the observed heterozygosity (Ho ), the expected heterozygosity (He ) and Shannon Information index (I) were calculated using POPGENE 32 (Yeh and Boyle, 1997). Wright F-statistic (FST) was used to estimate the variance among the populations using 1000 times permutation of the genotypes. Gene flow (Nm ) or the number of migrants per generation among populations was also estimated by POPGENE 32. The binary dataset was used to calculate the Nei’s genetic distance between the 14 populations using the program POPGENE version 32 (Nei, 1978; Yeh and Boyle, 1997) and a distance matrix was generated. Corresponding cluster analysis was performed based on the Nei’s genetic distances, employing the unweighted pair-group method with arithmetic average (UPGMA) algorithm provided in the computer program NTSYS version 2.10 (Rohlf, 1994). Finally, SAHN module plot of NTSYS was used for plotting the dendrogram and the robustness of the tree was tested using bootstrap analysis (1000 iterations). Hierarchical analysis of the
molecular variance (AMOVA) was performed after 1000 permutations to determine how the genetic diversity was partitioned within and between populations using GenAlEx version 6.3 (Peakall and Smouse, 2006). Principal component analysis (PCA) was also carried out by GenAlEx version 6.3 (Peakall and Smouse, 2006), assessing the diversity relationship among all individuals. Spearman’s correlation analysis was used to assess correlations between the genetic diversity estimates and sample size by using SPSS 11.0 software (D’Amico et al., 2001). A Mantel test was carried out to examine whether the genetic distances between population pairs were linearly related to their geographical distances using GenAlEx version 6.3 (Peakall and Smouse, 2006). 3. Results 3.1. Genetic diversity There were 25 loci detected in the 210 D. elliptica individuals from the 14 cultivated populations using 25 SSR primer pairs. All the loci were polymorphic in all populations. A total of 109 SSR alleles were identified with an average of 4.36 per locus (range of 2–8). The size of the amplified bands was in the range of 100–250 bp. The summary of genetic diversity analyzed for the 14 populations of D. elliptica is given in Table 3. At the species level, there were G = 70, CR = 0.667, R = 0.330, AR = 2.832, Ne = 2.28, He = 0.5286 and I = 0.9367. At population level, there was a wide range of variation: G was in the range of 1–21 with average of 5; CR was in the range of 0–0.960 with average of 0.55; R was in the range of 0.138–1.0 with average of 0.451; AR and Ne per population were in the ranges 1.56–2.682 and 1.280–1.897, respectively; He and Ho for each population were in the range of 0.147–0.446 and 0.280–0.549, with an average of 0.310 and 0.446, respectively; and I had an average of 0.451 and range of 0.194–0.763. Genetic diversity for the YF population was the highest of the 14 populations (R = 1.0, AR = 2.682, Ne = 1.882, He = 0.428, I = 0.763). The lowest genetic diversity was in the JL population (R = 0, AR = 1.282, Ne = 1.28, He = 0.147, I = 0.194). On the contrary, the rate of clonal reproduction for the YF population (0) and the JL population (0.960) was respectively the lowest and the highest of the 14 populations. The results showed that
12
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
Table 3 Genetic variation of the 14 Derris elliptica populations. Populations
Na
Gb
CRc
Rd
ARe
Ne f
He g
Ho h
Ii
FS3 YF FS1 FS2 DP JL MM JY WH SG ST YJ HZ ZS Mean Overall
30 21 30 15 11 25 10 25 12 7 10 6 12 6 15 210
5 21 8 4 7 1 8 5 3 7 3 5 5 4 5 70
0.833 0 0.733 0.733 0.364 0.96 0.2 0.8 0.75 0 0.7 0.167 0.583 0.333 0.551 0.667
0.138 1 0.241 0.214 0.6 0 0.778 0.167 0.182 1 0.222 0.8 0.367 0.6 0.451 0.33
1.570 ± 0.485 2.682 ± 0.764 1.581 ± 0.499 1.560 ± 0.496 1.920 ± 0.823 1.280 ± 0.449 2.233 ± 0.726 1.57 ± 0.508 1.547 ± 0.489 2.094 ± 0.858 1.560 ± 0.496 1.840 ± 0.833 2.160 ± 0.784 1.920 ± 0.688 1.823 2.832 ± 0.629
1.54 1.882 1.559 1.559 1.548 1.28 1.76 1.546 1.512 1.6 1.543 1.52 1.897 1.68 1.602 2.281
0.282 0.428 0.287 0.29 0.278 0.147 0.405 0.282 0.276 0.292 0.29 0.28 0.446 0.353 0.31 0.529
0.534 0.354 0.539 0.549 0.302 0.28 0.39 0.534 0.507 0.326 0.536 0.34 0.54 0.507 0.446 0.462
0.385 0.763 0.394 0.388 0.442 0.194 0.611 0.386 0.365 0.466 0.383 0.414 0.632 0.492 0.451 0.937
a b c d e f g h i
The number of individuals sampled. The number of distinct genotypes detected. Rate of clonal reproduction, CR = 1 – (G / N). A measure of genotypic richness, R = (G – 1)/(N – 1). Allelic richness. Effective number of alleles. Expected heterozygosity. Observed heterozygosity. Shannon information index.
genetic diversity at species level was higher than at population level. There were no significant correlations between the genetic diversity parameters and sample size (r = 0.071, P = 0.810 for G; r = –0.341, P = 0.232 for AR; r = 0.001, P = 0.996 for Ne ; r = –0.026, P = 0.929 for He ; r = 0.301, P = 0.295 for Ho ; and r = –0.032, P = 0.914 for I, Spearman’s correlation test), although the sample size varied among populations (6–30 individuals per population). 3.2. Genetic differentiation The mean FST among the 14 populations of D. elliptica was estimated as 0.461, indicating a relatively high level of overall genetic differentiation. Based on FST , the Nm was 0.292. AMOVA of the microsatellite data also showed significant (P < 0.05) genetic differences among the 14 populations of D. elliptica (Table 4). Of the total genetic diversity, 44.1% resided among populations, and the remainder (55.9%) was within populations (Table 4). When the populations were grouped into three regions (Eastern, Central and Western), hierarchical AMOVA indicated that 24.0% of the total variation was accounted for by differentiation among regions, with a further 26.6% among populations within regions and the remainder (49.4%) partitioned among individuals within populations (Table 4). The results showed significant differences in genetic differentiation among the Eastern, Central and Western regions.
3.3. Genetic relationships among populations To elucidate the genetic relationship among 14 cultivated populations of D. elliptica, cluster analysis (UPGMA) was used to generate a dendrogram based on Nei’s genetic distances. The similarity coefficients among all populations were in the range of 0.4–1.0. The 14 populations were clustered into two main clusters: I and II (Fig. 2). Cluster I was divided into two subclusters: Ia and Ib. HZ and ZS populations were located in subcluster Ib. Subcluster Ia contained JY, ST and the most populations from Meizhou (FS1, FS2, FS3 and WH populations). The six populations were very closely associated with each other (Fig. 2) and their similarity coefficients were very high. For example, the similarity coefficient between JY and ST populations was 1.00. Cluster II consisted of DP, JL, SG, YF, YJ and MM populations. Interestingly, the DP and JL populations from Meizhou were included in this cluster and were genetically more related to SG and YF populations rather than the other populations from Meizhou (which were geographically closer). The Mantel test of data for all 14 populations showed no significant correlation between genetic distances and corresponding geographical distances (r = –0.105, P = 0.614). Genetic relationships among 210 individuals of D. elliptica were also investigated by PCA analysis (Fig. 3). All individuals were mainly gathered into two groups. One group included all individuals from populations located in cluster II. The other group was mainly composed of all individuals from populations located in
Table 4 Analysis of molecular variance (AMOVA) for 210 Derris elliptica individuals from 14 populations using SSR data. Source of variation
d.f.a
SSDb
Variance components
%Totalc
p-value
Geographic location One group Among populations Within populations
13 161
1014.678 1298.602
3.02802 3.84108
44.1 55.9
<0.001 <0.001
Three regions Among regions Among populations within regions Within populations
2 11 161
411.06 603.611 1290.602
1.86524 2.06469 3.84108
24 26.6 49.4
<0.001 <0.001 <0.001
a b c
Degrees of freedom. Sum of squared deviations. The percentage of the total variance.
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
13
Fig. 2. UPGMA dendrogram showing genetic relationships among 14 cultivated populations of D. elliptica using 25 SSR markers. Population abbreviations are given in Table 1.
Fig. 3. Principal Coordinate Analysis (PCA) of all 210 individuals of D. elliptica. The first axis accounts 72.94% of the genetic variation while the second axis 7.89%.
cluster I, and was divided into two subgroups. The results confirmed the UPGMA clustering.
4. Discussion 4.1. Genetic diversity At the species level, there was a moderate level of variation in D. elliptica cultivated in China (Table 3), but the level of variation was relatively higher compared with other cultivated species previously studied using SSR markers, such as bermudagrass (Cynodon dactylon, He = 0.27, I = 0.43) (Wang et al., 2013) and barley (Hordeum vulgare, He = 0.1512) (Hajmansoor et al., 2013). Considering the relatively short history of D. elliptica introduction in China, the results were unexpected. For a newly introduced species, genetic variation within and among populations is determined to some extent by the history of introduction (Kishore et al., 2012). In general, recently introduced species would be expected to experience a series of population bottlenecks and genetic drift during colonization, which would result in reductions in both allelic richness and genetic diversity (Hassel et al., 2005; Ma et al., 2011). Thus, multiple locations from different Southeast Asian countries may have served as sources for the introduction of D. elliptica in China, which gave it a broad genetic base. However, the genetic diversity levels
of cultivated D. elliptica in China were also higher than that in wild D. trifoliata using ISSR markers (PPB = 89.7%, He = 0.3065, I = 0.4571) (Wu et al., 2012a). This may be due to the nature of markers derived from both systems (i.e., SSR and ISSR) (Parvaresh et al., 2012). It is possible that SSR markers are superior for assessing genetic diversity in Derris. At the population level, genetic diversity (He = 0.1474–0.4455) was lower than that at the species level. This result may be because most populations have been subjected to repeated bottlenecks or founder effects in their short cultivated history. Reproduction mode is an important factor affecting population genetic structure, and the low level of genetic variability of most populations may also be related to the reproduction mode of this species (Dong et al., 2006). The plant was cultivated by vegetative propagation in China, which would greatly decrease the genetic diversity and lead to genetic drift in cultivated populations over generations (Piquot et al., 1998 Zhou et al., 2008). Furthermore, clonal propagation in cultivated population may strengthen the trend. The values for R (0–1.0) and for CR (0–0.96) are quite variable among populations, and most populations have a low R value and high CR value, especially for JL where R and CR close to zero and 0.96 respectively. The facts indicate a considerable extent of clonality in the samples. Ho values are higher than He in most populations, again suggesting clonality (multiple ramets of a heterozygous individual will artificially increase Ho above He ). The observed low diversity and
14
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15
heterozygosity within most populations and the high FST estimates suggest that genetic drift had a major influence on the study populations (Mengesha et al., 2013). Interestingly, some populations showed a high level of genetic variability, such as the YF population (He = 0.4278), which was in a semi-wild state for a long time. Due to lack of artificial selection and natural reproduction, the semi-wild growing state may have helped retain the genetic variability of this population.
4.2. Genetic structure Based on both FST (FST = 0.4614, p < 0.01) and AMOVA analysis data (44.1%), significant genetic structure was observed among all D. elliptica populations in China. This level of population differentiation is greater than that of some other cultivated species (Ganeva et al., 2010; Keneni et al., 2012; Parvaresh et al., 2012). Reasonable explanations for this phenomenon are as follows: firstly, the genetic dissimilarities among populations analyzed may result from an initial difference in the introduced germplasm from the primary center of origin. All cultivated populations of D. elliptica in China were introduced from different Southeast Asian countries beginning in the early decades of the last century (Li and Wang, 2010). Similar inferences can be drawn from the cluster analysis, in which 14 populations of D. elliptica were clustered into two main clusters I and II, and two subclusters in cluster I. The result implied that the germplasm of D. elliptica in China evolved from different lines of ancestry that separated them into different gene pools (Keneni et al., 2012). Secondly, the high level of differentiation among populations could result from gene flow being limited among populations. In general, gene flow can reduce the genetic differences between populations and increase the genetic variation within populations (Allendorf and Luikart, 2007; Mengesha et al., 2013). In population genetics, the doorstep quantity of a value of gene flow (Nm ) is regarded as 1.0, the values below 1.0 would cause population differentiation (Kishore et al., 2012). In this study, the effective gene flow for D. elliptica (Nm = 0.2919) was much lower than one successful migrant per generation (Kishore et al., 2012; Wang et al., 2008). This extremely low gene flow can facilitate the genetic differentiation among populations. Because D. elliptica rarely flower and set fruit in China, propagation by cutting is the only manner of vegetative propagation for genetic exchange and gene flow between populations. Vegetative propagation is considered unsuited for long-distance dispersal, so successful gene migration would almost only occur locally or between adjacent populations (Zhou et al., 2008). Assuming propagules are always carried away from the donor population and redistributed by farmers, high within population variation should be expected (Dodd et al., 2002; Wu et al., 2012a). However, in our samples, only 55.9 and 49.4% of the genetic variation was attributed to variation within populations for total and regional samples, respectively. The results indicate that propagule dispersal was somewhat restricted among D. elliptica populations in China. Thus, the limited gene flow could be attributed to the vegetative propagation manner and the lack of exchange of planting materials between farmers. This interpretation was supported by the results of the PCoA analysis in which individuals from the same populations were often grouped together, and much less than 210 dots are distinguished in the first two axes of the PCoA (Fig. 3). The observations suggest that there must be many individuals with identical multilocus genotypes. For example, the 10 plants of JL are represented by a single dot in Fig. 3, suggesting that all, or almost all, of the 10 plants are genotypically identical. Likewise, all (>100) plants from populations FS1, FS2, FS3, JY, ST and WH are clustered in a very narrow area in the PCoA, again indicating that many of the samples are genotypically identical. The interpretation was also supported by the results of the Mantel test
that showed no significant relationship between geographical and genetic distances for all 14 populations. 4.3. Implications for breeding program and conservation The rich genetic diversity at the species level of D. elliptica in China provides great value for a breeding program. They could be potentially used to broaden the genetic base of D. elliptica cultivars and could be explored for novel genes to improve economically important traits. Especially the semi-wild populations, such as YF and HZ populations, which had higher genetic diversity than cultivated populations, would have greater value in a breeding program. However, strong and marked genetic differentiation among the observed populations implies the need for management and conservation of D. elliptica germplasm resources in China (Allendorf and Luikart, 2007; Sherwin and Moritz, 2000; Wu et al., 2012a). Each population has a certain conservation value. The magnitude and pattern of genetic diversity shown in the present study should be considered in future germplasm collection and utilization strategies (Keneni et al., 2012). Core collections should be set up, in which a subset of accessions should contain most of the genetic diversity of each population. Acknowledgements The authors wish to thank the Science and Technology Planning Project of Guangdong Province (No. 2010B020303007) and the 211 Project of South China Agriculture University for financial support. We also gratefully acknowledge Professor Feipeng Chen (College of Life Sciences, South China Agricultural University) for collecting samples, Professor Gang Hao (College of Life Sciences, South China Agricultural University) for support in supply of instruments, and Dr. Wei Gong, Dr. Zhizhan Chu Quan Chen, Siyin Tao and Peiran Li (College of Life Sciences, South China Agriculture University) for technical assistance. References Allendorf, F.W., Luikart, G., 2007. Conservation and the Genetics of Populations. Blackwell Publishing, Malden, pp. 641–$9. Andrea, A.D., Aliboni, A., De Santis, A., Mariani, S., Gorgoglione, D., Ritieni, A., 2007. SFE of Derris elliptica (Wallich) Benth. roots: influence of process parameters on yield and purity of rotenone. J. Supercrit. Fluids 42, 330–333. Bassam, B.J., Caetano-Anolles, G., Gresshoff, P.M., 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem. 196, 80–83. Chen, T., Chen, P., Fang, Y., Zheng, C., Chang, R., Ding, C., Li, J., Ma, C., Wei, Z., 2006. Leguminosae. In: Editorial Committee of Flora of China (Ed.), Flora of China. Science Press, Beijing, pp. 207–208. Chun, K.H., Kosmeder, J.W., Sun, S.H., Pezzuto, J.M., Lotan, R., Hong, W.K., Lee, H.Y., 2003. Effects of deguelin on the phosphatidylinositol 3-kinase/Akt pathway and apoptosis in premalignant human bronchial epithelial cells. J. Nat. Cancer Inst. 95, 291–302. D’Amico, E.J., Neilands, T.B., Zambarano, R., 2001. Power analysis for multivariate and repeated measures designs: a flexible approach using the SPSS MANOVA procedure. Beh. Res. Methods Inst. Comput. 33, 479–484. Dorken, M.E., Eckert, C.G., 2001. Severely reduced sexual reproduction in northern populations of a clonal plant, Decodon verticillatus (Lythraceae). J. Ecol. 89, 339–350. Dodd, R.S., Afzal-Rafii, Z., Kashani, N., Budrick, J., 2002. Land barriers and open oceans: effects on gene diversity and population structure in Avicennia germinans L. (Avicenniaceae). Mol. Ecol. 11, 1327–1338. Dong, M., Lu, B.R., Zhang, H.B., Chen, J.K., Li, B., 2006. Role of sexual reproduction in the spread of an invasive clonal plant Solidago canadensis revealed using intersimple sequence repeat markers. Plant Spec. Biol. 21, 13–18. Dos Santos, A.F., Sant’Ana, A.E., 2000. The molluscicidal activity of plants used in Brazilian folk medicine. Phytomed. Inter. J. Phytother. Phytophar. 6, 431–438. Doyle, J.J., Doyle, J.L., 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phyt. Bull. 15, 11–15. Fang, Y., Li, L., Hao, S., Lan, X., Shi, G., 2010. Antifungal and antitumor constituents in Derris elliptica (Roxb.) Benth. waste. Agrochemicals, 874–875+884 (In Chinese with English abstract). Ganeva, G., Korzun, V., Landjeva, S., Popova, Z., Christov, N.K., 2010. Genetic diversity assessment of Bulgarian durum wheat (Triticum durum Desf.)
H. Li, S. Geng / Industrial Crops and Products 73 (2015) 9–15 landraces and modern cultivars using microsatellite markers. Genet. Resour. Crop Evol. 57, 273–285. Goudet, J., 2002. FSTAT, a program to estimate and test gene diversities and fixation indices (version 2.9.3.2). Free available at . Hajmansoor, S., Bihamta, M.R., Alisoltani, A., 2013. Genetic diversity among and within Iranian and non-Iranian barely (Hordeum vulgare L.) genotypes using SSR and storage proteins markers. Biochem. Syst. Ecol. 46, 7–17. Hassel, K., Sastad, S.M., Gunnarsson, U., Soderstrom, L., 2005. Genetic variation and structure in the expanding moss Pogonatum dentatum (Polytrichaceae) in its area of origin and in a recently colonized area. Am. J. Bot. 92, 1684–1690. Jena, S., Sahoo, P., Mohanty, S., Das, A.B., 2004. Identification of RAPD markers, in situ DNA content and structural chromosomal diversity in some legumes of the mangrove flora of Orissa. Genetica 122, 217–226. Keneni, G., Bekele, E., Imtiaz, M., Dagne, K., Getu, E., Assefa, F., 2012. Genetic diversity and population structure of Ethiopian chickpea (Cicer arietinum L.) germplasm accessions from different geographical origins as revealed by microsatellite markers. Plant Mol. Biol. Rep. 30, 654–665. Kishore, G., Gupta, S., Pandey, A., 2012. Assessment of population genetic diversity of Fagopyrum tataricum using SSR molecular marker. Biochem. Syst. Ecol. 43, 32–41. Li, H., Geng, S., 2013. Development and characterization of microsatellite markers for Derris elliptica (Fabaceae), an insecticide-producing plant. Sci. Hortic. 154, 54–60. Li, Y., Wang, Z., 2010. The application and analisis progress of rotenone. Guangxi J. Light Indus. 11, 9–10 (In Chinese with English abstract). Lu, H.Y., Liang, J.Y., Yu, P., Qu, W., Zhao, L., 2008. Two new rotenoids from the root of Derris elliptica. Chin. Chem. Lett. 19, 1218–1220. Ma, J.W., Geng, S.L., Wang, S.B., Zhang, G.L., Fu, W.D., Shu, B., 2011. Genetic diversity of the newly invasive weed Flaveria bidentis (Asteraceae) reveals consequences of its rapid range expansion in northern China. Weed Res. 51, 363–372. Mengesha, W.A., Demissew, S., Fay, M.F., Smith, R.J., Nordal, I., Wilkin, P., 2013. Genetic diversity and population structure of Guinea yams and their wild relatives in South and South West Ethiopia as revealed by microsatellite markers. Genet. Resour. Crop Evol. 60, 529–541.
15
Mukherjee, A.K., Acharya, L., Panda, P.C., Mohapatra, T., 2006. Assessment of genetic diversity in 31 species of mangroves and their associates through RAPD and AFLP markers. J. Biosci. 61, 413–420. Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Parvaresh, M., Talebi, M., Sayed-Tabatabaei, B.-E., 2012. Molecular diversity and genetic relationship of pomegranate (Punica granatum L.) genotypes using microsatellite markers. Sci. Hortic. 138, 244–252. Peakall, R., Smouse, P.E., 2006. GENALEX 6: genetic analysis in Excel: Population genetic software for teaching and research. Mol. Ecol. Not. 6, 288–295. Piquot, Y., Petit, D., Valero, M., Cuguen, J., De Laguerie, P., Vernet, P., 1998. Variation in sexual and asexual reproduction among young and old populations of the perennial macrophyte Sparganium erectum. Oikos 82, 139–148. Rohlf, F.J., 1994. Ntsys-pc: Numerical Taxonomy and Multivariate Analysis System. Exeter Software, New York. Sherwin, W.B., Moritz, C., 2000. Managing and monitoring genetic erosion. Conserv. Biol. Ser. 4, 9–34. Sukrong, S., Phadungcharoen, T., Ruangrungsi, N., 2006. DNA fingerprinting of medicinally used Derris species by RAPD molecular markers. Planta Med. 72, 1031. Wang, T., Su, Y., Chen, G., 2008. Population genetic variation and structure of the invasive weed Mikania micrantha in southern China: consequences of rapid range expansion. J. Hered. 99, 22–33. Wang, Z., Liao, L., Yuan, X., Guo, H., Guo, A., Liu, J., 2013. Genetic diversity analysis of Cynodon dactylon (bermudagrass) accessions and cultivars from different countries based on ISSR and SSR markers. Biochem. Syst. Ecol. 46, 108–115. Wu, B., Geng, S., Shu, B., 2012a. Genetic variation and the conservation of isolated populations of Derris trifoliata (Leguminosae) a mangrove-associated vine in southern China. Biochem. Syst. Ecol. 40, 118–125. Wu, X., Song, Z., Xu, H., Zhang, H., Chen, W., Liu, H., 2012b. Chemical constituents of the aerial part of Derris elliptica. Fitoterapia 83, 732–736. Yeh, F.C., Boyle, T.J.B., 1997. Population genetic analysis of co-dominant and dominant markers and quantitative traits. Bel. J. Bot. 129, 157. Zhou, H., Chen, J., Zhang, S., 2008. Genetic and clonal diversity of Globba racemosa, a herb with a mixed reproductive mode. Zhiwu Shengtai Xuebao 32, 751–759 (In Chinese with English abstract).