Association of CYP1A1, CYP1B1 and CYP17 gene polymorphisms and organochlorine pesticides with benign prostatic hyperplasia

Chemosphere 108 (2014) 40–45

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Association of CYP1A1, CYP1B1 and CYP17 gene polymorphisms and organochlorine pesticides with benign prostatic hyperplasia Vivek Kumar a,1, Basu Dev Banerjee a,⇑, Sudip Kumar Datta d, Chandra Shekhar Yadav a, Satyender Singh c, Rafat Sultana Ahmed a, Sanjay Gupta b a

Environmental Biochemistry & Molecular Biology Laboratory, Department of Biochemistry, University College of Medical Sciences & GTB Hospital, University of Delhi, Dilshad Garden, Delhi 110095, India Department of Surgery, University College of Medical Sciences & GTB Hospital, University of Delhi, Dilshad Garden, Delhi 110095, India c Faculty of Pharmaceutical Sciences, Pt BD Sharma University of Health Sciences, Rohtak, Haryana 124001, India d Department of Biochemistry, PGIMER, Chandigarh 160012, India b

h i g h l i g h t s  Organochlorine pesticide and CYP polymorphism in BPH patients.  CYP17 polymorphism was significantly higher among BPH patients.  p,p0 -DDE and endosulfan

a r t i c l e

a were significantly higher amongst BPH patients.

i n f o

Article history: Received 2 September 2013 Received in revised form 22 February 2014 Accepted 26 February 2014

Handling Editor: Tamara S. Galloway Keywords: Benign prostatic hyperplasia Organochlorine pesticides Cytochrome P450 Polymorphism

a b s t r a c t It is well established that steroidal hormones (testosterone and estrogen) increase benign prostatic hyperplasia (BPH) risk. Cytochrome P450 (CYP) enzymes especially CYP1A1, CYP1B1 and CYP17 metabolize these hormones. Apart from that, several endocrine disrupting organochlorine pesticides (OCPs) are reported to mimic the activity of these steroidal hormones. Therefore, functional polymorphisms in these genes and exposure to such pesticides may increase BPH risk further. Our study included 100 newly diagnosed BPH subjects and 100 age-matched healthy male controls. CYP1A1, CYP1B1 and CYP17 polymorphisms were studied using PCR-RFLP and allele-specific PCR method. OCP levels in blood were analyzed by gas chromatography (GC). Levels of p,p0 -DDE and endosulfan a were found to be significantly higher amongst BPH subjects as compared to controls (p-values = 0.001 and 0.03 respectively) and CYP17 polymorphism was observed to be significantly associated with BPH subjects as compared to controls (p-values = 0.03), indicating that these factors may be important risk factors for BPH. However, further studies are required before unequivocal conclusion. Ó 2014 Published by Elsevier Ltd.

1. Introduction Benign prostatic hyperplasia (BPH) is a common non-malignant disorder in elderly men leading to lower urinary tract symptoms (LUTs), sometimes even leading to death in severe cases. It may affect up to 90% of men at the age of 85 years (Parsons et al., 2006). Etiopathogenesis of BPH is complex involving both environmental and genetic factors. Steroidal hormones, mainly androgen and estrogens, play an important role in the physiological growth

⇑ Corresponding author. Tel.: +91 11 22135362; fax: +91 11 22590495. 1

E-mail address: [email protected] (B.D. Banerjee). Present address: IMS Engineering College, Ghaziabad, India.

http://dx.doi.org/10.1016/j.chemosphere.2014.02.081 0045-6535/Ó 2014 Published by Elsevier Ltd.

and development of prostate gland, hence, any endogenous or exogenous factors influencing the steroidal hormonal levels may affect the susceptibility of individuals to BPH (Konwar et al., 2008). Endocrine disrupting chemicals (EDCs) are certain substances that mimic hormones and disrupt the physiologic function of endogenous hormones (Sonnenschein and Soto, 1998). These EDCs can mimic activity of natural estrogen activity and can adversely affect the prostate. Such substances are known as xenoestrogen. Organochlorine pesticides (OCPs) such as 1,1,1-trichloro-2,2-bis(p-chlorophenyl) ethane (DDT), hexachlorocyclohexane (HCH), dieldrin and endosulfan are known EDCs and among the most commonly used pesticides in developing countries like India. Previous studies have reported increase in weight of prostatic tissue in mice after exposure of known xenoestrogens (Gray, 1998). However, the

V. Kumar et al. / Chemosphere 108 (2014) 40–45

effects of OCPs on human prostate gland enlargement, remains largely unclear. Apart from these environmental pollutants, several genetic factors are also suspected to play a role in prostatic enlargement. Human cytochrome P450 (CYP) is a diverse family of phase I xenobiotic metabolizing enzyme involved in metabolism of mainly steroidal hormones and xenobiotics. Amongst the long list of enzymes clubbed under this group, CYP1A1 and CYP1B1 enzymes are involved in the hydroxylation of estrogens to the 2-hydroxy estrogen (2-OH HE) and 4-OH HEs (Aklillu et al., 2002; Kisselev et al., 2005; Kumar et al., 2009). Polymorphisms in CYP1A1, namely m1 and m2 are reported to cause variation in the enzyme activity resulting in altered metabolism of steroidal hormone and environmental carcinogens, which may possibly enhance tumor progression and risk of other diseases like arteritis, allergies, allergic dermatitis, miscarriages etc. (Androutsopoulos et al., 2009; Singh et al., 2011; Tsatsakis et al., 2009). CYP1A1 m1 is T to C polymorphism in the 30 non-coding region; this is known to affect enzyme inducibility. CYP1A1 m2 is A to G polymorphism in exon 7 which reportedly increase CYP1A1 enzyme activity (Marinkovic´ et al., 2013). Five different polymorphisms in CYP1B1 namely Arg to Gly substitution (CYP1B1⁄2), Ala to Ser substitution (CYP1B1⁄2), Leu to Val substitution (CYP1B1⁄3), Asn to Ser substitution (CYP1B1⁄4) and Ala to Gly substitution (CYP1B1⁄7) reportedly affect hormone metabolism (Aklillu et al., 2002; Kumar et al., 2009). The CYP17 enzyme mediates two steps in steroid hormone biosynthesis namely 17 a-hydroxylase and 17, 20-lyase activities. The CYP17 contains a single-base pair (bp) T to C polymorphism that creates a Sp-1 site (CCACC box) at 34 bp upstream from the initiation of translation and downstream from the transcription site, providing an additional promoter activity with an increased CYP17 transcription (Habuchi et al., 2000; Sharp et al., 2004). The androgens (androstenedione) produced by CYP17 activity may then be converted to estrone, testosterone and estrogen. This can potentially affect the ratio of steroidal hormones either directly or indirectly (Sharp et al., 2004). All these CYP genes are reported to express highly in human prostate. Moreover, they have suspected role in prostate cancer (Williams et al., 2000; Kumar et al., 2010; Habuchi et al., 2000). It is likely that these genetic polymorphisms may possibly increase BPH susceptibility. Studies have consistently analyzed the role of the endocrine disrupting OCPs and these steroidal hormone metabolizing genes and have evaluated the risk for prostate cancer; however, it is likely that the same factors may also increase the risk for BPH. Surprisingly, studies analyzing role of these factors in BPH are few. Hence, the present study was designed to evaluate the association of these CYP gene polymorphisms and OCP levels in BPH patients.

2. Material and methods 2.1. Subjects This study consisted of two hundred subjects, hundred each in two groups: (i) newly diagnosed BPH patients and (ii) age matched controls. The diagnosis of BPH in subjects with LUTS presenting to the Surgery OPD, GTB Hospital, Delhi was confirmed by measuring the prostate volume by ultrasonography >20 cc and plasma prostate specific antigen (PSA) levels >4 ng mL1. Controls were defined as subjects with no LUTs, normal PSA levels and prostate volume <20 cc. Subjects with history of any chronic or metabolic disorders including diabetes having elevated blood glucose level were excluded because of their probable role in BPH pathogenesis. Besides, subjects with history of chronic liver dysfunction and alcoholism were also excluded from the study as it may interfere with

41

steriodal hormone metabolism and therefore may increase BPH risk (Parsons et al., 2006; Kumar et al., 2011). Some of the eligible subjects and controls were recruited from our previous studies (Kumar et al., 2010, 2011). A written informed consent was obtained from each study subject. Information regarding age, tobacco usage, relevant clinical information etc. was obtained on a predesigned questionnaire form. Relevant approvals for the study and the procedures were obtained from the Institutional Ethical Committee for Human Research, UCMS and GTB Hospital, Delhi. 2.2. DNA isolation Blood was collected in EDTA containing vials and stored in 20 °C refrigerator till analysis. All the samples were processed within a week of collection. DNA was extracted from whole blood using commercially available DNA extraction kit (Omniprep™, GBiosciences, USA) following manufacturer’s protocol. Isolated DNA was stored at 20 °C till genotyping. 2.3. Genotyping For all genetic polymorphism analysis a total of 50 lL PCR reaction mixture consisting of 50 ng of genomic DNA, 10 lM of each primer, 0.2 mM of dNTPs mixture (Bangalore Genei, India), 1.5 mM of MgCl2, 1.5 unit of Taq polymerase with 1X PCR reaction buffer (Bangalore Genei, India) was used. PCR volume (50 lL) and reaction mixture composition was same for all the polymorphic analysis. The amplified PCR products were analyzed using 1.5% agarose gel. The PCR conditions, primer sequences and resulting amplified/ restriction fragments are summarized in Table 1. 2.3.1. CYP1A1 genotyping For CYP1A1 m1 and m2 polymorphism analysis, polymerase chain reaction-restriction fragment length polymorphism (PCRRFLP) and allele specific-PCR methods were used respectively (Kumar et al., 2010). For m1 polymorphism, the 340 bp PCR amplified fragment was digested with MspI (New England Biolabs, USA) at 37 °C for 5 h. The wild type allele produced single undigested band of 340 bp and the mutant type allele resulted in two fragments of 200 and 140 bp whereas heterozygous produced all three bands of size 340, 200 and 140 bp. For CYP1A1 m2 polymorphism both mutant and wild type allele produced 205 bp product (Kumar et al., 2010). (Table 1). 2.3.2. CYP1B1 genotyping For analysis of polymorphism present in CYP1B1, two step-allele-specific PCR was used with minor modifications (Aklillu et al., 2002; Kumar et al., 2009). Amplification product of first PCR was used as template of second PCR (Table 1). 2.3.3. CYP17 genotyping For analysis of CYP17 polymorphism PCR-RFLP was method was used. For analysis 419 bp fragment was digested with MspA1 (New England Biolabs, Beverly, MA) at 37 °C for 3 h (Habuchi et al., 2000; Yadav et al., 2011). Restriction digestion for wild type allele produced single undigested DNA fragment of 419 bp, mutant genotype resulted in two fragments of 295 and 124 bp whereas heterozygous geneotype produced all the bands (Table 1). 2.4. OCPs extraction and quantification For OCPs residue extraction and quantification HPLC-grade solvents were used and checked for any contamination before extraction. Extraction was done using hexane-acetone method of Bush et al. (1984). Whole blood (1 mL) was taken in a 50 mL conical flask. Hexane (6 mL) and acetone (3 mL) were added and

42

V. Kumar et al. / Chemosphere 108 (2014) 40–45

Table 1 Primers and PCR conditions for the detection of gene polymorphisms. Polymorphism

Primers sequence

PCR profile

Method

Band pattern (bp)

CYP1A1 m1

m1FAAGAGGTGTAGCCGCTGCACT m1R-TAGGAGTCTCTCATGCCT

94 °C-5 min, (35  94 °C-1 min, 61 °C-1-min, 72 °C-1 min), 72 °C-10 min

RFLP (REMspI)

AF: 340 bp, WT: 340 bp, HT: 340 bp, 200 bp, 140 bp MT: 200 bp, 140 bp

CYP1A1 m2

CommRGTAGACAGAGTCTAGGCCTCA. m2(wt)F-

94 °C-5 min, (35  94 °C-15 s, 64 °C-1 min, 72 °C-1 min), 72 °C-10 min

AS-PCR

WT: 205 bp MT: 205 bp

GAAGTGTATCGGTGAG-ACCG m2(mt)FGAAGTGTATCGGTGAGACCA CYP1B1 (Exon 2)

PCRI ex2FACGACCCTTGGCCGCTAAAC ex2R-GCCACCACCGTGCGAGTC

CYP1B1⁄2

PCRII comR-CAGCAGCGCCACCAGC

(Arg48Gly)$

Fwt-GGAGGCGGCAGCTCG

CYP1B1⁄2

Fmt- GGAGGCGGCAGCTCC comR-CAGCAGCGCCACCAGCTC $

(Ala119Ser) CYP1B1 (Exon 3)

CYP1B1⁄3

95 °C-1 min, (35  94 °C-15 s, 60 °C 15 s, 72 °C-1 min), 72 °C-7 min

AS-PCR

914 bp

95 °C-1 min, (20  94 °C-15 s, 54 °C-15 s, 72 °C-1 min), 72 °C-7 min

AS-PCR

416 bp

95 °C-1 min, (35  94 °C-15 s, 60 °C-15 s, 72 °C-1 min), 72 °C-7 min

AS-PCR

207 bp

95 °C-1 min, (35  94 °C-15 s, 60 °C-15s, 72 °C-1 min), 72 °C-7 min

AS-PCR

270 bp

95 °C-1 min, (20  94 °C-15 s, 54 °C-15 s, 72 °C-1 min), 72 °C-7 min

AS-PCR

153 bp

95 °C-1 min, (20  94 °C-15 s, 54 °C-15 s, 72 °C-1 min), 72 °C-7 min

AS-PCR

217 bp

95 °C-1 min, (20  94 °C-15s, 54 °C-15s, 72 °C-1 min), 72 °C-7 min

AS-PCR

186 bp

94 °C-5 min, (30  94 °C-1 min-1 min, 72 °C-1 min), 72 °C10 min

RFLP

AF: 419 bp, WT: 419 bp

(REMspA1)

HT: 419 bp, 295 bp, 124 bp, MT: 295 bp, 124 bp

Fwt-TCGCCGACCGGCCGG Fmt-TCGCCGACCGGCCGT PCRI ex3FAAGTTCTTCGCCAATGCACC ex3RTATGAAGCCATGCGCTTCTC PCRII ex3RTATGAAGCCATGCGCTTCTC Fwt-GTTAGGCCACTTCAG Fmt-GTTAGGCCACTTCAC

CYP1B1⁄4

ex3RTATGAAGCCATGCGCTTCTC Fwt-TGGTCAGGTCCTTGT Fmt- TGGTCAGGTCCTTGC

CYP1B1⁄7

ex3RTATGAAGCCATGCGCTTCTC Fwt-TGTCCAAGAATCGAG Fmt-TGTCCAAGAATCGAC

CYP17

CYP17FCATTCGCACCTCTGGAGTC CYP17RGGCTCTTGGGGTACTTG.

RFLP-restriction fragment length polymorphism, AS-PCR-allele specific-polymerase chain reaction, AF-amplified fragment, WT-wild type, HT-heterozygous type, MT-mutant type, s-seconds, RE-restriction enzyme, X-number of cycles, bp-base pairs & min-minutes. $-CYP1B1⁄2 (Arg48Gly) and CYP1B1⁄2 (Ala119Ser) are two linked polymorphism present in exon 2 of CYP1B1 gene (Aklillu et al., 2002).

the contents were vigorously shaken at room temp for 30 min in a shaker. The extract was centrifuged for 10 min at 2000 rpm and clear top layer of hexane was collected. The remaining sample was extracted twice using same process and the newly extracted hexane was added to the extracted solvent. Sample clean up was done by column chromatography following USEPA method 3620B. Eluted sample was collected in a beaker and concentrated by evaporation for further analysis. OCPs quantification was done using Perkin Elmer Gas Chromatograph (GC) equipped with 63Ni Electron Capture Detector. The column used was Elite-GC DB-5, 60 m and 0.25 mm internal diameter. Quantification of all OCP residues in each sample was done by comparing the peak area with those obtained from a chromatogram of a mixed OCPs standard (Supelco, Sigma–Aldrich) of known concentration. Limit of detection for each OCP was 4 pg mL1. For quality control, about 10% of the samples were randomly selected and spiked in triplicate to assess the inter assay and intra assay

variations; these were found to be within reasonable limits. The average recoveries of fortified samples exceeded 95%. For the purpose of external quality control, OCPs identification and quantification in about 10% of randomly selected samples was confirmed by GC–MS at Central Pollution Control Board, New Delhi. 2.5. Statistical analysis All statistical comparisons were performed using SPSS software (version 17.0 for Windows; SPSS, Chicago, IL) at Department of Biostatistics and Medical Information, UCMS and GTB Hospital, Delhi. Odds ratios (ORs) and 95% confidence interval (CI) for different polymorphisms were computed by logistic regression. v2 test was used to check Hardy Wienberg equilibrium for allele frequency of different polymorphism. The distribution of population characteristics for study groups were compared by Fischer exact test and student t-test. For OCP levels, data was analyzed by

V. Kumar et al. / Chemosphere 108 (2014) 40–45

student unpaired ‘t’-test and the levels were expressed as mean ± standard deviation and 25th, 50th and 75th percentiles. A p-value of <0.05 was considered statistically significant for all the tests. 3. Results Socio-demographic features of BPH patients and control subjects are compared in Table 2. Significantly higher frequency of unmarried men and incidence of OCPs exposure was observed in BPH group as compared to controls (p-values = 0.01 and 0.02 respectively). As expected, the prostate volumes were also significantly different amongst the study groups (p-value = 0.001). Other features in both subjects groups were observed to be similar. The genotypic frequencies for all polymorphism were in agreement with Hardy–Weinberg equilibrium equation. The data of genetic polymorphism of CYP1A1, CYP1B1 and CYP17 amongst the study groups are presented in Table 3. The frequencies of CYP1A1 (m1 and m2), CYP1B1 (⁄2, ⁄3, ⁄4 and ⁄7) were not significantly different amongst study groups. However, frequency of CYP17 polymorphism was significantly higher in BPH patients compared to controls (p-value = 0.03). Mean OCP levels (ng mL1) were compared amongst the study groups (Table 4). However, it was observed that the distribution of subjects with different OCP loads were not in the Gaussian pattern. Hence, the 25th, 50th and 75th percentiles are also shown in the table. We observed that, mean levels of p,p0 -DDE and endosulfan a were significantly higher in BPH patients as compared to control group (p-values = 0.001 and 0.03 respectively) suggesting an association between the two pesticides and BPH. Several other OCPs like endosulfan b, dieldrin and a-HCH also showed presence of higher levels BPH patients but the differences were not significant. Amongst BPH group p,p0 -DDE, p,p0 -DDT, dieldrin, c-HCH and a-HCH were detected in all cases. Whereas, in control group p,p0 DDT, p,p0 -DDE and c-HCH were detectable amongst all the controls. 4. Discussion Benign prostatic hyperplasia is a disorder common amongst elderly men. Evidences strongly support the role of higher circulating steroid hormone levels as risk factor for BPH. Since, circulating

Table 2 Sociodemographic characteristics of BPH and controls.

*

BPH (n = 100)

Controls (n = 100)

p-Value

Mean age ± S.D Marital status Yes No

63.9 ± 8.9

64.1 ± 7.8

0.87

82 (82) 18 (18)

94 (94) 6 (6)

0.01*

Smoking/tobacco use Yes No

21 (21) 79 (79)

26 (26) 74 (74)

0.501

Family history of BPH Yes No Prostate volume

17 (17) 83 (83) 47.0 ± 9.4

15 (15) 85 (85) 16.4 ± 2.3

0.82

Occupational exposure of pesticides Yes No

11 (11) 89 (89)

5 (5) 95 (95)

0.02*

Physical activity Low/moderate Strenuous/very strenuous

76 (76) 24 (24)

79 (79) 21 (21)

0.89

= Significant at p < 0.05.

0.001*

43

steroid hormone levels like estrogen and testosterone are age dependent, increase in prostate volume is somewhat age dependent and may lead to BPH (Joseph et al., 2002). Several other factors, both genetic and environmental, may play a role in regulating blood levels of circulating steroidal hormones. Thus, genes involved in the metabolic pathways of these hormones, if expressed differentially may alter the risk of development of BPH. To the best of our knowledge, only a few studies have analyzed the role of genes involved in steroidal hormone metabolism with BPH risk; furthermore, results of these studies have been mixed and inconclusive (Konwar et al., 2008; Habuchi et al., 2000). In this study, we found significantly higher association of CYP17 polymorphism with BPH patients compared to controls. CYP17 is highly expressed in the human prostate gland and plays an important role in metabolism of steroidal hormones; hence CYP17 polymorphisms which cause changes in enzymatic activity may alter the metabolism of steroidal hormones, possibly altering BPH risk (Ellem et al., 2004). In one previous study from our laboratory, frequency of CYP17 polymorphism was found to be significantly high among subjects with hypospadias, which is also a congenital defect resulting from alterations in maternal/fetal steroid hormone levels (Yadav et al., 2011). A report in Japanese population also claimed that CYP17 polymorphism was associated with increased risk of both BPH and prostate cancer (Habuchi et al., 2000). However, a Chinese population based study did not find any significant association between CYP17 polymorphism and BPH risk (Madigan et al., 2003). Thus, with present day knowledge, the risk of BPH should be evaluated with caution in the light of CYP17 polymorphisms. In our study we did not find any association of CYP1A1 and CYP1B1 polymorphism with BPH risk. Although these two genes are responsible for estrogen hydroxylation, they were not observed to be associated with BPH risk. However, further work is needed to be done in this aspect. Amongst the socio-demographic and environmental factors evaluated in this study, marital status and occupational exposure to OCPs were observed to be associated with BPH (Table 2). Significant association of occupational exposure with BPH strengthens our hypothesis that OCPs might increase the risk of BPH however, the role of marital status needs to be investigated further before any conclusions are drawn. Surprisingly, no association has been observed between BPH and smoking. Some studies have reported that male cigarette smoking is associated with higher plasma testosterone concentrations in males (Svartberg and Jorde, 2007). It is likely that higher testosterone concentrations may decrease BPH risk. In the next part of our study we concentrated on studying the association of OCPs with BPH. The mean levels of OCPs in the present study were in agreement with previous recent reports from India (Bhatnagar et al., 2004; Pathak et al., 2009; Kumar et al., 2010; Shekharyadav et al., 2011; Siddharth et al., 2012). Studies have consistently associated OCPs with various hormone mediated cancers (Diamanti-Kandarakis et al., 2009; Kumar et al., 2010). However, to the best of our knowledge no study till date demonstrates the association of endocrine disrupting OCPs with BPH. In one study occupational exposure to OCPs was not found to be associated with BPH risk, however, the levels of various types of OCPs was not measured (Fritschi et al., 2007). In a recent study, exposure to such chemicals is reported to increase risk of benign breast disorders in females (Fenton, 2006). It is likely that these chemicals can increase BPH susceptibility. In the present study significantly higher levels of p,p0 -DDE and endosulfan a were observed as compared to controls (Table 4). These compounds are known to possess xenoestrogenic properties (Sonnenschein and Soto, 1998; Diamanti-Kandarakis et al., 2009). Previously, p,p0 -DDE was reported to increase proliferation of steroidal hormone dependent MCF-7 breast cancer cell lines

44

V. Kumar et al. / Chemosphere 108 (2014) 40–45

Table 3 Frequencies of CYP1A1, CYP1B1 and CYP17 genotypes among BPH and controls. Genotype

BPH No. (%)

Control No. (%)

OR (95% CI)

p-Value

CYP1A1 m1 wt/wt wt/mt mt/mt

23 (23) 49 (49) 28 (28)

26 (26) 44 (44) 30 (30)

1.00 0.79 (0.40–1.58) 0.95 (0.32–1.90)

0.56 0.83

CYP1A1 m2 wt/wt wt/mt mt/mt

28 (28) 52 (52) 20 (20)

33 (33) 48 (48) 19 (19)

1.00 0.78 (0.41–1.48) 0.80 (0.36–1.80)

0.45 0.61

CYP1B1⁄2 (Arg48gly & Ala119Ser) wt/wt wt/mt mt/mt

31 (31) 52 (52) 17 (17)

31 (31) 55 (55) 14 (14)

1.00 1.05 (0.56–1.98) 0.82 (0.34 –1.95)

0.88 0.79

CYP1B1⁄3 wt/wt wt/mt mt/mt

29 (29) 41 (41) 30 (30)

30 (30) 43 (43) 27 (27)

1.00 1.01 (0.52–1.97) 0.87 (0.41–1.80)

0.90 0.70

CYP1B1⁄4 wt/wt wt/mt mt/mt

35 (35) 55 (55) 10 (10)

35 (35) 53 (53) 12 (12)

1.00 0.96 (0.52–1.75) 1.2 (0.46–3.13)

0.90 0.71

CYP1B1⁄7 wt/wt wt/mt mt/mt

31 (31) 57 (57) 12 (12)

36 (36) 52 (52) 12 (12)

1.00 0.78 (0.42–1.44) 0.86 (0.34–2.19)

0.43 0.75

CYP17 wt/wt wt/mt mt/mt

26 (26) 50 (50) 24 (24)

28 (28) 58 (58) 14 (14)

1.00 1.07 (0.56–2.07) 0.54 (0.23–1.26)

0.92 0.03*

OR: Odds ratio; CI: confidence of interval; wt/wt: homozygous wild genotype; wt/mt: heterozygous genotype; mt/mt: heterozygous mutant genotype. * = Significant at p-value <0.05.

Table 4 OCP levels in BPH and control subjects (ng mL1). BPH (n = 100)

a-HCH b- HCH c- HCH T- HCH Dieldrin Endosulfan a Endosulfan b p,p0 -DDE p,p0 -DDT

Control (n = 100)

p-Value

Minimum

Maximum

Mean ± SD

25%

50%

75%

Minimum

Maximum

Mean ± SD

25%

50%

75%

0.26 0.00 0.21 5.92 0.31 0.00 0.00 0.39 0.32

14.32 19.8 17.9 31.88 8.5 10.0 7.59 6.58 8.25

5.4 ± 3.5 4.8 ± 4.3 3.9 ± 4.4 14.1 ± 7.1 1.8 ± 1.3 2.6 ± 2.6 1.5 ± 1.0 2.6 ± 1.3 1.9 ± 1.7

2.49 1.51 0.7 8.64 1.26 0..002 0.002 1.58 0.78

4.11 3.81 2.69 12.80 1.44 1.67 1.29 2.36 1.65

7.69 7.87 4.55 18.10 2.31 2.57 1.81 3.41 2.78

0.00 0.00 0.32 3.92 0.00 0.00 0.00 0.37 0.16

9.43 10.74 11.42 22.3 3.22 4.12 5.36 4.19 7.73

5.2 ± 2.8 4.8 ± 3.4 4.3 ± 4.0 14.4 ± 5.6 1.4 ± 1.1 1.9 ± 2.0 1.4 ± 1.4 1.6 ± 1.2 2.2 ± 2.0

3.2 2.45 1.65 9.94 0.57 0.31 1.12 1.1 0.49

4.85 4.25 2.93 12.86 1.31 2.12 2.23 1.5 1.36

6.54 5.95 6.23 17.55 1.77 3.60 3.19 2.2 2.34

0.70 0.89 0.10 0.78 0.44 0.03* 0.63 0.001* 0.53

HCH: Hexachlorocyclohexane ; T-HCH (total endosulfan) is sum of a, b & c-HCH. = Significant at p < 0.05; 25% = 25th percentile, 50% = 50th percentile, 75% = 75th percentile.

*

(Aubé et al., 2008). A similar study showed that endosulfan leads to cell proliferation in the breast cancer cell line (Li et al., 2006). Therefore, these compounds may possibly increase cell proliferation in steroidal hormone sensitive human prostate which may lead to higher BPH risk. One of our previous studies has demonstrated significant association of some endocrine disrupting xenoestrogenic OCPs with risk of prostate cancer (Kumar et al., 2010). Moreover, in a recent study bisphenol A, a known xenoestrogen, was reported to increase the risk of BPH (Maffini et al., 2006). These studies further support our hypothesis and emphasises the role of xenostrogens in both benign and malignant prostate disorders.

our knowledge in this area. This is the first study to analyze both genetic and environmental factors related to steroidal hormones in BPH susceptibility. Like every study this study had some limitations, strict exclusion criteria (history of any disease and disorder, chronic liver dysfunction) limited our sample size. This prevents us from drawing any firm conclusion. Further studies with larger sample size are required to elucidate the individual role of each of these factors in BPH. Deep understanding of such factors will help us to not only pinpoint the attributes which are responsible for BPH development but also its prevention and/or developing strategies for therapeutic intervention for better life quality among elder men.

5. Conclusion Conflict of Interests Both genetic and environmental factors are known to increase BPH susceptibility, still it has remained less explored, limiting

None.

V. Kumar et al. / Chemosphere 108 (2014) 40–45

References Aklillu, E., Oscarson, M., Hidestrand, M., Liedvik, B., Otter, C., Ingelman-Sundberg, M., 2002. Functional analysis of six different polymorphic CYP1B1 enzyme variants found in an Ethiopian population. Mol. Pharmacol. 61, 586–594. Androutsopoulos, V.P., Tsatsakis, A.M., Spandidos, D.A., 2009. Cytochrome P450 CYP1A1: wider roles in cancer progression and prevention. BMC Cancer. 9, 187. Aubé, M., Larochelle, C., Ayotte, P., 2008. 1,1-dichloro-2,2-bis(pchlorophenyl)ethylene (p,p0 -DDE) disrupts the estrogen-androgen balance regulating the growth of hormone-dependent breast cancer cells. Breast Cancer Res. 10 (1), R16. Bhatnagar, V.K., Kashyap, R., Zaidi, S.S.A., Kulkarni, P.K., Saiyed, H.N., 2004. Levels of DDT, HCH and HCB residues in human blood in Ahmedabad, India. Bull. Environ. Contam. Toxicol. 72, 261–265. Bush, B., Snow, J., Koblintz, R., 1984. Polychlorobiphenyl (PCB) congeners, p,p0-DDE and hexachlorobenzene in maternal and fetal cord blood from mothers in upstate New York. Arch. Environ. Contam. Toxicol. 13, 517–527. Diamanti-Kandarakis, E., Bourguignon, J.P., Giudice, L.C., Hauser, R., Prins, G.S., Soto, A.M., Zoeller, R.T., Gore, A.C., 2009. Endocrine-disrupting chemicals: an Endocrine society scientific statement. Endocr. Rev. 30, 293–342. Ellem, S.J., Schmitt, J.F., Pedersen, J.S., Frydenberg, M., Risbridger, G.P., 2004. Local aromatase expression in human prostate is altered in malignancy. J. Clin. Endocrinol. Metab. 89, 2434–2441. Fenton, S.E., 2006. Endocrine-disrupting compounds and mammary gland development: early exposure and later life consequences. Endocrinology 147, S18–S24. Fritschi, L., Glass, D.C., Tabrizi, J.S., Leavy, J.E., Ambrosini, G.L., 2007. Occupational risk factors for prostate cancer and benign prostatic hyperplasia: a case–control study in Western Australia. Occup. Environ. Med. 64, 60–65. Gray Jr., L.E., 1998. Xenoendocrine disrupters: laboratory studies on male reproductive effects. Toxicol. Lett. 102–103, 331–335. Habuchi, T., Liqing, Z., Suzuki, T., Sasaki, R., Tsuchiya, N., Tachiki, H., Shimoda, N., Satoh, S., Sato, K., Kakehi, Y., Kamoto, T., Ogawa, O., Kato, T., 2000. Increased risk of prostate cancer and benign prostatic hyperplasia associated with a CYP17 gene polymorphism with a gene dosage effect. Cancer Res. 60, 5710– 5713. Joseph, M.A., Wei, J.T., Harlow, S.D., Cooney, K.A., Dunn, R.L., Jaffe, C.A., Montie, J.E., Schottenfeld, D., 2002. Relationship of serum sex-steroid hormones and prostate volume in African American men. Prostate 53, 322–329. Kisselev, P., Schunck, W.H., Roots, I., Schwarz, D., 2005. Association of CYP1A1 polymorphisms with differential metabolic activation of 17beta-estradiol and estrone. Cancer Res. 65, 2972–2978. Konwar, R., Chattopadhyay, N., Bid, H.K., 2008. Genetic polymorphism and pathogenesis of benign prostatic hyperplasia. BJU Int. 102, 536–543. Kumar, V., Singh, S., Ahmed, R.S., Banerjee, B.D., Ahmed, T., Pasha, S.T., 2009. Frequency of CYP1B1 polymorphic variation in North Indian population. Environ. Toxicol. Pharmacol. 28, 392–396. Kumar, V., Yadav, C.S., Singh, S., Goel, S., Ahmed, R.S., Gupta, S., Grover, R.K., Banerjee, B.D., 2010. CYP 1A1 polymorphism and organochlorine pesticides levels in the etiology of prostate cancer. Chemosphere 81, 464–468. Kumar, V., Yadav, C.S., Datta, S.K., Singh, S., Ahmed, R.S., Goel, S., Gupta, S., Mustafa, M., Grover, R.K., Banerjee, B.D., 2011. Association of GSTM1 and GSTT1

45

polymorphism with lipid peroxidation in benign prostate hyperplasia and prostate cancer: a pilot study. Dis. Markers 30, 163–169. Li, X., Zhang, S., Safe, S., 2006. Activation of kinase pathways in MCF-7 cells by 17beta-estradiol and structurally diverse estrogenic compounds. J. Steroid Biochem. Mol. Biol. 98, 122–132. Madigan, M.P., Gao, Y.T., Deng, J., Pfeiffer, R.M., Chang, B.L., Zheng, S., Meyers, D.A., Stanczyk, F.Z., Xu, J., Hsing, A.W., 2003. CYP17 polymorphisms in relation to risks of prostate cancer and benign prostatic hyperplasia: a population-based study in China. Int. J. Cancer 107, 271–275. Maffini, M., Rubin, B., Sonnenschein, C., Soto, A., 2006. Endocrine disruptors and reproductive health: the case of bisphenol-A. Mol. Cell. Endocrinol. 254–255, 179–186. Marinkovic´, N., Pasalic´, D., Potocki, S., 2013. Polymorphisms of genes involved in polycyclic aromatic hydrocarbons’ biotransformation and atherosclerosis. Biochem. Med. (Zagreb). 23, 255–265. Parsons, J.K., Carter, B.H., Partin, A.W., Windham, B.G., Metter, J., Ferrucci, L., Landis, P., Platz, E.A., 2006. Metabolic factors associated with benign prostatic hyperplasia. J. Clin. Endocrinol. Metab. 9, 2562–2568. Pathak, R., Ahmed, R.S., Tripathi, A.K., Guleria, K., Sharma, C.S., Makhijani, S.D., Banerjee, B.D., 2009. Maternal and cord blood levels of organochlorine pesticides: association with preterm labor. Clin. Biochem. 42, 746–749. Sharp, L., Cardy, A.H., Cotton, S.C., Little, J., 2004. CYP17 gene polymorphisms: prevalence and associations with hormone levels and related factors. A HuGE Review. Am. J. Epidemiol. 160, 729–740. Shekharyadav, C., Bajpai, M., Kumar, V., Ahmed, R.S., Gupta, P., Banerjee, B.D., 2011. Polymorphism in CYP1A1, GSTMI, GSTT1 genes and organochlorine pesticides in the etiology of hypospadias. Hum. Exp. Toxicol. 30, 1464–1474. Siddharth, M., Datta, S.K., Bansal, S., Mustafa, M., Banerjee, B.D., Kalra, O.P., Tripathi, A.K., 2012. Study on organochlorine pesticide levels in chronic kidney disease patients: association with estimated glomerular filtration rate and oxidative stress. J. Biochem. Mol. Toxicol. 26, 241–247. Singh, S., Kumar, V., Vashisht, K., Singh, P., Banerjee, B.D., Rautela, R.S., Grover, S.S., Rawat, D.S., Pasha, S.T., Jain, S.K., Rai, A., 2011. Role of genetic polymorphisms of CYP1A1, CYP3A5, CYP2C9, CYP2D6, and PON1 in the modulation of DNA damage in workers occupationally exposed to organophosphate pesticides. Toxicol. Appl. Pharmacol. 257, 84–92. Sonnenschein, C., Soto, A.M., 1998. An updated review of environmental estrogen and androgen mimics and antagonists. J. Steroid Biochem. Mol. Biol. 65, 143– 150. Svartberg, J., Jorde, R., 2007. Endogenous testosterone levels and smoking in men. The fifth Tromsø study. Int. J. Androl. 30, 137–143. Tsatsakis, A.M., Zafiropoulos, A., Tzatzarakis, M.N., Tzanakakis, G.N., Kafatos, A., 2009. Relation of PON1 and CYP1A1 genetic polymorphisms to clinical findings in a cross-sectional study of a Greek rural population professionally exposed to pesticides. Toxicol. Lett. 186, 66–72. Williams, J.A., Martin, F.L., Muir, G.H., Hewer, A., Grover, P.L., Phillips, D.H., 2000. Metabolic activation of carcinogens and expression of various cytochromes P450 in human prostate tissue. Carcinogenesis 21, 1683–1689. Yadav, C.S., Bajpai, M., Kumar, V., Datta, S.K., Ahmed, R.S., Gupta, P., Banerjee, B.D., 2011. Polymorphisms in the P450 c17 (17-Hydroxylase/17, 20-Lyase) gene: association with estradiol and testosterone concentration in Hypospadias. Urology 78, 902–907.