Autism with Seizures and Intellectual Disability: Possible Causative Role of Gain-of-function of the Inwardly-Rectifying K+ Channel Kir4.1

Neurobiology of Disease 43 (2011) 239–247

Contents lists available at ScienceDirect

Neurobiology of Disease j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y n b d i

Autism with Seizures and Intellectual Disability: Possible Causative Role of Gain-of-function of the Inwardly-Rectifying K+ Channel Kir4.1 Federico Sicca a,⁎, Paola Imbrici b,1, Maria Cristina D'Adamo b,1, Francesca Moro c,1, Fabrizia Bonatti c, Paola Brovedani a, Alessandro Grottesi d, Renzo Guerrini a,e, Gabriele Masi f, Filippo Maria Santorelli c, Mauro Pessia b a

Epilepsy, Neurophysiology and Neurogenetics Unit, IRCCS Stella Maris Foundation, Via dei Giacinti 2, 56128, Calambrone, Pisa, Italy Section of Human Physiology, University of Perugia School of Medicine, Via del Giochetto 1, 06126, Perugia, Italy c Molecular Medicine Unit, IRCCS Stella Maris Foundation, Via dei Giacinti 2, 56128, Calambrone, Pisa, Italy d Computational Chemistry and Biology Group, CASPUR (Inter-University Consortium for the Application of Super-Computing for Universities and Research), Via dei Tizii 6, 00185, Rome, Italy e Child Neurology Unit, A. Meyer Pediatric Hospital, University of Florence, Viale Pieraccini 24, 50139, Florence, Italy f Child Psychiatry and Psychopharmacology Unit, IRCCS Stella Maris Foundation, Via dei Giacinti 2, 56128, Calambrone, Pisa, Italy b

a r t i c l e

i n f o

Article history: Received 29 December 2010 Revised 26 February 2011 Accepted 19 March 2011 Available online 31 March 2011 Keywords: Kir4.1 KCNJ10 Autism Seizures Epilepsy Intellectual disability Mental retardation

a b s t r a c t The inwardly-rectifying potassium channel Kir4.1 is a major player in the astrocyte-mediated regulation of [K+]o in the brain, which is essential for normal neuronal activity and synaptic functioning. KCNJ10, encoding Kir4.1, has been recently linked to seizure susceptibility in humans and mice, and is a possible candidate gene for Autism Spectrum Disorders (ASD). In this study, we performed a mutational screening of KCNJ10 in 52 patients with epilepsy of “unknown cause” associated with impairment of either cognitive or communicative abilities, or both. Among them, 14 patients fitted the diagnostic criteria for ASD. We identified two heterozygous KCNJ10 mutations (p.R18Q and p.V84M) in three children (two unrelated families) with seizures, ASD, and intellectual disability. The mutations replaced amino acid residues that are highly conserved throughout evolution and were undetected in about 500 healthy chromosomes. The effects of mutations on channel activity were functionally assayed using a heterologous expression system. These studies indicated that the molecular mechanism contributing to the disorder relates to an increase in either surface-expression or conductance of the Kir4.1 channel. Unlike previous syndromic associations of genetic variants in KCNJ10, the pure neuropsychiatric phenotype in our patients suggests that the new mutations affect K+ homeostasis mainly in the brain, by acting through gain-of-function defects. Dysfunction in astrocytic-dependent K+ buffering may contribute to autism/ epilepsy phenotype, by altering neuronal excitability and synaptic function, and may represent a new target for novel therapeutic approaches. © 2011 Elsevier Inc. All rights reserved.

Introduction In the last decade, gene defects have been identified that cause different forms of epilepsy, and most of these genes code for ion channels (Helbig et al., 2008). Among those, the inwardly-rectifying potassium (Kir) channel 4.1 (Kir4.1) is receiving increasing interest. Alterations of the Kir4.1 channel have been recently linked to seizure susceptibility in both mice (Ferraro et al., 2004) and humans (Buono ⁎ Corresponding author. Fax: + 39050886247. E-mail addresses: [email protected] (F. Sicca), [email protected] (P. Imbrici), [email protected] (M.C. D'Adamo), [email protected] (F. Moro), [email protected] (F. Bonatti), [email protected] (P. Brovedani), [email protected] (A. Grottesi), [email protected] (R. Guerrini), [email protected] (G. Masi), [email protected] (F.M. Santorelli), [email protected] (M. Pessia). 1 These authors contributed equally to the manuscript. Available online on ScienceDirect (www.sciencedirect.com). 0969-9961/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.nbd.2011.03.016

et al., 2004). Conditional knockout mice lacking Kir4.1 in astrocytes have been found to display premature lethality and severe seizures prior to death (Djukic et al., 2007), supporting the idea of a pathophysiological relationship of Kir4.1 channel impairment with epilepsy. Moreover, loss-of-function recessive mutations of KCNJ10 (Kir4.1) have been recently associated with a syndrome consisting of seizures, ataxia, sensorineural deafness, mental retardation, and renal salt-losing tubulopathy in two independent studies (EAST syndrome [Bockenhauer et al., 2009]; SeSAME syndrome [Scholl et al., 2009]). Kir4.1 channels are expressed primarily in oligodendrocytes and in astrocytes surrounding synapses and blood vessels, mainly in the cortex, thalamus, hippocampus, and brainstem (Higashi et al., 2001; Takumi et al., 1995). They control the resting membrane potential of astrocytes and are believed to maintain the extracellular ionic and osmotic environment by promoting K+ transport from regions of high [K+]o, which results from synaptic excitation, to those of low [K+]o. This polarized transport of K+ in astrocytes, referred to as “spatial

240

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247

buffering of K+,” is essential for normal neuronal activity, excitability, and synaptic functions. A Kir subunit possesses two transmembrane domains (TM) separated by a loop sequence that comprises the selectivity filter (see Fig. 1). Kir channels may exist as homomers, whenever four identical α-subunits are assembled. However, Kir4.1 may polymerize with Kir5.1 (KCNJ16) (Bond et al., 1994; Pessia et al., 1996) to form heterotetramers with properties that are different from the parental homomeric channels. Heteromeric Kir4.1/Kir5.1 channels are abundantly expressed in the brainstem, mostly in the locus coeruleus (LC) (Wu et al., 2004), and in the renal tubular epithelia where they contribute to K+ recycling (Tucker et al., 2000). In this study, we have investigated the frequency of KCNJ10 and KCNJ16 variants in a cohort of patients in whom epilepsy of “unknown cause” was associated with impairment of either cognitive or communicative abilities, or both. We detected new heterozygous mutations of KCNJ10 in three children in two unrelated families displaying seizures, Autism Spectrum Disorders (ASD) and intellectual disability. The functional consequences of these mutations appear to be a gain-of-function mechanism of either Kir4.1 or Kir4.1/Kir5.1

channels. Collectively, our findings point to a new class of genes that should be examined in autism/epilepsy patients and provide novel molecular mechanisms that may increase the susceptibility to this distinct neuropsychiatric phenotype by altering the K+ homeostasis in the brain. Materials and methods Patients Mutation analyses of KCNJ10 and KCNJ16 were performed in 52 patients (34 boys and 18 girls, median age 10.0 ± 4.9 years, range 2.3–24.4 years) with epilepsy of “unknown cause” associated with impairment of either cognitive or communicative abilities, or both. There were forty-six sporadic patients and three affected sib pairs. The term epilepsy of “unknown cause” indicated that seizures were not the result of known brain damage, structural abnormalities or other neurological disorders; clinical and EEG findings, moreover, were not characteristic of idiopathic epilepsy syndromes. Brain MRI was normal

Fig. 1. Pedigrees of Family A and Family B and Sequence Analysis. (A) Pedigrees of two families harboring novel mutations in KCNJ10. Squares are males and circles females; solid black symbols represent propositi; slashes denote deceased individual. (B) Mutation detection by sequencing. Electropherograms of exon 2 flanking the mutations in KCNJ10 in unaffected individuals (WT) and propositi in affected kindred (A-III:1, B-III:1). The positions of the heterozygous mutations are arrow-headed and the predicted effect of the mutation is shown below. Patient A-III:1 displayed a heterozygous c.53G N A transition, predicting a novel non-synonymous p.R18Q variant. This mutation was also identified in patient A-III:2. Patient B-III:1 harbored a heterozygous c.250G N A transition predicting a novel p.V84M. (C) Computational prediction. Full-length orthologous and paralogous protein sequences of the KCNJ10 gene from vertebrate were aligned using ClustalW algorithm. GeneBank accession numbers for orthologous and paralogous were: NP_002232.2 (human KCNJ10), XP_001115293.2 (macaca), XP_513920.2 (pantroglodytes), NP_001034573.1 (mouse), NP_113790.1 (rattus), NP_001075070.1 (bos taurus), AAW30192.1 (sus scrofa), NP_001072312.1 (Xenopus tropicalis). (D) Schematic representation of the human Kir 4.1 subunit which is composed of a pore delimiting region (S1-H5 loop-S2), with both the N- and C-termini residing inside the cell. The p.R18Q variant lies in the cytoplasmic N-terminus domain, whereas the p.V84M variant is located in the M1 transmembrane domain.

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247

in 39 patients, whereas 13 subjects had mild abnormalities (delayed myelination in four, cerebellar hypoplasia in two patients, and a combination of both in two other subjects; acquired microcephaly in two; corpus callosum hypoplasia in two, brainstem hypoplasia in one patient). Nonetheless, MRI findings were insufficient to assign a specific epilepsy etiology. At epilepsy onset, 23 children had infantile spasms, 20 had focal seizures, and nine patients had generalized seizures (tonic, tonic–clonic, myoclonic, atypical absences). In addition to seizures, all patients had other signs of severe neurological dysfunction, such as intellectual disability or impairment of communicative abilities, or both. When assessed by standardized evaluation, intellectual disability was present in 45 patients (mild-to-moderate in 22, severe-to-profound in 23), whereas three subjects had normal cognitive level. We included the latter cases because they had severe communicative and relational problems, which were not satisfactorily justified by the epileptic process. Four subjects, referred for infantile spasms of “unknown cause” and intellectual disability, could not be assessed by standardized cognitive evaluation. Fourteen patients fitted the diagnostic DSM-IV-TR criteria for ASD. Various degrees of impairment of motor functions were also observed in 31 patients (motor retardation\clumsiness in 19, ataxia in two, severe movement disorder in one case, spastic\dyscinetic quadriparesis in nine patients). Mutations in other genes known to be associated with epilepsy and mental retardation had previously been excluded in 21 patients (CDKL5 in three, ARX in 11, and both genes in seven). In three additional subjects, we subsequently identified pathogenic mutations in CDKL5, SCN1A, and SLC2A1 in one case each. In another subject, CGH-array analysis detected a deletion on chromosome 22p. All patients or their legal representatives signed informed consent prior to enrolment. The local Institutional Review Board approved this study.

Molecular genetic analyses Genomic DNA from total blood samples obtained from patients was isolated using standard extraction protocols. The coding exons and exon–intron boundaries of KCNJ10 (NM_002241, NG_016411) and KCNJ16 (NM_018658) were amplified by polymerase chain reaction (PCR) amplification using primer oligonucleotides designed with Primer 3 (see Table 1; PCR conditions are available upon request). The PCR products were subjected to denaturing high-performance liquid chromatography (Wave Fragment Analysis 3500A, Transgenomic, Santa Clara, CA) or purified with ExoSap (USB, Cleveland, OH)

241

and bidirectionally sequenced using the BigDye v3.1 chemistry (Applied Biosystems Foster City, CA), or a combination of the two. For the description of the mutations we used the latest conventions of the Human Genome Variation Society nomenclature. Synonymous, missense and splice site variations were systematically evaluated for modifications of exonic splicing enhancers (Polyphen analysis, http://genetics.bwh.harvard.edu/pph/; ESEfinder, www.rulai.cshl.edu/cgi-bin/tools/ESE/esefinder.cgi) or consensus splicing sequences in order to determine the splice site score (http://rulai.cshl.edu/new_alt_exon_db2/HTML/score.html and www.fruitfly.org/seq_tools/splice.html). Multiple alignments with Kir4.1 orthologs were performed using ClustalW (www.ebi.ac.uk/ clustalw/) to evaluate the degree of conservation of missense variants. For the p.R18Q and p.V84M mutations, 280 Italian and three large cohorts of pooled genomic DNA samples (NA16129, NA1660, and NA16601) of different ethnicities from the Coriell Institute for Medical Research (Camden, NJ) were screened. To establish gene dosage, we determined the relative fluorescence of two probes in the KCNJ10 gene using SYBR Green in a quantitative real time-PCR (q-PCR) protocol (Applied Biosystems, Foster City, CA) and the comparative Ct method (Livak and Schmittgen, 2001). Electrophysiology Animal handling and care were done in accordance with the regulations of the Italian Animal Welfare Act, approved by the local Veterinary Service Authority, and with the NIH Guide for the Care and Use of Laboratory Animals. The human Kir4.1 cDNA was subcloned into an oocyte expression vector, and mutations were introduced by site-directed mutagenesis. The nucleotide sequences of all constructs were determined by automated sequencing. The concentration of the in vitro transcribed complementary RNA (cRNA) was quantified by electrophoresis and ethidium bromide staining, and spectrophotometric analysis. The expression of wild-type and mutant channels in Xenopus laevis oocytes, the two-electrode voltage-clamp recordings (TEVC), and patch-clamp recordings were performed as previously described (D'Adamo et al., 1998; Tucker et al., 2000). Channel activity was analyzed with a TAC-TAC fit program (Bruxton Co. WA, USA) using the 50% threshold technique to determine the event amplitude. Channel openings were visually inspected before being accepted (event-by-event mode). Intracellular acidification was achieved using a K-acetate buffering system as previously described (Pessia et al., 2001). Homology modeling

Table 1 KCNJ10 and KCNJ16 primers used for PCR and sequencing reactions. Oligonucleotide sequences

PCR size (bp)

PCR Ta (°C)

KCNJ10-1F 5′ aagaacacataagcgacattca 3′ KCNJ10-1R 5′ catgtgccacagctaccaga 3′ KCNJ10-2F 5′ caggcacatggttcctcttt 3′ KCNJ10-2R 5′ ggcaactcggatcatgagg 3′ KCNJ10-3F 5′ gggctgagaccattcgttt 3′ KCNJ10-3R 5′ ctctggcaggtaggaagtgc 3′ KCNJ10-4F 5′ gtgactttgagctggtgctg 3′ KCNJ10-4R 5′ ttaccagggcattggaagag 3′ KCNJ16-6AF 5′ tggtatgacactgctccaaa 3′ KCNJ16-6AR 5′ atatggcgccacttggtgt 3′ KCNJ16-6BF 5′ tggagaatggggaagctatg 3′ KCNJ16-6BR 5′ aggcaaagcttcccatctct 3′ KCNJ16-6CF 5′ ggcaactgctcgaaagagag 3′ KCNJ16-6CR 5′ cttccacacttccttcaaactg 3′ KCNJ16-6DF 5′ aattctctggggccataggt 3′ KCNJ16-6DR 5′ cccagcatcatcataaaaca 3′ KCNJ16-6EF 5′ ttcagccaatcaagtcgttg3′ KCNJ16-6ER 5′ gcttactgaatgcatcttttgc 3′

395

59 then 55

377

59 then 55

386

59 then 55

378

59 then 55

400

59 then 55

424

59 then 55

489

59 then 55

465

59 then 55

421

59 then 55

Ta: annealing temperature.

The 3D structure of hetero-tetramer Kir4.1/5.1 was built through comparative modeling using the software Modeller (Sali and Blundell, 1993). The X-ray structure of the Kir3.1-prokaryotic Kir channel chimera (PDB id.: 2QKS) was used as a template (Nishida et al., 2007). Sequence alignment of the target sequence vs. the template was generated using ClustalX, and further refined using Muscle (Edgar, 2004); the calculated percentage of identity on the aligned sequences was 36.7%, while the similarity was 66.3%; only residues 25–349 of the Kir4.1 primary structure and residues 31–347 of the Kir5.1 sequence could be aligned with the corresponding segments of the X-ray template. Twenty homology models were generated and scored against the minimum number of constraint violations. Among them, the five lowest energy models were selected and analyzed using Procheck (Laskowski et al., 1993). The final model was chosen according to the highest percentage of residues in the allowed region of the Ramachandran plot (N90%). The model was then immersed in a preequilibrated patch of palmitoyl-oleoyl-phosphatidylcholine (POPC) lipids bilayer, and all overlapping lipid molecules (within 3 Å from any protein atoms) were removed. Lastly, the V84M mutant was

242

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247

generated by substituting the Val-84 side-chain with the methionine one using VMD (Humphrey et al., 1996). The final model was further minimized to reduce steric hindrance with neighboring atoms using GROMACS4 and the GROMOS96 forcefield (Hess et al., 2008). Results Clinical findings Family A Patients A-III:1 and A-III:2 (Fig. 1A) are 8-year-old identical twins born from unrelated parents. At 5 months, impaired social interaction, sleep difficulties, and hypotonia were apparent for both twins. At the age of 7 months, within 24 h, both exhibited epileptic spasms that remitted under ACTH. At 10 months, Patient A-III:2 was seizure-free, whereas his twin brother had persisting seizures that stopped at 12 months on valproate-topiramate bitherapy. Both children came to our attention at that time and showed postural delay, hypotonia, nystagmus, and absence of speech. EEGs were normal while awake; sleep recordings showed posterior (Patient A-III:1) and diffuse (Patient A-III:2) slow and sharp activities, and normalized in both by the age of 3 years. Laboratory analyses (including serum electrolytes and standard urine examination), high-resolution karyotype, array-CGH and ARX mutation analyses, were normal. Somatosensory, visual, and brainstem auditory evoked potentials, audiograms and brain MRI were unremarkable. Patient A-III:1 showed persistent motor delay, clumsiness, produced his first words at 5 years; he also exhibited a severe disorder of social interaction, stereotypies, and repetitive behaviors. These symptoms fitted diagnostic DSM-IV-TR criteria for ASD. At last evaluation, at age 8 years, clear deficits in social and communicative skills, repetitive behaviors, clumsiness, and moderate mental retardation (IQ: 43) were still present. Most of such symptoms, though less severe, were also evident in patient A-III:2, who also showed ritualistic behaviors, impaired social skills, symptoms of anxiety, depression, and of obsessive–compulsive disorder, and mild mental retardation (IQ: 58). The 48-year-old mother (subject A-II:1) had a multiple tic disorder, obsessive-compulsive symptoms, mood swings with impulsivity, and motor clumsiness. No history of seizures was referred. Family B The 14-year-old propositus (B-III:1; Fig. 1A) is the first child of healthy, non-consanguineous parents. Psychomotor development was normal up to 12 months of age, when a sleep disorder, poor social gaze, no response to name, absence of language development, and withdrawal behaviors became evident. At the age of 18 months he received a diagnosis of ASD. At that time EEG, brain CT scan, auditory brainstem response, fundus oculi, karyotype and Fragile X testing were normal. At 6 years, he experienced complex partial seizures that partially responded to valproate. EEGs showed bilateral frontal paroxysms while awake and asleep, while brain MRI scan was normal. Blood count and chemistry values (including electrolytes and urine testing) were in the normal range. Autistic features progressively worsened, with severe deficit in social and communicative skills, stereotyped and repetitive behaviors, severe mental retardation, and self- and other-directed injurious behaviors. The younger sister (B-III:2) and maternal grandfather (B-I:1) are reportedly healthy but were not examined. Genetic analysis In patients A-III:1 and A-III:2 we detected a heterozygous c.53G N A mutation in KCNJ10, predicting a non-synonymous p.R18Q variant at the cytoplasmic N-terminus of human Kir4.1 (Fig. 1B, D). Patient B-III:1 harbored a heterozygous c.250G N A (p.V84M) in the first

transmembrane domain (TM1) of KCNJ10 (Fig. 1B, D). The two variants were not detected in 528 healthy chromosomes. Both mutations were inherited from the mother. In family A, the maternal grandmother (A-I:2) was wild-type. In Family B, the mutation was also detected in B-I:1 and B-III:2. The two KCNJ10 mutations are novel and were not detected in the dbSNP. They affected residues highly conserved in mammalian and vertebrate orthologs, and in Xenopus tropicalis (Fig. 1C). The presence of a large-scale rearrangement encompassing the paternal copies of KCNJ10 was ruled out in the patients with an average KCNJ10-copy number of 0.97 and 0.65 in subjects A-III:1 and B-III:1, whereas the value was 0.91 ± 0.23 in normal controls, by q-PCR analyses. In this study, we also identified a reported p.R271C heterozygous variant in two children. This variant has been identified to occur commonly in healthy individuals (Buono et al., 2004) and the functional consequences of this mutation on channel function or structure have been questioned (Shang et al., 2005). Two additional heterozygous variants in KCNJ10 were also detected (g.250T N C and g.83_88dup6). Prediction software analysis, however, indicated that the latter variants were probably not damaging. Mutation analysis of KCNJ16 only detected a heterozygous polymorphic variant (rs34408089) in four patients, including case B-III:1.

Functional characterization of homomeric and heteromeric channels harboring p.R18Q or p.V84M mutation To compare any differences in intrinsic channel properties and expression levels caused by the mutations, we used a heterologous expression system. Expression of either p.R18Q or p.V84M channels yielded currents with macroscopic kinetics similar to WT (Fig. 2A–C). Nevertheless, the current/voltage relationships for both mutant channels had larger amplitudes than WT when equal amounts of WT or mutated RNAs were expressed (n = 120; Fig. 2D, F). To mimic the heterozygous state of the disease, WT and either p.R18Q or p.V84M RNAs were co-injected (1:1 ratio) and yielded current amplitudes intermediate between homomeric WT and p.R18Q or p.V84M (Fig. 2E, G). Patch-clamp single-channel recordings revealed that the V84M mutation increased the unit conductance ~1.5 fold compared to WT (Fig. 3; n = 14). No apparent differences were observed in probability and mean time of opening between WT and p.V84M channels (data not shown). The p.R18Q mutation did not alter either the unit conductance (Fig. 3; n = 8) or the other single-channel parameters (data not shown). Taken together, these results indicate that the p.R18Q and p.V84M mutations affect current amplitudes mainly by increasing surface expression and single-channel conductance, respectively. Kir5.1 subunits assemble selectively with Kir4.1, conferring several unique properties to heteromeric Kir4.1/Kir5.1 channels as compared to homomeric Kir4.1, but most importantly they exhibit smaller instantaneous current, a time-dependent “relaxation” at hyperpolarized potentials, and a dramatic increase in sensitivity to inhibition by intracellular H+ (pHi) (Pessia et al., 1996) (compare Figs. 2A and 4A). Thus, we characterized the effects of both variants also on the biophysical properties and pHi sensitivity of heteromeric Kir4.1/Kir5.1 channels. Both mutations increased the instantaneous current and nearly nullified the slow “relaxation” component of Kir4.1/Kir5.1 channels. Conversely, their pHi sensitivity was not changed (Fig. 4A–I). Based on crystal structure data, we generated a 3D-homology model of a heteromeric Kir4.1/Kir5.1 channel. The analysis of this modeling indicated that the V84M mutation is located near the membrane/water interface of the first transmembrane segment (TM1) and revealed that the side-chain atoms of Met-84 point towards the lipid molecules of the membrane bilayer (Fig. 5). However, the position of the Arg-18 residue in the N-terminal region could not be determined due to lack of structural data.

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247

243

Fig. 2. Expression of Kir4.1 wild–type, R18Q and V84M channels. Sample current families recorded in TEVC configuration from Xenopus oocytes expressing equal amounts of Kir 4.1 WT (A), R18Q (B) or V84M (C) mRNA. K+ currents rectify strongly, activate rapidly and undergo time-dependent decay at more hyperpolarized potentials. Currents were evoked by voltage commands from a holding potential of − 10 mV, and were delivered in − 10 mV increments from + 50 to − 150 mV. The pulse protocol is shown as inset in A. Horizontal dashed lines indicate 0 current level. Average steady-state current–voltage (I/V) relationships for either WT (●) and R18Q (○) (D) or WT (●) and V84M (○) (F), when equal amount of cRNA for each channel type was expressed. Note that the I/V relationships for both R18Q and V84M had larger amplitudes than WT channels. (E, G) Average current amplitudes recorded at − 100 mV from oocytes expressing the indicated channels. The amount of cRNA injected in each group is reported in brackets. The reported bar graph is representative of 4 independent experiments performed using different batches of oocytes. The total number of oocytes examined from each group is approximately 120. Note that current amplitudes strictly depend on the amount of cRNA injected. R18Q and V84M mutations remarkably increase both homomeric and heteromeric current amplitudes. Data are mean ± SEM. The statistical significance of the differences observed was evaluated by comparing each data set with the relevant control and by using ANOVA and the unpaired Student's t test. *P values b 0.05;**P values b 0.01.

Discussion Epilepsy and ASD are strongly associated. The prevalence of seizures is overrepresented in ASD (5–46%) (Bryson et al., 1988; Hughes and Melyn, 2005), compared with the general population (0.5–1%). The prevalence of autism in the epilepsy population is approximately 32%, which is about 50 times higher than in the general population (Clarke et al., 2005). An “autism–epilepsy phenotype” has been identified and shared pathogenetic mechanisms have been hypothesized (Tuchman et al., 2009). In this study we report two new KCNJ10 mutations associated with seizures, ASD, and intellectual disability. These mutations change highly conserved residues. Reduced penetrance was observed in three apparently asymptomatic mutation carriers (B-I:1, B-II:1 and B-III:2) and in one that was mildly affected (A-II:1). Incomplete penetrance is possible in “channelopathies” (Camerino et al., 2008; Li and Lester,

2001), particularly when they affect the central nervous system (Gargus, 2009). Alternatively, occurrence of KCNJ10 variants within a more complex multigenic scenario should also be considered (Abrahams and Geschwind, 2008; Toro et al., 2010). However, we cannot exclude that other mechanisms, including methylation of the paternal allele or a parent-of-origin effect, or even other genetic or epigenetic factors may have contributed to the variable clinical expression of the mutant KCNJ10. For instance, epigenetic determinants are invoked to explain the reduced penetrance of mutations in KCNJ11 (Pinney et al., 2008). On the other hand, ASD do not follow classical Mendelian inheritance (Gupta and State, 2007) and the rate of concordance between monozygotic twins can be as low as 40% (Rosenberg et al., 2009). The psychiatric manifestations observed in case A-II:1 fit the diagnosis of Tourette Syndrome and ObsessiveCompulsive Disorder. A growing body of evidence suggests that these psychiatric disorders and ASD may share similarities in phenomenology,

244

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247

Fig. 3. Single-channel recordings of Kir4.1 wild-type, R18Q, and V84M channels. Representative recordings of WT (A), R18Q (B), and V84M (C) channels obtained at − 80 mV in a cell-attached configuration of the patch-clamp. The bottom traces are shown on an expanded time scale. Channel openings are downward deflections and arrows denote closed (C) and open (O) levels. Current traces were filtered at 0.5 kHz. Averaged sweeps with no openings were used to subtract leak and capacity currents. Single-channel current amplitudes from 6 or more different patches, recorded under several voltages, were subsequently averaged and plotted for the single-channel slope conductance calculation (G). There was no difference in single-channel conductance between WT (25.8 pS; black) and R18Q (26.1 pS; blue), whereas it was significantly increased by the V84M mutation (39.5 pS; orange). Amplitude histogram of unitary currents recorded at − 80 mV from oocytes expressing WT (D), R18Q (E) and V84M (F) channels. The histograms were constructed from stretches of recordings in which openings to only a single level were detected.

comorbidity, brain circuitry, familial, and genetic features (Hollander et al., 2009). Parents and siblings of children with ASD often show much milder, subclinical, manifestation of autism, the so-called “broad autism phenotype” (Piven et al., 1997), further suggesting that ASD can be, at least partially, linked to preexisting genetic variants in parents. The possibility that KCNJ10 might be unrelated to the phenotype cannot, of course, be excluded. ASD was not among the clinical findings associated with the EAST/ SeSAME syndrome and autosomal recessively inherited KCNJ10 mutations, and intellectual disability was not an obligate symptom of the disease. Biallelic mutations in EAST/SeSAME syndrome compromised channel function through different loss-of-function mechanisms, including decreases in surface expression, mean open time reductions and a shift of pH sensitivity to the alkaline range (Reichold et al.,

2010; Sala-Rabanal et al., 2010; Tang et al., 2010). These functional defects have been proposed to underlie the renal features of the disease, including hypokalemic metabolic alkalosis and activation of the renin–angiotensin–aldosterone system. Our patients exhibit a pure neuropsychiatric phenotype, without manifestations of renal disease or hearing impairment. Different also appear the molecular mechanisms by which the newly identified KCNJ10 mutations contribute to disease pathogenesis. In particular, the p.V84M mutation that is located in TM1, near the membrane/ water interface, mainly increased the single-channel conductance producing a gain-of-function effect. These structural and functional data suggest that this mutation may alter channel gating by modifying either the intrinsic gating machinery or the interactions between the channel and the lipids of the membrane bilayer. Interestingly, a mutation in the TM1 of Kir3.2 channels (N94H) results in constitutively active channels, and ~ 30-fold higher basal currents than WT (Yi et al., 2001). On the other hand, the p.R18Q mutation, located in the N-terminus of Kir4.1 channels, also produces a gain of channel function by increasing whole-cell current amplitudes, without changing single-channel conductance, open probability, and mean open time. All this strongly suggests that p.R18Q mainly enhances surface expression. This conclusion is further supported by structurefunction data obtained with Kir3.2 channels. The S9A mutation in Kir3.2 yielded ~ 3-fold higher surface expression than WT in HEK293 cells without changing the single-channel conductance (Chung et al., 2009). Sequence alignments revealed that both the S9A mutation in Kir3.2 and the R18Q mutation in Kir4.1 reside in a similar N-terminal domain of the channel and, possibly, may share common mechanisms of action. Both p.R18Q and p.V84M caused a dramatic increase in the instantaneous current of heteromeric Kir4.1/Kir5.1 channels and nearly abolished the slow component of the current, denoting a more efficient and faster response of the mutated channels. The fact that the pHi sensitivity of the mutated Kir4.1/Kir5.1 channels is similar to WT demonstrates that assembly of mutated Kir4.1 subunits takes place normally, regardless of the mutation. A number of arguments substantiate that variants in KCNJ10 might contribute to brain dysfunction, seizures susceptibility and ASD. Kir4.1 is the main glial inward conductance responsible for the high K+ permeability that control membrane potential and the efficient uptake of K+ by glial cells (Chever et al., 2010). Astrocytes make up 90% of all human brain cells and each astrocyte controls the activity of many thousands of synapses (about 140 000 in the hippocampus) (Benarroch, 2009). Co-occurrence of epilepsy and ASD in patients harboring KCNJ10 gain-of-function mutations suggests that dysfunction in the astrocytic-dependent K+ buffering may be a common mechanism contributing to seizures as well as the core behavioral features of ASD. In addition, recordings from surgical specimens of patients with intractable epilepsies have demonstrated a reduction of Kir conductance in astrocytes (Bordey and Sontheimer, 1998) and of potassium clearance (Jauch et al., 2002). Conditional Kir4.1 knockout mice display stress-induced seizures (Djukic et al., 2007). Seizures and mental retardation are part of the clinical spectrum of loss-offunction mutations in Kir4.1 (Bockenhauer et al., 2009; Scholl et al., 2009). The relationship between KCNJ10 and ASD seems less straightforward. However, a recent linkage analysis study on a large Finnish pedigree has proposed KCNJ10 as a candidate gene for ASD (Kilpinen et al., 2009). KCNJ10 has also been considered as a possible player in ASD and MECP2-null mice, an animal model of Rett syndrome (Zhang et al., 2010). It has been proposed that the loss-of-function of glial potassium conductance would favor extracellular K+ accumulation, contributing to neuronal hyperexcitability and epilepsy (Chever et al., 2010; Orkand et al., 1966). In Kir4.1 knock-out glial cells, no variations in membrane potential were observed during increases in [K+]o induced by nerve stimulations (Chever et al., 2010). Recently, it has been shown that an isolated episode of local neuronal hyperactivity triggers

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247

245

Fig. 4. Effects of R18Q and V84M mutation on heteromeric Kir4.1/Kir5.1 channel function. Representative current families from oocytes expressing (A) Kir4.1(WT)/Kir5.1, (B) Kir4.1 (R18Q)/Kir5.1, and (C) Kir4.1(V84M)/Kir5.1 channels. Currents were evoked by voltage commands as described in Fig. 2. Horizontal dashed lines indicate 0 current level. Note the typical time-dependent “relaxation” of Kir4.1(WT)/Kir5.1 current (A), whereby an instantaneous (Iinst) and a steady-state (Iss) current can be distinguished (inset in A). Instead, both Kir4.1(R18Q)/Kir5.1 (B) and Kir4.1(V84M)/Kir5.1 (C) currents had Iinst and Iss components of similar amplitudes (inset in B and C), denoting an increase of the Iinst and the nearly complete absence of the slow time-dependent “relaxation.” Average instantaneous current–voltage (Iinst/V) relationships (D) and steady-state current–voltage (Iss/V) relationships (E) for Kir4.1(WT)/Kir5.1 (●), Kir4.1(R18Q)/Kir5.1 (○), and Kir4.1(V84M)/Kir5.1 (□) channels. (F) Bar graph showing that at − 100 mV both Iinst and Iss for both Kir4.1(R18Q)/Kir5.1 (blue) and Kir4.1(V84M)/Kir5.1 (purple) are larger than Kir4.1(WT)/Kir5.1 channels (pink) when an equal amount of cRNA for each channel type was expressed. (G) Iss/Iinst ratio for Kir4.1(WT)/Kir5.1 (pink), Kir4.1(R18Q)/Kir5.1 (blue), or Kir4.1(V84M)/Kir5.1 (purple) calculated at − 100 mV. This analysis denotes that the slow component accounts for ~ 40% of total current for WT, whereas, it is nearly absent in mutant channels. (H) The slow component of activation for Kir4.1(WT)/Kir5.1 channels was fitted with a single-exponential function and the average time constant is plotted as a bar graph, whereas this value could not be determined (ND) for either mutant channel type. The reported bar graphs are representative of 4 independent experiments performed using different batches of oocytes. The total number of oocytes examined from each group is approximately 100. These results indicate that the R18Q and V84M mutations enhance heteromeric current amplitudes and result in inwardly-rectifying K+ currents with faster activation kinetics than the wild-type. (I) Intracellular pH vs. current inhibition for homomeric channels Kir 4.1(WT) (●), Kir4.1(R18Q) (▲), and Kir4.1(V84M) (■), and for heteromeric channels Kir4.1(WT)/ Kir5.1 (○), Kir4.1(R18Q)/Kir5.1 (△), and Kir4.1(V84M)/Kir5.1 (□). Data points were obtained from currents recorded at − 100 mV in the TEVC configuration in control conditions and during the perfusion of a membrane-permeable K-acetate buffer that reduces the oocyte intracellular pH to the indicated value (mean ± S.E.M. of 6–8 oocytes). The solid line shows the fit with the equation 1/[1 + ([H+]i/K)n] from which the apparent pKa values were calculated. Note that the R18Q and V84M mutations do not change the sensitivity of either homomeric Kir4.1 or heteromeric Kir4.1/Kir5.1 channels to pHi. Data are mean ± SEM. The statistical significance of the differences was evaluated by comparing each data set with the relevant control and by using ANOVA and the unpaired Student's t test. *P values b 0.05;**P values b 0.01.

a large and synchronous calcium elevation in closely associated astrocytes. Activated astrocytes signal back to neurons favoring their recruitment into a coherent activity that underlines the hypersynchronous ictal discharge (Gómez-Gonzalo et al., 2010). The functional analyses carried out here suggest, as an alternative pathogenic mechanism, that an increased and faster influx of K+ into astrocytes through Kir4.1-containing channels during intense neuronal activity may lead to larger membrane depolarization and higher intracellular calcium elevations in these cells. Calcium elevations in astrocytes are associated with the release of gliotransmitters, such as glutamate and D-serine that trigger discharges in neurons, promotes local neuronal synchrony and epileptic activity (Angulo et al., 2004; Bezzi et al.,

1998; Fellin et al., 2004; Mothet et al., 2005; Parpura et al., 1994; Pasti et al., 2001; Tian et al., 2005). We are tempted to speculate that a recurrent neuron-astrocyte-neuron excitatory loop may develop at a restricted brain site, as a consequence of gain-of-function of Kir4.1 channels, and contribute to initiation of seizures. The high expression level of Kir4.1 and Kir5.1 that likely form heteromeric channels in LC neurons (D'Adamo et al., 2010) suggests that these mutations may alter the noradrenergic (NA) system of the brain as well. A developmental dysregulation of this LC-NA network (Samuels and Szabadi, 2008) has been suggested to possibly modulate autistic behaviors in humans (Mehler and Purpura, 2009). Upregulation of Kir4.1 has been found in LC neurons of MECP2-null

246

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247

Fig. 5. 3D-homology model of a heteromeric Kir4.1/Kir5.1 channel indicating the position of Val-84. (A) Crystal structure showing the cone-shaped region of the channel immersed in the POPC lipids of the membrane bilayer (depicted as light blue colored sticks). The secondary structure elements are shown as ribbons. Blue and red chains refer to Kir4.1 and 5.1 monomers, respectively. (B) Close-up view of the channel indicating the position of Val-84 in the first transmembrane domain that has been changed into methionine (shown as sticks). Note that the side-chain atoms of Met-84 point towards the POPC lipid molecules that have been positioned at a distance of ~ 3.0 Å. The position of the Arg-18 residue in the N-terminal region could not be determined due to lack of structural data. The first residue available in the crystal structure is Arg-27 (shown as sticks).

mice. This over-expression of Kir4.1 might impair the neuromodulation of LC neurons, leading to the autonomic dysfunction and autistic behaviors seen in Rett Syndrome (Zhang et al., 2010). Fifty to 70% of autistic children show some degree of intellectual disability (Matson and Shoemaker, 2009). Both cognitive and autistic features could be tied to postnatal developmental events, occurring as a function of synaptic activity and activity-dependent transcriptional changes, underlying synaptic plasticity, learning and memory (Hong et al., 2005; Zoghbi, 2003). Kir4.1 channel activity shows a profound developmental regulation, which correlates with both cell differentiation and the developmental regulation of extracellular K+ dynamics (Connors et al., 1982; MacFarlane and Sontheimer, 2000; Neusch et al., 2001). Also, astrocyte-released neuroactive substances govern several functions including neuronal excitability (Tian et al., 2005; Zhang et al., 2003), excitatory and inhibitory synaptic transmission and plasticity (Beattie et al., 2002; Fiacco and McCarthy, 2004; Kang et al., 1998; Pascual et al., 2005; Yang et al., 2003), as well as synaptogenesis and neuronal wiring (Collazos-Castro and NietoSampedro, 2001; Elmariah et al., 2005; Fasen et al., 2003; Ullian et al., 2004). Thus, either the possible effects of R18Q mutation on channel trafficking or the increased single channel conductance of V84M may alter a number of different mechanisms related to K+ homeostasis, cell differentiation and synaptic plasticity. Our results suggest that the molecular mechanism contributing to autism/epilepsy with intellectual disability tentatively relates to an increase in either surface-expression or conductance of Kir4.1 channels, or both. Alike neurons, astrocytes might represent a crucial target for the pharmacological control of abnormal electrical discharge and synaptic function.

Acknowledgments This work was partially supported by the COMPAGNIA di San Paolo (Turin) “Programma Neuroscienze,” MIUR (Italian Ministry of Instruction, University and Research)—PRIN, and the Fondazione Cassa di Risparmio di Perugia. We are also grateful to Dr. Anselm A. Zdebik, at Department of Neuroscience, Physiology and Pharmacology, University College London, London, UK, for providing the human Kir4.1 cDNA.

Appendix A. Supplementary data Supplementary data to this article can be found online at doi:10.1016/j.nbd.2011.03.016.

References Abrahams, B.S., Geschwind, D.H., 2008. Advances in autism genetics: on the threshold of a new neurobiology. Nat. Rev. Genet. 9, 341–355. Angulo, M.C., Kozlov, A.S., Charpak, S., Audinat, E., 2004. Glutamate released from glial cells synchronizes neuronal activity in the hippocampus. J. Neurosci. 24, 6920–6927. Beattie, E.C., Stellwagen, D., Morishita, W., Bresnahan, J.C., Ha, B.K., Von Zastrow, M., et al., 2002. Control of synaptic strength by glial TNFalpha. Science 295, 2282–2285. Benarroch, E.E., 2009. Astrocyte–neuron interactions: implications for epilepsy. Neurology 73, 1323–1327. Bezzi, P., Carmignoto, G., Pasti, L., Vesce, S., Rossi, D., Rizzini, B.L., et al., 1998. Prostaglandins stimulate calcium-dependent glutamate release in astrocytes. Nature 391, 281–285. Bockenhauer, D., Feather, S., Stanescu, H.C., Bandulik, S., Zdebik, A.A., Reichold, M., et al., 2009. Epilepsy, ataxia, sensorineural deafness, tubulopathy, and KCNJ10 mutations. N. Engl. J. Med. 360, 1960–1970. Bond, C.T., Pessia, M., Xia, X.M., Lagrutta, A., Kavanaugh, M.P., Adelman, J.P., 1994. Cloning and expression of a family of inward rectifier potassium channels. Receptors Channels 2, 183–191. Bordey, A., Sontheimer, H., 1998. Properties of human glial cells associated with epileptic seizure foci. Epilepsy Res. 32, 286–303. Bryson, S.E., Clark, B.S., Smith, I.M., 1988. First report of a Canadian epidemiological study of autistic syndromes. J. Child. Psychol. Psychiatry 29, 433–445. Buono, R.J., Lohoff, F.W., Sander, T., Sperling, M.R., O'Connor, M.J., Dlugos, D.J., et al., 2004. Association between variation in the human KCNJ10 potassium ion channel gene and seizure susceptibility. Epilepsy Res. 58, 175–183. Camerino, D.C., Desaphy, J.F., Tricarico, D., Pierno, S., Liantonio, A., 2008. Therapeutic approaches to ion channel diseases. Adv. Genet. 64, 81–145. Chever, O., Djukic, B., McCarthy, K.D., Amzica, F., 2010. Implication of k(ir)4.1 channel in excess potassium clearance: an in vivo study on anesthetized glial-conditional k(ir) 4.1 knock-out mice. J. Neurosci. 30, 15769–15777. Chung, H.J., Qian, X., Ehlers, M., Jan, Y.N., Jan, L.Y., 2009. Neuronal activity regulates phosphorylation-dependent surface delivery of G protein-activated inwardly rectifying potassium channels. Proc. Natl. Acad. Sci. U.S.A. 106, 629–634. Clarke, D.F., Roberts, W., Daraksan, M., Dupuis, A., McCabe, J., Wood, H., et al., 2005. The prevalence of autistic spectrum disorder in children surveyed in a tertiary care epilepsy clinic. Epilepsia 46, 1970–1977. Collazos-Castro, J.E., Nieto-Sampedro, M., 2001. Developmental and reactive growth of dentate gyrus afferents: cellular and molecular interactions. Restor. Neurol. Neurosci. 19, 169–187. Connors, B.W., Ransom, B.R., Kunis, D.M., Gutnick, M.J., 1982. Activity-dependent K +accumulation in the developing rat optic nerve. Science 216, 1341–1343. D'Adamo, M.C., Liu, Z., Adelman, J.P., Maylie, J., Pessia, M., 1998. Episodic ataxia type-1 mutations in the hKv1.1 cytoplasmic pore region alter the gating properties of the channel. EMBO J. 17, 1200–1207.

F. Sicca et al. / Neurobiology of Disease 43 (2011) 239–247 D'Adamo, M.C., Shang, L., Imbrici, P., Brown, S.D., Pessia, M., Tucker, S.J., 2010. Genetic inactivation of KCNJ16 identifies Kir5.1 as an important determinant of neuronal PCO2/pH sensitivity. J. Biol. Chem. 286, 192–198. Djukic, B., Casper, K.B., Philpot, B.D., Chin, L.S., McCarthy, K.D., 2007. Conditional knockout of Kir4.1 leads to glial membrane depolarization, inhibition of potassium and glutamate uptake, and enhanced short term synaptic potentiation. J. Neurosci. 27, 11354–11365. Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. Elmariah, S.B., Oh, E.J., Hughes, E.G., Balice-Gordon, R.J., 2005. Astrocytes regulate inhibitory synapse formation via Trk-mediated modulation of postsynaptic GABAA receptors. J. Neurosci. 25, 3638–3650. Fasen, K., Elger, C.E., Lie, A.A., 2003. Distribution of alpha and beta integrin subunits in the adult rat hippocampus after pilocarpine-induced neuronal cell loss, axonal reorganization and reactive astrogliosis. Acta Neuropathol. (Berl.) 106, 319–322. Fellin, T., Pascual, O., Gobbo, S., Pozzan, T., Haydon, P.G., Carmignoto, G., 2004. Neuronal synchrony mediated by astrocytic glutamate through activation of extrasynaptic NMDA receptors. Neuron 43, 729–743. Ferraro, T.N., Golden, G.T., Smith, G.G., Martin, J.F., Lohoff, F.W., Gieringer, T.A., et al., 2004. Fine mapping of a seizure susceptibility locus on mouse Chromosome 1: nomination of Kcnj10 as a causative gene. Mamm. Genome 15, 239–251. Fiacco, T.A., McCarthy, K.D., 2004. Intracellular astrocyte calcium waves in situ increase the frequency of spontaneous AMPA receptor currents in CA1 pyramidal neurons. J. Neurosci. 24, 722–732. Gargus, J.J., 2009. Genetic calcium signaling abnormalities in the central nervous system: seizures, migraine, and autism. Ann. N.Y. Acad. Sci. 1151, 133–156. Gómez-Gonzalo, M., Losi, G., Chiavegato, A., Zonta, M., Cammarota, M., Brondi, M., et al., 2010. An excitatory loop with astrocytes contributes to drive neurons to seizure threshold. PLoS Biol. 8, e1000352. Gupta, A.R., State, M.W., 2007. Recent advances in the genetics of autism. Biol. Psychiatry 61, 429–437. Helbig, I., Scheffer, I.E., Mulley, J.C., Berkovic, S.F., 2008. Navigating the channels and beyond: unravelling the genetics of the epilepsies. Lancet Neurol. 7, 231–245. Hess, B., Kutzner, C., van der Spoel, D., Lindahl, E., 2008. GROMACS 4: algorithms for highly efficient, load-balanced, and scalable molecular simulation. J. Chem. Theor. Comp. 4, 435–447. Higashi, K., Fujita, A., Inanobe, A., Tanemoto, M., Doi, K., Kubo, T., et al., 2001. An inwardly rectifying K(+) channel, Kir4.1, expressed in astrocytes surrounds synapses and blood vessels in brain. Am. J. Physiol. Cell Physiol. 281, C922–C931. Hollander, E., Kim, S., Braun, A., Simeon, D., Zohar, J., 2009. Cross-cutting issues and future directions for the OCD spectrum. Psychiatry Res. 170, 3–6. Hong, E.J., West, A.E., Greenberg, M.E., 2005. Transcriptional control of cognitive development. Curr. Opin. Neurobiol. 15, 21–28. Hughes, J.R., Melyn, M., 2005. EEG and seizures in autistic children and adolescents: further findings with therapeutic implications. Clin. EEG Neurosci. 36, 15–20. Humphrey, W., Dalke, A., Schulten, K., 1996. VMD—visual molecular dynamics. J. Mol. Graphics 14, 33–38. Jauch, R., Windmüller, O., Lehmann, T.N., Heinemann, U., Gabriel, S., 2002. Effects of barium, furosemide, ouabaine and 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid (DIDS) on ionophoretically-induced changes in extracellular potassium concentration in hippocampal slices from rats and from patients with epilepsy. Brain Res. 925, 18–27. Kang, J., Jiang, L., Goldman, S.A., Nedergaard, M., 1998. Astrocyte-mediated potentiation of inhibitory synaptic transmission. Nat. Neurosci. 1, 683–692. Kilpinen, H., Ylisaukko-oja, T., Rehnström, K., Gaál, E., Turunen, J.A., Kempas, E., et al., 2009. Linkage and linkage disequilibrium scan for autism loci in an extended pedigree from Finland. Hum. Mol. Genet. 18, 2912–2921. Laskowski, R.A., MacArthur, M.W., Moss, D.S., Thornton, J.M., 1993. PROCHECK—a program to check the stereochemical quality of protein structures. J. App. Cryst. 26, 283–291. Li, M., Lester, H.A., 2001. Ion channel diseases of the central nervous system. CNS Drug Rev. 7, 214–240. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2–ΔΔCT method. Methods 25, 402–408. MacFarlane, S.N., Sontheimer, H., 2000. Changes in ion channel expression accompany cell cycle progression of spinal cord astrocytes. Glia 30, 39–48. Matson, J.L., Shoemaker, M., 2009. Intellectual disability and its relationship to autism spectrum disorders. Res. Dev. Disabil. 30, 1107–1114. Mehler, M.F., Purpura, D.P., 2009. Autism, fever, epigenetics and the locus coeruleus. Brain Res. Rev. 59, 388–392. Mothet, J.P., Pollegioni, L., Ouanounou, G., Martineau, M., Fossier, P., Baux, G., 2005. Glutamate receptor activation triggers a calcium-dependent and SNARE proteindependent release of the gliotransmitter D-serine. Proc. Natl. Acad. Sci. U.S.A. 102, 5606–5611. Neusch, C., Rozengurt, N., Jacobs, R.E., Lester, H.A., Kofuji, P., 2001. Kir4.1 potassium channel subunit is crucial for oligodendrocyte development and in vivo myelination. J. Neurosci. 21, 5429–5438.

247

Nishida, M., Cadene, M., Chait, B.T., MacKinnon, R., 2007. Crystal structure of a Kir3.1prokaryotic Kir channel chimera. EMBO J. 26, 4005–4015. Orkand, R.K., Nicholls, J.G., Kuffler, S.W., 1966. Effect of nerve impulses on the membrane potential of glial cells in the central nervous system of amphibia. J. Neurophysiol. 29, 788–806. Parpura, V., Basarsky, T.A., Liu, F., Jeftinija, K., Jeftinija, S., Haydon, P.G., 1994. Glutamatemediated astrocyte–neuron signalling. Nature 369, 744–747. Pascual, O., Casper, K.B., Kubera, C., Zhang, J., Revilla-Sanchez, R., Sul, J.Y., et al., 2005. Astrocytic purinergic signaling coordinates synaptic networks. Science 310, 113–116. Pasti, L., Zonta, M., Pozzan, T., Vicini, S., Carmignoto, G., 2001. Cytosolic calcium oscillations in astrocytes may regulate exocytotic release of glutamate. J. Neurosci. 21, 477–484. Pessia, M., Tucker, S.J., Lee, K., Bond, C.T., Adelman, J.P., 1996. Subunit positional effects revealed by novel heteromeric inwardly rectifying K + channels. EMBO J. 15, 2980–2987. Pessia, M., Imbrici, P., D'Adamo, M.C., Salvatore, L., Tucker, S.J., 2001. Differential pH sensitivity of Kir4.1 and Kir4.2 potassium channels and their modulation by heteropolymerisation with Kir5.1. J. Physiol. 532, 359–367. Pinney, S.E., MacMullen, C., Becker, S., Lin, Y.W., Hanna, C., Thornton, P., et al., 2008. Clinical characteristics and biochemical mechanisms of congenital hyperinsulinism associated with dominant KATP channel mutations. Clin. Invest. 118, 2877–2886. Piven, J., Palmer, P., Jacobi, D., Childress, D., Arndt, S., 1997. Broader autism phenotype: evidence from a family history study of multiple-incidence autism families. Am. J. Psychiatry 154, 185–190. Reichold, M., Zdebik, A.A., Lieberer, E., Rapedius, M., Schmidt, K., Bandulik, S., et al., 2010. KCNJ10 gene mutations causing EAST syndrome (epilepsy, ataxia, sensorineural deafness, and tubulopathy) disrupt channel function. Proc. Natl. Acad. Sci. U.S.A. 107, 14490–14495. Rosenberg, R.E., Law, J.K., Yenokyan, G., McGready, J., Kaufmann, W.E., Law, P.A., 2009. Arch. Pediatr. Adolesc. Med. 163, 907–914. Sala-Rabanal, M., Kucheryavykh, L.Y., Skatchkov, S.N., Eaton, M.J., Nichols, C.G., 2010. Molecular mechanisms of EAST/SeSAME syndrome mutations in Kir4.1 (KCNJ10). J. Biol. Chem. 285, 36040–36048. Sali, A., Blundell, T.L., 1993. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815. Samuels, E.R., Szabadi, E., 2008. Functional neuroanatomy of the noradrenergic locus coeruleus: its roles in the regulation of arousal and autonomic function part I: principles of functional organisation. Curr. Neuropharmacol. 6, 235–253. Scholl, U.I., Choi, M., Liu, T., Ramaekers, V.T., Häusler, M.G., Grimmer, J., et al., 2009. Seizures, sensorineural deafness, ataxia, mental retardation, and electrolyte imbalance (SeSAME syndrome) caused by mutations in KCNJ10. Proc. Natl. Acad. Sci. U.S.A. 106, 5842–5847. Shang, L., Lucchese, C.J., Haider, S., Tucker, S.J., 2005. Functional characterisation of missense variations in the Kir4.1 potassium channel (KCNJ10) associated with seizure susceptibility. Brain Res. Mol. Brain Res. 13 (139), 178–183. Takumi, T., Ishii, T., Horio, Y., Morishige, K., Takahashi, N., Yamada, M., et al., 1995. A novel ATP-dependent inward rectifier potassium channel expressed predominantly in glial cells. J. Biol. Chem. 270, 16339–16346. Tang, X., Hang, D., Sand, A., Kofuji, P., 2010. Variable loss of Kir4.1 channel function in SeSAME syndrome mutations. Biochem. Biophys. Res. Commun. 3399, 537–541. Tian, G.F., Azmi, H., Takano, T., Xu, Q., Peng, W., Lin, J., et al., 2005. An astrocytic basis of epilepsy. Nat. Med. 11, 973–981. Toro, R., Konyukh, M., Delorme, R., Leblond, C., Chaste, P., Fauchereau, F., et al., 2010. Key role for gene dosage and synaptic homeostasis in autism spectrum disorders. Trends Genet. 26, 363–372. Tuchman, R., Moshé, S.L., Rapin, I., 2009. Convulsing toward the pathophysiology of autism. Brain Dev. 31, 95–103. Tucker, S.J., Imbrici, P., Salvatore, L., D'Adamo, M.C., Pessia, M., 2000. pH dependence of the inwardly rectifying potassium channel, Kir5.1, and localization in renal tubular epithelia. J. Biol. Chem. 275, 16404–16407. Ullian, E.M., Christopherson, K.S., Barres, B.A., 2004. Role for glia in synaptogenesis. Glia 47, 209–216. Wu, J., Xu, H., Shen, W., Jiang, C., 2004. Expression and coexpression of CO2-sensitive Kir channels in brainstem neurons of rats. J. Membrane Biol. 197, 179–191. Yang, Y., Ge, W., Chen, Y., Zhang, Z., Shen, W., Wu, C., et al., 2003. Contribution of astrocytes to hippocampal long-term potentiation through release of D-serine. Proc. Natl. Acad. Sci. U.S.A. 100, 15194–15199. Yi, B.A., Lin, Y.F., Jan, Y.N., Jan, L.Y., 2001. Yeast screen for constitutively active mutant G protein-activated potassium channels. Neuron 29, 657–667. Zhang, J.M., Wang, H.K., Ye, C.Q., Ge, W., Chen, Y., Jiang, Z.L., et al., 2003. ATP released by astrocytes mediates glutamatergic activity-dependent heterosynaptic suppression. Neuron 40, 971–982. Zhang, X., Cui, N., Wu, Z., Su, J., Tadepalli, J.S., Sekizar, S., et al., 2010. Intrinsic membrane properties of locus coeruleus neurons in Mecp2-null mice. Am. J. Physiol. Cell Physiol. 298, C635–C646. Zoghbi, H.Y., 2003. Postnatal neurodevelopmental disorders: meeting at the synapse? Science 302, 826–830.