- Email: [email protected]
Association assessment of platelet derived growth factor B gene polymorphism and its expression status with susceptibility to coronary artery disease
The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx
Contents lists available at ScienceDirect
The Egyptian Journal of Medical Human Genetics journal homepage: www.sciencedirect.com
Original article
Association assessment of platelet derived growth factor B gene polymorphism and its expression status with susceptibility to coronary artery disease Shayesteh Rezayani 1, Touraj Farazmandfar 1, Majid shahbazi ⇑ Medical Cellular and Molecular Research Center, Golestan University of Medical Sciences, Gorgan, Iran
a r t i c l e
i n f o
Article history: Received 28 February 2017 Accepted 14 March 2017 Available online xxxx Keywords: Coronary artery disease PDGF-B Polymorphism Genotyping mRNA expression
a b s t r a c t Background: Coronary artery disease (CAD) is the most frequent cause of morbidity and mortality in the world and it is known as a multifactorial disorder which is influenced by both genetic and environmental factors. Based on different assays, the platelet derived growth factor B (PDGF-B) gene is shown to be amongst the inflammation inducers involved in different pathological conditions such as atherosclerosis. Aim: In this case-control study we have examined the association of the functional PDGF-B +286 and +1135 polymorphisms and its expression status with susceptibility to CAD. Subjects and methods: Study groups included 369 patients with CAD and 413 healthy individuals. Genotypic and allelic frequencies of PDGF-B +286 and +1135 polymorphisms were determined by the SSP-PCR method. PDGF-B expression status was identified by quantitative real-time PCR. Results: The analysis of genotyping results revealed CAD patients had an increased frequency of PDGF-B +286A>G A/A genotype in comparison with healthy individuals. Furthermore, we found that the PDGF-B expression level in CAD patients group is nearly 2-folds greater than its level in control group. Conclusion: There is probably a relationship between variations in PDGF-B gene and CAD influence. The increase in PDGF-B gene expression may has a role in susceptibility to CAD. Ó 2017 Ain Shams University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Coronary artery disease (CAD) is the most frequent cause of disability and the world’s major cause of death. The CAD is a complex chronic multifactorial disorder that results from obvious genetic susceptibility and environmental risk factors and their interactions [1] and starts during adolescence and slowly progressing during life. Family history is regarded as one of the important autonomous CAD risk factors, and identifying the susceptibility genes for this frequent and complex disease, is a crucial goal [2]. CAD is defined as narrowing of epicardial coronary arteries induced by a build-up of atherosclerotic plaques. Inflammation is considered as one of the main processes contributing to atherogenesis [3]. According to National Heart, Lung, and Blood Institute in 2010 the prevalence of CAD was lower in women with age <60 years than men with same age. The CAD rate increases in both genders after age
Peer review under responsibility of Ain Shams University. ⇑ Corresponding author at: Department of Medical Genetics, School of Advanced Technologies in Medicine, Golestan University of Medical Sciences, Gorgan, Iran E-mail address: [email protected] (M. shahbazi). 1 These authors contributed equally and should be considered as first authors.
60 years, especially in men who are living in the ’80 s [4]. Among the different risk factors associated with CAD, age, gender, cigarette smoking, hypertension and hyperlipidemia are more effective. The manifestation of fibrous atherosclerotic plaque results from modification or acceleration of multiple inflammatory-fibro proliferative responses. The risk factors and the vascular smooth muscle cells are the central cell component involved in these responses. CAD is approximately 40–60% heritable, but its genetics mechanism is not completely clear. Genetics-epidemiological and twin studies have revealed the role of genetics factors in the atherosclerosis development. Moreover, case-control studies on polymorphisms have identified genes associated with increased risks to CAD [5,6]. The Platelet derived growth factor B (PDGF-B) gene locus is located on 22q13.1 chromosome, producing a cationic hydrophilic 30 KD protein which binds to specific receptors, and now is considered as one of the best characterized growth factor-receptor systems. PDGF-B was described approximately 40 years ago as a potent mitogen and chemo-attractant serum factor, and was elicited from the alpha-granules of the platelets. This protein stimulates the proliferation of mesenchymal original cells such as fibroblasts and vascular smooth muscle cells. Different assays have
http://dx.doi.org/10.1016/j.ejmhg.2017.03.004 1110-8630/Ó 2017 Ain Shams University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
2
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx
shown that PDGF contributes to different pathological conditions such as atherosclerosis, fibrosis, restenosis, glomerulonephritis, liver cirrhosis, pulmonary fibrosis and cancer. The conventional PDGF-A and PDGF-B, and more recently discovered PDGF-C and PDGF-D polypeptides, constitute four members of PDGF family [7,8]. Four disulfide-bonded homodimers of PDGF protein including PDGF-AA, PDGF-BB, PDGF-CC and PDGF-DD, and one heterodimer, PDGF-AB are biologically active proteins. These proteins act through structural activation of two tyrosine kinase receptors, PDGFRa and PDGFRb [9,10]. PDGF is expressed by cells which related to mesenchymal cells expressed PDGF receptors, including megakaryocytes that are the precursor of platelets cells. These expressional patterns suggest that PDGF mediates paracrine signaling. Although some recent case-control studies have been performed on gene polymorphisms in CAD at populations with different geographic and genetic diversity [5,6]. No studies have been examined the role of these PDGF-B functional polymorphisms in susceptibility to CAD in Iranian population yet. Therefore, we conducted a case-control study to analyze the association of the PDGF-B functional polymorphisms (positions of +286 and +1135 from transcription start site) and PDGF-B expression level with susceptibility to CAD in Iranian population. 2. Subjects and methods 2.1. Study subjects In this prospective study, we randomly screened 369 CAD patients and 413 control individuals (mean age 30–60) from the northeast of Iran to analyze the genetic variations in the PDGF-B gene +286 and +1135 loci. For selecting the CAD patients, two expert cardiologists confirmed the occurrence of CAD, according the clinical and paraclinical findings, invasive angiography, as 70% stenosis in at least 1 major epicardial coronary artery. Control subjects were selected randomly among healthy individuals with a normal angiography (15% stenosis) and with no visible autoimmune or inflammatory disorders. This work has been carried out in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments in humans, and was approved by the local Ethical Committee. The informed written consent was obtained from all recruited individuals. None of the approached subjects refused to participate. Expression assay also was randomly performed on 80 CAD patients and 80 control individuals among the same individuals with the same age condition. 2.2. DNA extraction and genotyping Genomic DNA was extracted from 2 ml peripheral whole blood by a standard protocol [11]. Briefly, red blood cells were lysed three times with a buffer containing ammonium chloride, potassium dihydrogen phosphate, and disodium hydrogen phosphates (Sigma, Munich, Germany). Then, SDS (10%), EDTA, and 10 ll proteinase K (Sigma, Munich, Germany) were added to the pellet that was incubated for 1 h at 65 °C. After incubation, a phenol/chloroform/isoamyl alcohol mix (Sigma, Munich, Germany) was added to samples. The mix was then centrifuged. Isopropanol and sodium acetate (Merck, Kenilworth, US) were added to the supernatant to visualize and precipitate the DNA, and DNA was extracted after centrifugation. Using a spectrophotometer (Techne, Staffordshire, UK), the amount of DNA for each sample was determined by measuring the optical density at 260 nm wavelength. DNA samples were aliquoted in graded distilled water and stored at 80 °C until used. The sequence-specific primer-polymerase chain reaction (SSP-PCR) method was used for genotyping. To detect the
PDGF-B polymorphism at +286 and +1135 position, 100 ng of genomic DNA was amplified in a 15 ml reaction mix with 13 ll master mix containing 20 lm dNTP, 1X ready-load PCR buffer, DMSO, one unit Taq polymerase (GENETBIO, Daejeon, South Korea), 6 lm human growth hormone primer (Eurofins, Ebersberg, Germany) as internal control, and 30 lM of each specific primer (Eurofins, Ebersberg, Germany). The PCR reaction for SNPs of +286 and +1135 were performed in a Thermal Cycler (Techne, Staffordshire, UK), with the one program that described previously [12]. The primer sequences used for both polymorphisms are shown in Table 1. The PCR products were electrophoresed on a 1.5% agarose gel (Merck, Germany), and bands were visualized with a gel documentation system (Uvitec, Cambridge, UK). 2.3. Quantitative real-time PCR Total RNA was extracted from cultured leukocytes of 6 ml of peripheral whole blood. The transcriptor First Strand cDNA Synthesis Kit (Roche, Grenzach-Wyhlen, Germany) was used to converting 1 lg of total RNA into cDNA. Quantitative real-time polymerase chain reaction of the PDGF-B gene was performed in duplicates in ABI Prism 7300 Sequence Detection System using SYBR Green (Applied Biosystems, Foster City, US) according to the manufacturer’s instructions with the following optimized PCR conditions (94 °C 10 min, and 94 °C 30 s, 58 °C 1 min, 72 °C 45 s for 35 cycles, then 10 min extension at 72 °C). All thresholds cycle (Ct) of PDGF-B gene normalized with PGK1 cDNA. The used primers are shown in Table 1. Primers were designed based on sequences from the GenBank and to span exon-intron junctions to prevent amplification of genomic DNA. The mRNA level was calculated using the 2-DCt method [13]. 2.4. Statistical analysis After entering data in a SPSS v-16 program, the means of parametric variables were calculated. Data are presented as Mean ± SD for parametric variables and as percentages for non-parametric values. Allele and genotype frequencies were calculated and compared between groups by non-parametric tests followed by Fisher’s exact analysis using STATA v-8 (CA, US). P-values were determined, and those less than 0.05 were considered to be significant. 3. Results A total of 369 CAD patients and 413 healthy individuals were successfully genotyped for SNPs, PDGF-B +286A>G and PDGF-B +1135A>C. In both SNPs, deviation from the Hardy-Weinberg equation was not observed in either patient group (PDGF-B +286A>G: v2 = 0.263, df = 1, p = 0. 607 and PDGF-B +1135A>C: v2 = 0.119, df = 1, p = 0. 730), or the control group (PDGF-B +286A>G: v2 = 0.096, df = 1, p = 0.765 and PDGF-B +1135A>C: v2 = 0.864, df = 1, p = 0.352). Complementary data including the allele and genotype frequencies of PDGF-B +286 are shown in Table 2. According to the data analysis, there is a significant association between A/A genotype and CAD disease [OR (95%CI): 1.58 (1.05– 2.36), p = 0.032]. The results also indicated that allele A is significantly associated with the CAD disease [OR (95%CI): 1.26 (1.03– 1.54), p = 0.021]. As the Table 3 showed, allelic and genotypic frequencies of PDGF-B +1135 polymorphism did not show any significant statistical association with CAD. To investigate the inheritance model of SNPs at PDGF-B gene, three models of recessive, dominant and co-dominant were considered and no significant association was seen in inheritance models, in both SNPs (Tables 2 and 3). Combined genotypes distribution of PDGF-B
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
3
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx Table 1 The used primers in this study. Amplified factor SSP-PCR PDGF-B (+286)
PDGF-B (+1135)
hGH-N Real-Time PCR PDGF-B PGK1
Primers 50 –30
Bond size (bp)
Annealing temperature (°C)
Genbank Accession Number
235
57
NG_012111
263
55
Forward-A Forward-G Reverse Forward-A Forward-C Reverse
GCCCAGAGCGGCGAGCA GCCCAGAGCGGCGAGCG TTCCAAAGTTGGCTTTGCAAC ATTCATTACCTTCGCCCCCA ATTCATTACCTTCGCCCCCC TGTTCTCGGGTTCCCAAAGG
Forward Reverse
GCCTTCCCAACCATTCCCTTA TCACGGATTTCTGTTGTG
429
50
NG_011676.1
Forward Reverse
AGTGGCCAAATAGGAGGGAG AGGACTTTGGGAAATGGAGG
81
54
NM_002608.3
Forward Reverse
GCAGATTGTGTGGAATGGTC CCCTAGAAGTGGCTTTCACC
101
53
NM_000291.3
Table 2 The genotypic and allelic distribution of PDGF-B +286 A>G polymorphism in CAD and control group. Characteristic
Patients, n (%)
Control, n (%)
OR (95% CI)
p value
Genotypes G/G A/G A/A
65 (17.6) 174 (47.2) 130 (35.2)
94 (22.8) 200 (48.4) 119 (28.8)
1 1.25 (0.86–1.83) 1.58 (1.05–2.36)
– 0.253 0.032
Alleles G A
304 (41.2) 434 (58.8)
388 (47) 438 (53)
1 1.26 (1.03–1.54)
– 0.021
0.74 (0.55–1.00) 1.37 (0.96–1.96) 1.05 (0.79–1.39)
0.055 0.075 0.774
Model of inheritance Recessive (A/A vs. G/G + A/G) Dominant (A/G + A/A vs. G/G) Co-dominant (A/G vs. G/G + A/A) OR, odds ratio; CI, confidence interval; Significant p values are bold.
Table 3 The genotypic and allelic distribution of PDGF-B +1135 A>C polymorphism in CAD and control group. Characteristic
Patients, n (%)
Control, n (%)
OR (95% CI)
p value
Genotypes A/A A/C C/C
164 (44.4) 162 (43.9) 43 (11.7)
186 (45.0) 176 (42.6) 51 (12.3)
1 1.04 (0.77–1.40) 0.95 (0.60–1.51)
– 0.818 0.907
Alleles A C
490 (66.4) 248 (33.6)
548 (53.2) 278 (46.8)
1 0.99 (0.80–1.23)
– 1.000
1.06 (0.69–1.64) 1.02 (0.77–1.35) 0.94 (0.71–1.26)
0.825 0.885 0.718
Model of inheritance Recessive (C/C vs. A/A + A/C) Dominant (A/C + C/C vs. A/A) Co-dominant (A/C vs. A/A + C/C) OR, odds ratio; CI, confidence interval.
+286 and +1135 polymorphisms in control and patient groups have been shown in Table 4, and analysis results indicated that there is no significant association between combinations of genotypes with the CAD in this population. In order to compare the PDGF-B mRNA level in patient and control groups, we used a relative RT-PCR assay on PDGF-B cDNA samples. Our results have shown, averages of PDGF-B level in CAD group (4.11 ± 1.41) was significantly higher in comparison with healthy group (2.01 ± 0.94) (p = 0.011) (Fig. 1). 4. Discussion Despite the remarkable successes in identification of genetics variants that affect common risk factors, such as cholesterol levels,
the progress in exploration of novel CAD genes has been slow. Some recent findings emphasize a relationship between CAD and inflammation [14] and PDGF-B as an important inducer and modulator factor of inflammation, contributes to atherosclerosis occurrence. Despite the fact that the platelets are the basic origin of the PDGFs, the expression of these growth factors is induced in all the constituent cells of normal vessel wall and inflammatory cells, and this induction is in response to penetration of the pathological stimuli into the vessels. The Acute vascular injuries show increased release of PDGFs from the vascular cells such as the endothelial cells, vascular smooth muscle cells, active monocytes and monocyte derived macrophages [15–17]. Moreover, the increased expression of PDGF-B mRNA has been reported several times in atherosclerotic plaques in humans [18]. These studies have also
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
4
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx
Table 4 Combined genotypes distribution of PDGF-B +286 and +1135 polymorphisms in control and patient groups. Combined genotypes (PDGF + 1135/+286)
Case n (%)
Control n (%)
OR (CI 95%)
P value
AA/GG AA/AA AA/AG CC/AA CC/GG CC/AG AC/AA AC/GC AC/AG
32 66 88 10 20 21 43 42 91
22 (6) 68 (18.4) 74 (20.1) 8 (2.2) 19 (5.1) 16 (4.3) 54 (14.6) 24 (6.5) 84 (22.8)
1 1.49 1.22 1.16 1.38 1.10 1.82 0.83 1.34
– 0.259 0.635 0.780 0.520 0.830 0.091 0.710 0.431
(7.8) (16) (21.3) (2.4) (4.8) (5.1) (10.4) (10.2) (22)
(0.75 – 3.00) (0.62–2.41) (0.33 – 3.87) (0.55 – 5.43) (0.43 – 2.80) (0.88 – 3.80) (0.37 – 1.86) (0.69 – 2.62)
OR, odds ratio; CI, confidence interval.
Fig. 1. QRT-PCR analysis of PDGF-B mRNA. The cDNA levels of genes were normalized to PGK1 cDNA. The PDGF-B expression level in patients group was significantly higher than healthy group.
shown the existence of the PDGF-B protein in these lesions. These observations directly evidence the contribution of the PDGF in atherogenesis. However, to the best of our knowledge, the present study is the first document on analysis of the PDGF-B expression in PBMCs of CAD patients. Our results showed that PDGF-B gene transcripts were elevated in PBMCs of CAD patients nearly 2-folds than normal individuals. In this study, a statistically significant difference was noted in the distribution of the PDGF-B polymorphism at position +286 between the case and control groups. This result is consistent with an earlier study by Tambur et al. [19] that had analyzed PDGF-B +286A>G and +1135A>C polymorphisms in heart transplant recipients who showed CAD after angiography. They also found a significant difference in A/A genotype in +286A>G position between patients and controls, and suggested that this SNP may play an important role in susceptibility of CAD. Furthermore, in contrast to our work, they found a significant difference in C/C genotype in +1135A>C SNP between patients and controls. Few recent studies have documented the expression of PDGF-B in plasma and the atherosclerotic lesions separated from coronary vessel wall autopsies of CAD patients. Rinse et al. [18] in their study showed that PDGF-B mRNA expression in atherosclerotic lesions is higher than in normal vessel walls. In another study Barrett et al. [15] studied the expression level of PDGF-B mRNA in atherosclerotic plaques and normal vessel walls. Their finding showed more than 5-folds increase in mRNA transcripts. The proliferation of smooth muscle cells (SMC), as the most frequent atherosclerotic forming cells, is the basic aspect in progression of the human atherosclerotic lesions. Moreover, cellular response of the human vessel walls after angioplasty is often performed by SMCs. The SMC proliferation and migration controlling factors are key elements in progress of these lesions. Laboratory researches have shown that PDGFs are one of the biological determinants involved in this process [15,20]. Tanizawa et al. study [20] examined PDGF-B expression of eight patients with coronary arteries who had died after angioplasty due to heart ischemia. Their
findings showed that there is a PDGF mediated repair process with involvement of SMCs and macrophages. In another study, Ueda et al. [21] examined the presence of PDGF-B mRNAs in coronary artery autopsies after angiography. Their results showed that in humans the B chain of PDGF gene is expressed in injury sites and in connection with reconstructive processes. Cagnin et al. study [22] investigated the expressional changes of human carotid genes influenced by atherosclerotic plaques. They found an increased level of PDGF-B in plasma of atherosclerosis patients. Tuuminen et al. study [23] has also shown an increased expression in PDGFB in agreement with our findings. In conclusion, there is probably a relationship between some PDGF-B functional polymorphisms and CAD influence. The increase in PDGF-B gene expression may be a risk factor in susceptibility to CAD. However, in large populations with different ethnic composition, acquired results may be different.
Compliance with ethical standards Funding: The financial support provided by the Arya Tina Gene (ATG) company. Conflict of interest: The authors declare that they have no conflicts of interest. Research involving human participants and/or animals: Samples in this study were non-identifiable with no direct human participant. Informed consent: participants signed informed written consents were acquired in accordance with Declaration of Helsinki. Acknowledgments We kindly appreciate those who participated in this study. We thank the Arya Tina Gene company for recruiting study subjects. Our study was instrumentally supported by Golestan University of Medical Science. References [1] Nanni L, Romualdi C, Maseri A, Lanfranchi G. Differential gene expression profiling in genetic and multifactorial cardiovascular diseases. J Mol Cell Cardiol 2006;41:934–48. http://dx.doi.org/10.1016/j.yjmcc.2006.08.009. [2] Watkins H, Farrall M. Genetic susceptibility to coronary artery disease: from promise to progress. Nat Rev Genet 2006;7:163–73. http://dx.doi.org/10.1038/ nrg1805. [3] Libby P, Theroux P. Pathophysiology of coronary artery disease. Circulation 2005;111:3481–8. http://dx.doi.org/10.1161/CIRCULATIONAHA.105.537878. [4] Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, et al. Heart disease and stroke statistics—2015 update. Circulation 2014. http://dx. doi.org/10.1161/CIR.0000000000000152. CIR.0000000000000152. [5] Topol EJ, McCarthy J, Gabriel S, Moliterno DJ, Rogers WJ, Newby LK, et al. Single nucleotide polymorphisms in multiple novel thrombospondin genes may be associated with familial premature myocardial infarction. Circulation 2001;104:2641–4.
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx [6] Winkelmann BR, Hager J, Kraus WE, Merlini P, Keavney B, Grant PJ, et al. Genetics of coronary heart disease: current knowledge and research principles. Am Heart J 2000;140:S11–26. http://dx.doi.org/10.1067/mhj.2000.109636. [7] Fredriksson L, Li H, Eriksson U. The PDGF family: four gene products form five dimeric isoforms. Cytokine Growth Factor Rev 2004;15:197–204. http://dx.doi. org/10.1016/j.cytogfr.2004.03.007. [8] Reigstad LJ, Varhaug JE, Lillehaug JR. Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family. FEBS J 2005;272:5723–41. http://dx.doi.org/10.1111/j.1742-4658. 2005.04989.x. [9] Trojanowska M. Role of PDGF in fibrotic diseases and systemic sclerosis. Rheumatol Oxf Engl 2008;47(Suppl 5):v2–4. http://dx.doi.org/10.1093/ rheumatology/ken265. [10] Betsholtz C. Biology of platelet-derived growth factors in development. Birth Defects Res Part C Embryo Today Rev 2003;69:272–85. http://dx.doi.org/ 10.1002/bdrc.10030. [11] Javaheri-Kermani M, Farazmandfar T, Ajami A, Yazdani Y. Impact of hepcidin antimicrobial peptide on iron overload in tuberculosis patients. Scand J Infect Dis 2014;46:693–6. http://dx.doi.org/10.3109/00365548.2014.929736. [12] Farazmandfar T, Haghshenas MR, Janbabai G, Azadeh H, Sharifian R, Taghipour M. A rapid and reliable genotyping method for hepatitis B virus genotypes (AH) using type-specific primers. J Virol Methods 2012;181:114–6. http://dx.doi. org/10.1016/j.jviromet.2012.01.025. [13] Janbabai G, Oladi Z, Farazmandfar T, Taghvaei T, Naghshvar F. The prognostic impact of EGFR, ErbB2 and MET gene amplification in human gastric carcinomas as measured by quantitative Real-Time PCR. J Cancer Res Clin Oncol 2015;141:1945–52. http://dx.doi.org/10.1007/s00432-015-1965-7. [14] Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med 2005;352:1685–95. http://dx.doi.org/10.1056/NEJMra043430. [15] Barrett TB, Benditt EP. Sis (platelet-derived growth factor B chain) gene transcript levels are elevated in human atherosclerotic lesions compared to normal artery. Proc Natl Acad Sci U S A 1987;84:1099–103.
5
[16] Heldin CH, Westermark B. Mechanism of action and in vivo role of plateletderived growth factor. Physiol Rev 1999;79:1283–316. [17] Rubin K, Tingström A, Hansson GK, Larsson E, Rönnstrand L, Klareskog L, et al. Induction of B-type receptors for platelet-derived growth factor in vascular inflammation: possible implications for development of vascular proliferative lesions. Lancet Lond Engl 1988;1:1353–6. [18] Raines EW. PDGF and cardiovascular disease. Cytokine Growth Factor Rev 2004;15:237–54. http://dx.doi.org/10.1016/j.cytogfr.2004.03.004. [19] Tambur AR, Pamboukian S, Costanzo M-R, Heroux A. Genetic polymorphism in platelet-derived growth factor and vascular endothelial growth factor are significantly associated with cardiac allograft vasculopathy. J Heart Lung Transplant Off Publ Int Soc Heart Transplant 2006;25:690–8. http://dx.doi.org/ 10.1016/j.healun.2006.02.006. [20] Tanizawa S, Ueda M, van der Loos CM, van der Wal AC, Becker AE. Expression of platelet derived growth factor B chain and beta receptor in human coronary arteries after percutaneous transluminal coronary angioplasty: an immunohistochemical study. Heart Br Card Soc 1996;75:549–56. [21] Ueda M, Becker AE, Kasayuki N, Kojima A, Morita Y, Tanaka S. In situ detection of platelet-derived growth factor-A and -B chain mRNA in human coronary arteries after percutaneous transluminal coronary angioplasty. Am J Pathol 1996;149:831–43. [22] Cagnin S, Biscuola M, Patuzzo C, Trabetti E, Pasquali A, Laveder P, et al. Reconstruction and functional analysis of altered molecular pathways in human atherosclerotic arteries. BMC Genomics 2009;10:13. http://dx.doi.org/ 10.1186/1471-2164-10-13. [23] Tuuminen R, Nykänen A, Keränen MA, Krebs R, Alitalo K, Koskinen PK, et al. The effect of platelet-derived growth factor ligands in rat cardiac allograft vasculopathy and fibrosis. Transplant Proc 2006;38:3271–3. http://dx.doi.org/ 10.1016/j.transproceed.2006.10.056.
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
Contents lists available at ScienceDirect
The Egyptian Journal of Medical Human Genetics journal homepage: www.sciencedirect.com
Original article
Association assessment of platelet derived growth factor B gene polymorphism and its expression status with susceptibility to coronary artery disease Shayesteh Rezayani 1, Touraj Farazmandfar 1, Majid shahbazi ⇑ Medical Cellular and Molecular Research Center, Golestan University of Medical Sciences, Gorgan, Iran
a r t i c l e
i n f o
Article history: Received 28 February 2017 Accepted 14 March 2017 Available online xxxx Keywords: Coronary artery disease PDGF-B Polymorphism Genotyping mRNA expression
a b s t r a c t Background: Coronary artery disease (CAD) is the most frequent cause of morbidity and mortality in the world and it is known as a multifactorial disorder which is influenced by both genetic and environmental factors. Based on different assays, the platelet derived growth factor B (PDGF-B) gene is shown to be amongst the inflammation inducers involved in different pathological conditions such as atherosclerosis. Aim: In this case-control study we have examined the association of the functional PDGF-B +286 and +1135 polymorphisms and its expression status with susceptibility to CAD. Subjects and methods: Study groups included 369 patients with CAD and 413 healthy individuals. Genotypic and allelic frequencies of PDGF-B +286 and +1135 polymorphisms were determined by the SSP-PCR method. PDGF-B expression status was identified by quantitative real-time PCR. Results: The analysis of genotyping results revealed CAD patients had an increased frequency of PDGF-B +286A>G A/A genotype in comparison with healthy individuals. Furthermore, we found that the PDGF-B expression level in CAD patients group is nearly 2-folds greater than its level in control group. Conclusion: There is probably a relationship between variations in PDGF-B gene and CAD influence. The increase in PDGF-B gene expression may has a role in susceptibility to CAD. Ó 2017 Ain Shams University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction Coronary artery disease (CAD) is the most frequent cause of disability and the world’s major cause of death. The CAD is a complex chronic multifactorial disorder that results from obvious genetic susceptibility and environmental risk factors and their interactions [1] and starts during adolescence and slowly progressing during life. Family history is regarded as one of the important autonomous CAD risk factors, and identifying the susceptibility genes for this frequent and complex disease, is a crucial goal [2]. CAD is defined as narrowing of epicardial coronary arteries induced by a build-up of atherosclerotic plaques. Inflammation is considered as one of the main processes contributing to atherogenesis [3]. According to National Heart, Lung, and Blood Institute in 2010 the prevalence of CAD was lower in women with age <60 years than men with same age. The CAD rate increases in both genders after age
Peer review under responsibility of Ain Shams University. ⇑ Corresponding author at: Department of Medical Genetics, School of Advanced Technologies in Medicine, Golestan University of Medical Sciences, Gorgan, Iran E-mail address: [email protected] (M. shahbazi). 1 These authors contributed equally and should be considered as first authors.
60 years, especially in men who are living in the ’80 s [4]. Among the different risk factors associated with CAD, age, gender, cigarette smoking, hypertension and hyperlipidemia are more effective. The manifestation of fibrous atherosclerotic plaque results from modification or acceleration of multiple inflammatory-fibro proliferative responses. The risk factors and the vascular smooth muscle cells are the central cell component involved in these responses. CAD is approximately 40–60% heritable, but its genetics mechanism is not completely clear. Genetics-epidemiological and twin studies have revealed the role of genetics factors in the atherosclerosis development. Moreover, case-control studies on polymorphisms have identified genes associated with increased risks to CAD [5,6]. The Platelet derived growth factor B (PDGF-B) gene locus is located on 22q13.1 chromosome, producing a cationic hydrophilic 30 KD protein which binds to specific receptors, and now is considered as one of the best characterized growth factor-receptor systems. PDGF-B was described approximately 40 years ago as a potent mitogen and chemo-attractant serum factor, and was elicited from the alpha-granules of the platelets. This protein stimulates the proliferation of mesenchymal original cells such as fibroblasts and vascular smooth muscle cells. Different assays have
http://dx.doi.org/10.1016/j.ejmhg.2017.03.004 1110-8630/Ó 2017 Ain Shams University. Production and hosting by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
2
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx
shown that PDGF contributes to different pathological conditions such as atherosclerosis, fibrosis, restenosis, glomerulonephritis, liver cirrhosis, pulmonary fibrosis and cancer. The conventional PDGF-A and PDGF-B, and more recently discovered PDGF-C and PDGF-D polypeptides, constitute four members of PDGF family [7,8]. Four disulfide-bonded homodimers of PDGF protein including PDGF-AA, PDGF-BB, PDGF-CC and PDGF-DD, and one heterodimer, PDGF-AB are biologically active proteins. These proteins act through structural activation of two tyrosine kinase receptors, PDGFRa and PDGFRb [9,10]. PDGF is expressed by cells which related to mesenchymal cells expressed PDGF receptors, including megakaryocytes that are the precursor of platelets cells. These expressional patterns suggest that PDGF mediates paracrine signaling. Although some recent case-control studies have been performed on gene polymorphisms in CAD at populations with different geographic and genetic diversity [5,6]. No studies have been examined the role of these PDGF-B functional polymorphisms in susceptibility to CAD in Iranian population yet. Therefore, we conducted a case-control study to analyze the association of the PDGF-B functional polymorphisms (positions of +286 and +1135 from transcription start site) and PDGF-B expression level with susceptibility to CAD in Iranian population. 2. Subjects and methods 2.1. Study subjects In this prospective study, we randomly screened 369 CAD patients and 413 control individuals (mean age 30–60) from the northeast of Iran to analyze the genetic variations in the PDGF-B gene +286 and +1135 loci. For selecting the CAD patients, two expert cardiologists confirmed the occurrence of CAD, according the clinical and paraclinical findings, invasive angiography, as 70% stenosis in at least 1 major epicardial coronary artery. Control subjects were selected randomly among healthy individuals with a normal angiography (15% stenosis) and with no visible autoimmune or inflammatory disorders. This work has been carried out in accordance with the Code of Ethics of the World Medical Association (Declaration of Helsinki) for experiments in humans, and was approved by the local Ethical Committee. The informed written consent was obtained from all recruited individuals. None of the approached subjects refused to participate. Expression assay also was randomly performed on 80 CAD patients and 80 control individuals among the same individuals with the same age condition. 2.2. DNA extraction and genotyping Genomic DNA was extracted from 2 ml peripheral whole blood by a standard protocol [11]. Briefly, red blood cells were lysed three times with a buffer containing ammonium chloride, potassium dihydrogen phosphate, and disodium hydrogen phosphates (Sigma, Munich, Germany). Then, SDS (10%), EDTA, and 10 ll proteinase K (Sigma, Munich, Germany) were added to the pellet that was incubated for 1 h at 65 °C. After incubation, a phenol/chloroform/isoamyl alcohol mix (Sigma, Munich, Germany) was added to samples. The mix was then centrifuged. Isopropanol and sodium acetate (Merck, Kenilworth, US) were added to the supernatant to visualize and precipitate the DNA, and DNA was extracted after centrifugation. Using a spectrophotometer (Techne, Staffordshire, UK), the amount of DNA for each sample was determined by measuring the optical density at 260 nm wavelength. DNA samples were aliquoted in graded distilled water and stored at 80 °C until used. The sequence-specific primer-polymerase chain reaction (SSP-PCR) method was used for genotyping. To detect the
PDGF-B polymorphism at +286 and +1135 position, 100 ng of genomic DNA was amplified in a 15 ml reaction mix with 13 ll master mix containing 20 lm dNTP, 1X ready-load PCR buffer, DMSO, one unit Taq polymerase (GENETBIO, Daejeon, South Korea), 6 lm human growth hormone primer (Eurofins, Ebersberg, Germany) as internal control, and 30 lM of each specific primer (Eurofins, Ebersberg, Germany). The PCR reaction for SNPs of +286 and +1135 were performed in a Thermal Cycler (Techne, Staffordshire, UK), with the one program that described previously [12]. The primer sequences used for both polymorphisms are shown in Table 1. The PCR products were electrophoresed on a 1.5% agarose gel (Merck, Germany), and bands were visualized with a gel documentation system (Uvitec, Cambridge, UK). 2.3. Quantitative real-time PCR Total RNA was extracted from cultured leukocytes of 6 ml of peripheral whole blood. The transcriptor First Strand cDNA Synthesis Kit (Roche, Grenzach-Wyhlen, Germany) was used to converting 1 lg of total RNA into cDNA. Quantitative real-time polymerase chain reaction of the PDGF-B gene was performed in duplicates in ABI Prism 7300 Sequence Detection System using SYBR Green (Applied Biosystems, Foster City, US) according to the manufacturer’s instructions with the following optimized PCR conditions (94 °C 10 min, and 94 °C 30 s, 58 °C 1 min, 72 °C 45 s for 35 cycles, then 10 min extension at 72 °C). All thresholds cycle (Ct) of PDGF-B gene normalized with PGK1 cDNA. The used primers are shown in Table 1. Primers were designed based on sequences from the GenBank and to span exon-intron junctions to prevent amplification of genomic DNA. The mRNA level was calculated using the 2-DCt method [13]. 2.4. Statistical analysis After entering data in a SPSS v-16 program, the means of parametric variables were calculated. Data are presented as Mean ± SD for parametric variables and as percentages for non-parametric values. Allele and genotype frequencies were calculated and compared between groups by non-parametric tests followed by Fisher’s exact analysis using STATA v-8 (CA, US). P-values were determined, and those less than 0.05 were considered to be significant. 3. Results A total of 369 CAD patients and 413 healthy individuals were successfully genotyped for SNPs, PDGF-B +286A>G and PDGF-B +1135A>C. In both SNPs, deviation from the Hardy-Weinberg equation was not observed in either patient group (PDGF-B +286A>G: v2 = 0.263, df = 1, p = 0. 607 and PDGF-B +1135A>C: v2 = 0.119, df = 1, p = 0. 730), or the control group (PDGF-B +286A>G: v2 = 0.096, df = 1, p = 0.765 and PDGF-B +1135A>C: v2 = 0.864, df = 1, p = 0.352). Complementary data including the allele and genotype frequencies of PDGF-B +286 are shown in Table 2. According to the data analysis, there is a significant association between A/A genotype and CAD disease [OR (95%CI): 1.58 (1.05– 2.36), p = 0.032]. The results also indicated that allele A is significantly associated with the CAD disease [OR (95%CI): 1.26 (1.03– 1.54), p = 0.021]. As the Table 3 showed, allelic and genotypic frequencies of PDGF-B +1135 polymorphism did not show any significant statistical association with CAD. To investigate the inheritance model of SNPs at PDGF-B gene, three models of recessive, dominant and co-dominant were considered and no significant association was seen in inheritance models, in both SNPs (Tables 2 and 3). Combined genotypes distribution of PDGF-B
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
3
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx Table 1 The used primers in this study. Amplified factor SSP-PCR PDGF-B (+286)
PDGF-B (+1135)
hGH-N Real-Time PCR PDGF-B PGK1
Primers 50 –30
Bond size (bp)
Annealing temperature (°C)
Genbank Accession Number
235
57
NG_012111
263
55
Forward-A Forward-G Reverse Forward-A Forward-C Reverse
GCCCAGAGCGGCGAGCA GCCCAGAGCGGCGAGCG TTCCAAAGTTGGCTTTGCAAC ATTCATTACCTTCGCCCCCA ATTCATTACCTTCGCCCCCC TGTTCTCGGGTTCCCAAAGG
Forward Reverse
GCCTTCCCAACCATTCCCTTA TCACGGATTTCTGTTGTG
429
50
NG_011676.1
Forward Reverse
AGTGGCCAAATAGGAGGGAG AGGACTTTGGGAAATGGAGG
81
54
NM_002608.3
Forward Reverse
GCAGATTGTGTGGAATGGTC CCCTAGAAGTGGCTTTCACC
101
53
NM_000291.3
Table 2 The genotypic and allelic distribution of PDGF-B +286 A>G polymorphism in CAD and control group. Characteristic
Patients, n (%)
Control, n (%)
OR (95% CI)
p value
Genotypes G/G A/G A/A
65 (17.6) 174 (47.2) 130 (35.2)
94 (22.8) 200 (48.4) 119 (28.8)
1 1.25 (0.86–1.83) 1.58 (1.05–2.36)
– 0.253 0.032
Alleles G A
304 (41.2) 434 (58.8)
388 (47) 438 (53)
1 1.26 (1.03–1.54)
– 0.021
0.74 (0.55–1.00) 1.37 (0.96–1.96) 1.05 (0.79–1.39)
0.055 0.075 0.774
Model of inheritance Recessive (A/A vs. G/G + A/G) Dominant (A/G + A/A vs. G/G) Co-dominant (A/G vs. G/G + A/A) OR, odds ratio; CI, confidence interval; Significant p values are bold.
Table 3 The genotypic and allelic distribution of PDGF-B +1135 A>C polymorphism in CAD and control group. Characteristic
Patients, n (%)
Control, n (%)
OR (95% CI)
p value
Genotypes A/A A/C C/C
164 (44.4) 162 (43.9) 43 (11.7)
186 (45.0) 176 (42.6) 51 (12.3)
1 1.04 (0.77–1.40) 0.95 (0.60–1.51)
– 0.818 0.907
Alleles A C
490 (66.4) 248 (33.6)
548 (53.2) 278 (46.8)
1 0.99 (0.80–1.23)
– 1.000
1.06 (0.69–1.64) 1.02 (0.77–1.35) 0.94 (0.71–1.26)
0.825 0.885 0.718
Model of inheritance Recessive (C/C vs. A/A + A/C) Dominant (A/C + C/C vs. A/A) Co-dominant (A/C vs. A/A + C/C) OR, odds ratio; CI, confidence interval.
+286 and +1135 polymorphisms in control and patient groups have been shown in Table 4, and analysis results indicated that there is no significant association between combinations of genotypes with the CAD in this population. In order to compare the PDGF-B mRNA level in patient and control groups, we used a relative RT-PCR assay on PDGF-B cDNA samples. Our results have shown, averages of PDGF-B level in CAD group (4.11 ± 1.41) was significantly higher in comparison with healthy group (2.01 ± 0.94) (p = 0.011) (Fig. 1). 4. Discussion Despite the remarkable successes in identification of genetics variants that affect common risk factors, such as cholesterol levels,
the progress in exploration of novel CAD genes has been slow. Some recent findings emphasize a relationship between CAD and inflammation [14] and PDGF-B as an important inducer and modulator factor of inflammation, contributes to atherosclerosis occurrence. Despite the fact that the platelets are the basic origin of the PDGFs, the expression of these growth factors is induced in all the constituent cells of normal vessel wall and inflammatory cells, and this induction is in response to penetration of the pathological stimuli into the vessels. The Acute vascular injuries show increased release of PDGFs from the vascular cells such as the endothelial cells, vascular smooth muscle cells, active monocytes and monocyte derived macrophages [15–17]. Moreover, the increased expression of PDGF-B mRNA has been reported several times in atherosclerotic plaques in humans [18]. These studies have also
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
4
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx
Table 4 Combined genotypes distribution of PDGF-B +286 and +1135 polymorphisms in control and patient groups. Combined genotypes (PDGF + 1135/+286)
Case n (%)
Control n (%)
OR (CI 95%)
P value
AA/GG AA/AA AA/AG CC/AA CC/GG CC/AG AC/AA AC/GC AC/AG
32 66 88 10 20 21 43 42 91
22 (6) 68 (18.4) 74 (20.1) 8 (2.2) 19 (5.1) 16 (4.3) 54 (14.6) 24 (6.5) 84 (22.8)
1 1.49 1.22 1.16 1.38 1.10 1.82 0.83 1.34
– 0.259 0.635 0.780 0.520 0.830 0.091 0.710 0.431
(7.8) (16) (21.3) (2.4) (4.8) (5.1) (10.4) (10.2) (22)
(0.75 – 3.00) (0.62–2.41) (0.33 – 3.87) (0.55 – 5.43) (0.43 – 2.80) (0.88 – 3.80) (0.37 – 1.86) (0.69 – 2.62)
OR, odds ratio; CI, confidence interval.
Fig. 1. QRT-PCR analysis of PDGF-B mRNA. The cDNA levels of genes were normalized to PGK1 cDNA. The PDGF-B expression level in patients group was significantly higher than healthy group.
shown the existence of the PDGF-B protein in these lesions. These observations directly evidence the contribution of the PDGF in atherogenesis. However, to the best of our knowledge, the present study is the first document on analysis of the PDGF-B expression in PBMCs of CAD patients. Our results showed that PDGF-B gene transcripts were elevated in PBMCs of CAD patients nearly 2-folds than normal individuals. In this study, a statistically significant difference was noted in the distribution of the PDGF-B polymorphism at position +286 between the case and control groups. This result is consistent with an earlier study by Tambur et al. [19] that had analyzed PDGF-B +286A>G and +1135A>C polymorphisms in heart transplant recipients who showed CAD after angiography. They also found a significant difference in A/A genotype in +286A>G position between patients and controls, and suggested that this SNP may play an important role in susceptibility of CAD. Furthermore, in contrast to our work, they found a significant difference in C/C genotype in +1135A>C SNP between patients and controls. Few recent studies have documented the expression of PDGF-B in plasma and the atherosclerotic lesions separated from coronary vessel wall autopsies of CAD patients. Rinse et al. [18] in their study showed that PDGF-B mRNA expression in atherosclerotic lesions is higher than in normal vessel walls. In another study Barrett et al. [15] studied the expression level of PDGF-B mRNA in atherosclerotic plaques and normal vessel walls. Their finding showed more than 5-folds increase in mRNA transcripts. The proliferation of smooth muscle cells (SMC), as the most frequent atherosclerotic forming cells, is the basic aspect in progression of the human atherosclerotic lesions. Moreover, cellular response of the human vessel walls after angioplasty is often performed by SMCs. The SMC proliferation and migration controlling factors are key elements in progress of these lesions. Laboratory researches have shown that PDGFs are one of the biological determinants involved in this process [15,20]. Tanizawa et al. study [20] examined PDGF-B expression of eight patients with coronary arteries who had died after angioplasty due to heart ischemia. Their
findings showed that there is a PDGF mediated repair process with involvement of SMCs and macrophages. In another study, Ueda et al. [21] examined the presence of PDGF-B mRNAs in coronary artery autopsies after angiography. Their results showed that in humans the B chain of PDGF gene is expressed in injury sites and in connection with reconstructive processes. Cagnin et al. study [22] investigated the expressional changes of human carotid genes influenced by atherosclerotic plaques. They found an increased level of PDGF-B in plasma of atherosclerosis patients. Tuuminen et al. study [23] has also shown an increased expression in PDGFB in agreement with our findings. In conclusion, there is probably a relationship between some PDGF-B functional polymorphisms and CAD influence. The increase in PDGF-B gene expression may be a risk factor in susceptibility to CAD. However, in large populations with different ethnic composition, acquired results may be different.
Compliance with ethical standards Funding: The financial support provided by the Arya Tina Gene (ATG) company. Conflict of interest: The authors declare that they have no conflicts of interest. Research involving human participants and/or animals: Samples in this study were non-identifiable with no direct human participant. Informed consent: participants signed informed written consents were acquired in accordance with Declaration of Helsinki. Acknowledgments We kindly appreciate those who participated in this study. We thank the Arya Tina Gene company for recruiting study subjects. Our study was instrumentally supported by Golestan University of Medical Science. References [1] Nanni L, Romualdi C, Maseri A, Lanfranchi G. Differential gene expression profiling in genetic and multifactorial cardiovascular diseases. J Mol Cell Cardiol 2006;41:934–48. http://dx.doi.org/10.1016/j.yjmcc.2006.08.009. [2] Watkins H, Farrall M. Genetic susceptibility to coronary artery disease: from promise to progress. Nat Rev Genet 2006;7:163–73. http://dx.doi.org/10.1038/ nrg1805. [3] Libby P, Theroux P. Pathophysiology of coronary artery disease. Circulation 2005;111:3481–8. http://dx.doi.org/10.1161/CIRCULATIONAHA.105.537878. [4] Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, et al. Heart disease and stroke statistics—2015 update. Circulation 2014. http://dx. doi.org/10.1161/CIR.0000000000000152. CIR.0000000000000152. [5] Topol EJ, McCarthy J, Gabriel S, Moliterno DJ, Rogers WJ, Newby LK, et al. Single nucleotide polymorphisms in multiple novel thrombospondin genes may be associated with familial premature myocardial infarction. Circulation 2001;104:2641–4.
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004
S. Rezayani et al. / The Egyptian Journal of Medical Human Genetics xxx (2017) xxx–xxx [6] Winkelmann BR, Hager J, Kraus WE, Merlini P, Keavney B, Grant PJ, et al. Genetics of coronary heart disease: current knowledge and research principles. Am Heart J 2000;140:S11–26. http://dx.doi.org/10.1067/mhj.2000.109636. [7] Fredriksson L, Li H, Eriksson U. The PDGF family: four gene products form five dimeric isoforms. Cytokine Growth Factor Rev 2004;15:197–204. http://dx.doi. org/10.1016/j.cytogfr.2004.03.007. [8] Reigstad LJ, Varhaug JE, Lillehaug JR. Structural and functional specificities of PDGF-C and PDGF-D, the novel members of the platelet-derived growth factors family. FEBS J 2005;272:5723–41. http://dx.doi.org/10.1111/j.1742-4658. 2005.04989.x. [9] Trojanowska M. Role of PDGF in fibrotic diseases and systemic sclerosis. Rheumatol Oxf Engl 2008;47(Suppl 5):v2–4. http://dx.doi.org/10.1093/ rheumatology/ken265. [10] Betsholtz C. Biology of platelet-derived growth factors in development. Birth Defects Res Part C Embryo Today Rev 2003;69:272–85. http://dx.doi.org/ 10.1002/bdrc.10030. [11] Javaheri-Kermani M, Farazmandfar T, Ajami A, Yazdani Y. Impact of hepcidin antimicrobial peptide on iron overload in tuberculosis patients. Scand J Infect Dis 2014;46:693–6. http://dx.doi.org/10.3109/00365548.2014.929736. [12] Farazmandfar T, Haghshenas MR, Janbabai G, Azadeh H, Sharifian R, Taghipour M. A rapid and reliable genotyping method for hepatitis B virus genotypes (AH) using type-specific primers. J Virol Methods 2012;181:114–6. http://dx.doi. org/10.1016/j.jviromet.2012.01.025. [13] Janbabai G, Oladi Z, Farazmandfar T, Taghvaei T, Naghshvar F. The prognostic impact of EGFR, ErbB2 and MET gene amplification in human gastric carcinomas as measured by quantitative Real-Time PCR. J Cancer Res Clin Oncol 2015;141:1945–52. http://dx.doi.org/10.1007/s00432-015-1965-7. [14] Hansson GK. Inflammation, atherosclerosis, and coronary artery disease. N Engl J Med 2005;352:1685–95. http://dx.doi.org/10.1056/NEJMra043430. [15] Barrett TB, Benditt EP. Sis (platelet-derived growth factor B chain) gene transcript levels are elevated in human atherosclerotic lesions compared to normal artery. Proc Natl Acad Sci U S A 1987;84:1099–103.
5
[16] Heldin CH, Westermark B. Mechanism of action and in vivo role of plateletderived growth factor. Physiol Rev 1999;79:1283–316. [17] Rubin K, Tingström A, Hansson GK, Larsson E, Rönnstrand L, Klareskog L, et al. Induction of B-type receptors for platelet-derived growth factor in vascular inflammation: possible implications for development of vascular proliferative lesions. Lancet Lond Engl 1988;1:1353–6. [18] Raines EW. PDGF and cardiovascular disease. Cytokine Growth Factor Rev 2004;15:237–54. http://dx.doi.org/10.1016/j.cytogfr.2004.03.004. [19] Tambur AR, Pamboukian S, Costanzo M-R, Heroux A. Genetic polymorphism in platelet-derived growth factor and vascular endothelial growth factor are significantly associated with cardiac allograft vasculopathy. J Heart Lung Transplant Off Publ Int Soc Heart Transplant 2006;25:690–8. http://dx.doi.org/ 10.1016/j.healun.2006.02.006. [20] Tanizawa S, Ueda M, van der Loos CM, van der Wal AC, Becker AE. Expression of platelet derived growth factor B chain and beta receptor in human coronary arteries after percutaneous transluminal coronary angioplasty: an immunohistochemical study. Heart Br Card Soc 1996;75:549–56. [21] Ueda M, Becker AE, Kasayuki N, Kojima A, Morita Y, Tanaka S. In situ detection of platelet-derived growth factor-A and -B chain mRNA in human coronary arteries after percutaneous transluminal coronary angioplasty. Am J Pathol 1996;149:831–43. [22] Cagnin S, Biscuola M, Patuzzo C, Trabetti E, Pasquali A, Laveder P, et al. Reconstruction and functional analysis of altered molecular pathways in human atherosclerotic arteries. BMC Genomics 2009;10:13. http://dx.doi.org/ 10.1186/1471-2164-10-13. [23] Tuuminen R, Nykänen A, Keränen MA, Krebs R, Alitalo K, Koskinen PK, et al. The effect of platelet-derived growth factor ligands in rat cardiac allograft vasculopathy and fibrosis. Transplant Proc 2006;38:3271–3. http://dx.doi.org/ 10.1016/j.transproceed.2006.10.056.
Please cite this article in press as: Rezayani S et al. . Egypt J Med Hum Genet (2017), http://dx.doi.org/10.1016/j.ejmhg.2017.03.004