- Email: [email protected]
Autocrine Regulation of Norepinephrine Transporter Expression
Molecular and Cellular Neuroscience 17, 539 –550 (2001) doi:10.1006/mcne.2000.0946, available online at http://www.idealibrary.com on
MCN
Autocrine Regulation of Norepinephrine Transporter Expression Z. G. Ren,* P. Po¨rzgen, † J. M. Zhang,* X. R. Chen,* S. G. Amara, †,‡ R. D. Blakely, § and M. Sieber-Blum* ,1 *Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, Milwaukee, Wisconsin 53226; †Vollum Institute and ‡Howard Hughes Medical Institute, Oregon Health Sciences University, Portland, Oregon 97201; and §Department of Pharmacology, Vanderbilt University, Nashville, Tennessee 37232
The1 norepinephrine transporter (NET) is a neurotransmitter scavenger and site of drug action in noradrenergic neurons. The aim of this study was to identify mechanisms that regulate NET expression during the development of quail (q) sympathetic neuroblasts, which develop from neural crest stem cells. Neurotrophin-3 (NT-3) and transforming growth factor 1 (TGF-1) cause an increase of qNET mRNA levels in neural crest cells. When combined, the growth factors are additive in increasing qNET mRNA levels. Both NT-3 and TGF-1 are synthesized by neural crest cells. Onset of NET expression precedes the onset of neural crest stem cell emigration from the neural tube. In older embryos, qNET is expressed by several crest-derived and noncrest tissues. The data show that qNET expression in presumptive sympathetic neurons is initiated early in embryonic development by growth factors that are produced by neural crest cells themselves. Moreover, the results support our previous observations that norepinephrine transport contributes to the regulation of the differentiation of neural crest stem cells into sympathetic neurons.
INTRODUCTION In adult neurons, NET serves to remove excess transmitter from the synaptic cleft (Axelrod, 1965; Iversen, 1967; Snyder, 1970) and is a site of action of drugs that block norepinephrine transport, such as tricyclic antidepressants and cocaine, (Axelrod et al., 1961; Whitby et al., 1960). The human (Pacholczyk et al., 1991), mouse (Fritz et al., 1998), and rat (Bru¨ss et al., 1997) NET genes have been cloned and characterized. In the adult mammalian organism, the same NET gene is expressed in the
peripheral and central nervous systems in sympathetic neurons, the adrenal gland, and the locus ceruleus in the brain stem (Amara, 1995). In developing noradrenergic neurons, norepinephrine transport leads to the expression of tyrosine hydroxylase and dopamine--hydroxylase in differentiating neural crest cells, suggesting that NET is involved in promoting the differentiation of neural crest stem cells into sympathetic neurons (Sieber-Blum, 1989; Zhang and Sieber-Blum, 1992; Zhang et al., 1997a). After leaving the dorsal aspect of the neural tube, presumptive noradrenergic neural crest cells migrate dorsoventrally between the somite and the neural tube and past the notochord. Ultimately they settle near the dorsal aorta, where they start to synthesize catecholamines and differentiate into the primary sympathetic ganglia. Despite the importance of NET function, the mechanisms that regulate NET expression, the time course of NET expression, and the NET expression patterns in the embryo are not well defined. We have cloned a partial qNET cDNA and used it to determine the function of candidate growth factors in NET expression. Our data show that NT-3 and TGF-1 cause an increase in NET mRNA levels in an additive manner. Both growth factors are expressed by migratory neural crest cells, thus indicating that they have autocrine or paracrine function. Moreover, NET is expressed in a number of neural crest-derived and noncrest embryonic tissues of both ectodermal and mesodermal origin.
RESULTS Cloning of a Partial Quail NET cDNA
1 To whom correspondence and reprint requests should be addressed. Fax: 414-456-6517. E-mail: [email protected].
1044-7431/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
A partial qNET cDNA was cloned from RNA of cultured quail neural crest cells (Genbank Accession
539
FIG. 1. Sequence of partial qNET clone. Deduced amino acid sequence and clustal align with human NET (hNET), mouse NET (mNET), human dopamine transporter (hDAT), and human serotonin transporter (hSERT). Sequence marked blue, extracellular loop. Sequence marked red (W124 –T373) was used for in situ hybridization. Sequence marked with yellow was used as an immunogen to raise antibody 43408.
540 Ren et al.
Autocrine Regulation of NET Expression
541 that the cloned transporter fragment is part of the quail NET gene. This notion is further supported by a positive in situ hybridization signal in the locus ceruleus (data not shown).
Increase in NET mRNA Levels in the Presence of NT-3 and TGF-1 Neural crest cell explants were grown in a chemically defined culture medium (Sieber-Blum and Chokshi, 1985; Sieber-Blum, 1999). RNA from 24-h cultures that were grown in the presence and absence of growth factors was isolated and amplified by RT-PCR with qNET-specific and GAPDH-specific primers. In contrast FIG. 2. RT-PCR amplification of qNET, TGF-, and NT-3 mRNA from 24-h neural crest cell cultures. (A) qNET RT-PCR. Each panel shows five independent experiments, in which 18 –22 neural crest cell cultures served as a starting material for the RT-PCR experiments. The band densities were quantified by fluorimaging, expressed as ratio NET:GAPDH, and statistically analyzed by 1-factor analysis of variance. Top panel: In this control the cells were grown in defined culture medium in the absence of added growth factors. Upper bands, GAPDH; lower bands, qNET. A qNET band was observed, suggesting either an autocrine mechanism of qNET expression or qNET expression prior to the onset of neural crest cell migration. Second panel: Cells were grown in defined culture medium in the presence of anti-NT-3 blocking antibodies (4 g/ml) and anti-pan TGF- blocking antibodies (4 g/ml). The qNET band is significantly reduced, suggesting that neural crest cells synthesize NT-3 and TGF- and that the growth factors increase qNET mRNA levels by an autocrine mechanism. Third panel: Cells were grown in the presence of FGF-2 (2.5 ng/ml) and NT-3 (10 ng/ml). The qNET band is significantly increased compared to the control without growth factors and the control with blocking antibodies. Fourth panel: When cells were grown in the presence of TGF-1 (1 ng/ml), the qNET band was increased. Fifth panel: When the cells were grown in the presence of all three factors, FGF-2, NT-3, and TGF-1, the band intensity was further increased, indicating an additive mechanism. All values were significantly different from each other (P ⱕ 0.006). (B) TGF- and NT-3 RT-PCR. RNA was isolated from 24-h neural crest cell cultures that had been grown in defined culture medium in the absence of noncrest cells and in the absence of added growth factors. The data suggest that early migratory neural crest cells synthesize all three TGF-s, as well as NT-3.
No. AF230787). The cloned fragment encodes 515 amino acids (aa) and shows 88% aa identity to human NET (hNET), 88% to mouse NET (mNET), 71% to the human dopamine transporter (hDAT), and 52% to the human serotonin transporter (hSERT; Fig. 1). The moderately conserved large extracellular loop domain of the transporters shows a high degree of identity between the qNET and the mammalian NETs, but significant differences to hDAT and hSERT, strongly suggesting
FIG. 3. qNET in situ hybridization of cultured neural crest cells. (a) Cells were grown for in the presence of FGF-2 and NT-3 for 48 h (h 0 – 48) to promote proliferation. At 24 h, TGF-1, which inhibits cell proliferation, was added as well (h 24 – 48). At 48 h of culture, the cells were processed for in situ hybridization with anti-sense probe. (b) Cells were grown in the presence of NT-3 blocking antibodies and pan-TGF- blocking antibodies and subsequently hybridized with anti-sense probe. (c) Control in which cells were grown in the presence of FGF-2, NT-3, and TGF-1 and hybridization was done with sense probe. The hybridization signal is significantly reduced in (b) and (c). Bar, 25 m.
542 to expectation, a qNET band was present in RNA from control neural crest cell cultures that were grown in the absence of added growth factors (Fig. 2A; top panel). This indicated either expression of qNET prior to onset of migration of neural crest cells or autocrine regulation of NET expression. To investigate autocrine regulation, neural crest cells were grown in the presence of antiNT-3 and anti-pan TGF- blocking antibodies. The viability of the cells was not affected (not shown), but the qNET band was significantly decreased (P ⫽ 0.0001; Fig. 2A, second panel), suggesting autocrine regulation of NET expression. Both the FGF-2/NT-3 combination and TGF-1 caused a significant increase in NET mRNA levels over the antibody control (P ⫽ 0.0001 for both; Fig. 2A, panels 3 and 4). FGF-2 by itself does not affect NE transport but potentiates NT-3 action (Zhang et al., 1997a, b). When the cells were grown in the presence of all three growth factors, NET mRNA levels were elevated significantly (P ⫽ 0.0001; Fig. 2A, bottom panel) compared to FGF-2 ⫹ NT-3 and to TGF-1, indicating that FGF-2/NT-3 and TGF-1 synergize in increasing NET mRNA levels. Data from all control and experimental groups were significantly different from each other (P ⱕ 0.006). Equivalent results were obtained by in situ hybridization of cultured neural crest cells with a NET probe (Fig. 3). Cells were grown in the presence of FGF-2, NT-3, and TGF-1 (Figs. 3a and 3c) or in the presence of NT-3 blocking antibodies and pan TGF- blocking antibodies (Fig. 3b) and processed for in situ hybridization. The relative intensity of the alkaline phosphatase reaction product was high with antisense probe in cells grown in the presence of the growth factors (141.3 ⫾ 5.7; Fig. 3a), but significantly lower when the cells were grown in the presence of the blocking antibodies (63.3 ⫾ 2.5; P ⬍ 0.001; Fig. 3b), comparable to the staining intensity with sense probe (negative control; 57.5 ⫾ 1.7; P ⬍ 0.001; Fig. 3c). The combination of FGF-2 and NT-3 increases NET function as measured by high-affinity uptake of tritiated NE and subsequent autoradiography in neural crest cell colony assays (Zhang et al., 1997a; SieberBlum, 1999). Here we show by the same method that TGF-1 also promotes NE transport activity and that the FGF-2/NT-3 plus TGF-1 combination is additive (Table 1). In these experiments the cells were grown in the presence of 4% horse serum and 2.5% chick embryo extract. It is thus possible that under those culture conditions additional mechanisms, such as activation of the transporter, might operate in addition to the NT-3 and TGF--mediated increase of NET expression.
Ren et al.
NT-3 and TGF- Expression in Neural Crest Cells and Noncrest Cells in Vitro and in Vivo The idea of autocrine growth factor production was confirmed at the mRNA and protein levels in neural crest cell cultures and in the embryo. RNA isolated from 24 h neural crest cell cultures that were grown in defined culture medium was amplified by RT-PCR with growth factor-specific primer pairs. RT-PCR products were obtained for NT-3, TGF-1, TGF-2, and TGF-3 (Fig. 2B). Virtually all neural crest cells in culture and in the 3.5-day-old quail embryo were strongly immunoreactive for NT-3 as detected by confocal microscopy (Fig. 4). During advanced development, the neural tube (see also Pinco et al., 1993), the dorsal root ganglion, the ventral root, the sympathetic ganglion (see also Zhang et al., 1994), the dorsal aorta, and the myotome (stationary somitic cells adjacent to the neural tube and migratory somitic cells on course to the limb bud) were intensely NT-3 immunoreactive (Fig. 4f). Figure 4g shows HNK-1 stain in the same section as in f. HNK-1 immunoreactivity is characteristic for migrating avian neural crest cells. This particular HNK-1 hybridoma clone (VC1.1) recognizes N-CAM and other cell-adhesion molecules and therefore also binds to the neural tube and the notochord (Zaremba et al., 1990). Virtually all neural crest cells also expressed TGF- both in vitro (see also Brauer and Yee, 1993) and in vivo, as determined with anti-pan TGF- antibodies (Fig. 5). Figure 5a shows TGF- immunoreactivity in cultured neural crest cells. Specificity of antibody binding is shown in the controls in Fig. 5b (no primary antibody) and Fig. 5c (preabsorbed primary antibody). Dorsoventrally migrating neural crest cells in the embryo were immunoreactive for TGF- (Fig. 5), as were the dorsal root ganglion, neural tube, ventral root, sympathetic ganglion, and the myotome cells (cells in somites adjacent to the neural tube and cells migrating into the limb bud; Fig. 5d). Figure 5e shows HNK-1 binding in the same section as in Fig. 5d. Figure 5f shows a higher magnification of the area marked in Fig. 5a, in which TGF- immunoreactive migrating neural crest cells and cells in the nascent dorsal root ganglion are visible.
NET Expression in the Neural Crest and in Neural Crest-Derivatives Since NET mRNA is expressed early in neural crest development (Figs. 2 and 3), we determined by confocal microscopy the time course of qNET protein expression. In culture, some neural crest cells expressed NET
543
Autocrine Regulation of NET Expression
TABLE 1 Increase in Norepinephrine Transport Activity in the Presence of NT-3 and TGF-
Experimental condition
Number of colonies per plate containing grainpositive cells
Total number of colonies per plate
Control (no growth factors) NT-3 TGF-1 NT-3 plus TGF-1
2.0 ⫾ 0.4 4.5 ⫾ 0.6* 4.3 ⫾ 0.7* 7.0 ⫾ 0.7*
32.0 ⫾ 1.4 34.3 ⫾ 1.2 29.8 ⫾ 0.6 35.4 ⫾ 1.5
Note. Cells in colony assay were cultured in the presence of 4% horse serum and 2.5% chick embryo extract. The data are averages from colony counts from 10 plates in each group. The total number of colonies per plate was unchanged (P ⫽ 0.38–0.76). *Significantly different from the control, P ⬍ 0.01.
at high levels already 6 h after explantation of the neural tube, the earliest time point postexplantation at which immunocytochemistry can be performed (Figs. 6a and 6b). Staining appeared to be predominantly intracellular. In 4-day-old cultures that had been grown in the presence of FGF-2 and NT-3, NET was expressed by neuronal cells (Figs. 6c and 6d). Immunoreactivity was stronger in neurites than in cell bodies. Similar to cultured neural crest cells, some neural crest cells in vivo expressed NET already at the onset of their emigration from the neural tube. Figures 6e– 6h shows a cross section through the trunk region of a 2.5-day-old embryo. Virtually all cells that form the leading edge of migratory neural crest cells are NET immunoreactive (Fig. 6e, NET fluoresceine fluorescence; Fig. 6f, HNK-1 rhodamine fluorescence). This subset of neural crest cells consists primarily of stem cells (Sieber-Blum, 1989b). Interestingly, the dorsal aspect of the neural tube, from which neural crest cells delaminate, is intensely immunoreactive (Figs. 6e and 6g), suggesting that premigratory neural crest cells are already NET-immunoreactive. In addition, myotome cells are NET-positive (Figs. 6e and 6g). In Figs. 6g and 6h, a higher magnification of part of Fig. 6e and 6f is shown. Two neural crest cells that express both NET and HNK-1 are marked by arrows. In 3.5-day-old embryos (Figs. 6i and 6k), NET was expressed by several neural crest-derived tissues, including the sympathetic ganglion, as expected, but also the dorsal root ganglion (drg), and putative Schwann cell precursors in the ventral root (vr). In addition, several noncrest tissues were NET-immunoreactive. The entire cross-section of the neural tube (nt) shows variable intensities of NET immunoreactivity. Moreover, the myotome (mt) and the lining of the dorsal
aorta (da) are NET-immunoreactive. Controls for immunohistochemistry included omitting one of the two first antibodies and indicated that immunofluorescene was NET-specific and HNK-1-specific, respectively (data not shown).
DISCUSSION The main observation in this report is that both the FGF-2/NT-3 combination and TGF-1 regulate expression of the norepinephrine transporter, as indicated by an increase in steady state qNET mRNA levels. Their action is additive. Moreover, the growth factors are synthesized by neural crest cells, the precursors of sympathetic neurons. Therefore they are likely to act as neural crest-autocrine factors. Since the early migratory neural crest already is a heterogeneous population consisting of pluripotent stem cells, committed cells and cells with restricted developmental potentials (SieberBlum and Sieber, 1984), it remains to be determined whether the neural crest cells that express NET also express the three growth factors, or whether some or all factors are supplied by neighboring cells in a paracrine fashion. Moreover, it is possible that the mechanism of growth factor-mediated increase in qNET mRNA levels is indirect, insofar as NT-3 and/or TGF-1 could induce another factor, which in turn promotes NET expression. NT-3 and TGF-1 activate independent signaling pathways, which may, however, converge as they share downstream mediators. For example, MAP kinase kinase-1 (MEKK-1), which is a member of a neurotrophinactivated pathway, can activate Smad2, a signaling mediator downstream of TGF- (reviewed by Zhang and Derynck, 1999). Alternatively it is conceivable that TGF- promotes expression of NT-3. This possibility, however, is unlikely for two reasons. One, in both neurons (Buchman et al., 1994) and Schwann cells (Cai et al., 1999), TGF- inhibits expression of NT-3. Two, we have shown that the 10 ng/ml concentration of NT-3 that was used in this study elicits a maximal response in cultured neural crest cells (Zhang et al., 1997a). Neural crest cells express the NT-3 receptor, TrkC, when they leave the neural tube (Tessarollo et al., 1993; Henion et al., 1995) and require NT-3 (Farinas et al., 1994). NT-3 is unique among neurotrophins of the NGF family in promoting NE transport (Zhang et al., 1997a). In contrast, it remains to be determined whether TGF-1 is the sole active physiological member of this family of growth factors, in particular since TGF-2 and TGF-3 are also produced by neural crest cells. In addition to promoting NET expression, the three growth
544
Ren et al.
FIG. 4. NT-3 immunoreactivity in 12-h neural crest cell cultures and in the embryo. Culture: (a) Virtually all neural crest cells are strongly immunoreactive (fluorescein fluorescence). (b) Negative control for secondary antibody: no first antibody. (c) Negative control for primary antibody: preabsorbed first antibody. Bar, 20 m. Embryo: (d) Cross-section through the rostral trunk region of a day 3.5 embryo during early neural crest cell migration. Migrating neural crest cells are NT-3 immunoreactive. (e) Higher magnification of area marked by white square in (d). (f) NT-3 immunoreactivity in caudal axial levels during late neural crest cell migration. (g) HNK-1 immunoreactivity (rhodamine fluorescence) in the same section as (f) to mark neural crest cells and their derivatives. The entire cross section of the neural tube, the sympathetic ganglion (sg), dorsal root ganglion (drg), ventral root (vr), myotome (mt) adjacent to neural tube and migrating into limb bud and the dorsal aorta (da) are immunoreactive. Bar (d, f, g), 200 m; (e), 25 m.
factors regulate neural crest cell proliferation. FGF-2 is a mitogen for neural crest cells and renders them dependent on neurotrophins (Zhang et al., 1997b). Neurotrophins, including NT-3, rescue neural crest cells that proliferate in response to FGF-2 action (Zhang et al., 1997b). In contrast, TGF-1 is a potent anti-proliferative agent that dominates over the FGF-2/NT-3 proliferative effect (Zhang et al., 1997b). In addition, TGF-1 promotes expression of neuronal traits (Howard and Gershon, 1993; Zhang et al., 1997b). Thus FGF-2, NT-3, and TGF-1, alone and in combination, have multiple functions in neural crest cell development. Figure 7 summarizes the functions of FGF-2, NT-3, TGF-, and NET in sympathetic neuron differentiation. A second observation in the present study is that NET is already expressed in sympathetic neuron progenitor cells, the neural crest. NET protein is expressed in the roof plate of the neural tube, from which neural
crest cells delaminate, and in early migratory neural crest cells in vitro and in vivo, suggesting that qNET is expressed by neural crest cells before they leave the neural tube. The leading edge of the migrating neural crest cell population consists primarily of two classes of pluripotent stem cell (Sieber-Blum, 1989b), suggesting that at least some neural crest stem cells express qNET. Rothman et al. (1978) have shown that avian neural crest cells acquire the capacity to transport NE during advanced migration, when they arrive in the vicinity of the notochord. Thus there appears to be a lag phase during which neural crest cells express qNET protein, but not yet a functional transporter. It is conceivable that NET protein trafficking is involved in regulating NET function, as has been shown for the serotonin transporter (Blakely et al., 1998). It is interesting to note that several crest-derived and noncrest qNET-expressing tissues also express
545
Autocrine Regulation of NET Expression
FIG. 5. TGF- immunoreactivity in 12 h neural crest cell cultures and in the embryo. Culture: (a) Virtually all neural crest cells in 12-h cultures bind anti-pan TGF- antibodies. (b) Negative control for second antibody: no primary antibody. (c) Negative control for first antibody: preabsorbed primary antibody. Bar, 20 m. Embryo: (d) pan-TGF- immunoreactivity in day 3.5 embryo. The sympathetic ganglion (sg), dorsal root ganglion (drg), ventral root (vr), neural tube (nt), and myotome (m) are immunoreactive. (e) HNK-1 immunoreactivity in the same embryonic section to identify neural crest cells and neural crest derivatives. (f) Higher magnification of area marked by white square in (e) shows migrating neural crest cells and the dorsal part of the dorsal root ganglion. Bars: (d, e) 200 m; (f) 25 m.
both NT-3 and TGF-. They include the dorsal root ganglion, the sympathetic ganglion, the ventral root, the neural tube, and the somitic myotome. It is thus conceivable that autocrine regulation of NET expression is not limited to the neural crest, but occurs in several or all NET-expressing tissues. The significance of qNET expression in tissues other than the sympathetic ganglion remains to be determined. In this context it is interesting, however, that both sensory neuroblasts in the dorsal root ganglion and enteric neuroblasts express NET and become transiently adrenergic during embryonic development (Gershon et al., 1984; Xue et al., 1985). In summary, our data indicate that the quail NET is highly homologous to mammalian NETs and that its expression is mediated by autocrine FGF-2, NT-3, and TGF-. They further suggest that NET is expressed already in some premigratory neural crest cells, most likely in stem cells.
EXPERIMENTAL PROCEDURES Cloning of a Partial Quail NET Quail neural crest cells were grown for 4 days in culture and total RNA was isolated using the RNA STAT-60 kit (TEL-TEST Inc., Friendswood, TX). A cDNA pool was generated using hexamers and oligo dT12-18mer as primers (cDNA Synthesis System, Life
Technologies), followed by touch-down RT-PCR (Roux KH, 1995) with degenerated NET-specific oligos: NETEL2s (5⬘TGG ACC ASY CCM AAY TGY ACN GAC CC3⬘) and NET-IL4as (5⬘GTG ATR ACH GCY TCC ATR CCW CCC AT3⬘). A 750-bp PCR products was subcloned into pCRII (Invitrogen) and sequenced. From this fragment we designed two outward facing primers, which were subsequently used together with degenerated NET primers from TM1 (5⬘GRG AGM MYT GGG GCA AGR ARA TYG A3⬘) and TM12 (5⬘TAG RYR GGB ACC AGR ABC ATG GAK GA3⬘) to clone 3 overlapping fragments that encode 515aa of the qNET gene. For the in situ hybridization experiments we used the initial 750-bp PCR product, cloned in both orientations into pCRII, reverse-transcribed from the vector’s T7 promoter.
Neural Crest Primary Cultures Neural crest cell cultures were prepared and maintained in chemically defined culture medium as described previously (Sieber-Blum and Cohen, 1980; Sieber-Blum, 1999). Thirty-five-millimeter culture plates were coated with collagen, laminin (28 g per plate), and fibronectin (100 g plasma fibronectin from horse serum). The last six segments of Hamburger-Hamilton (1951) stage 14 quail embryos (49 h of incubation) were excised and isolated. At 24 h postexplantation, the neural tubes were removed, leaving the emigrated neural
546
Ren et al.
state Biotechnology) at 2.5 ng/ml, and hrNT-3 (gift of Genentech Inc., South San Francisco, CA and from Promega, Madison, WI) at 10 ng/ml. Where indicated anti-NT-3 blocking antibody (mouse monoclonal IgG, 2 mg/ml; gift of Y.-A. Barde and I. Bartke; Gaese et al. 1994) were added to the cultures at 1:500 and pan-TGF- blocking antibodies (rabbit IgG, 1 mg/ml, Research Biochemicals International, Natick, MA) at 1:250. Neural Crest Colony Assay
FIG. 7. Summary of FGF-2, NT-3, TGF-1, and NET action in the differentiation of quail neural crest cells into sympathetic neuroblasts. FGF-2 is synthesized by early migratory neural crest cells, which express FGF receptor (Heuer et al., 1990; Murphy et al., 1994). FGF-2 is mitogenic for all neural crest cells (Zhang et al., 1997b). However, proliferating presumptive neuronal cells do not survive unless a neurotrophin (NGF, BDNF, or NT-3) is present as well. NT-3 is synthesized by neural crest cells (Fig. 3). NT-3 causes an increase in qNET mRNA levels (Fig. 2). TGF-1 causes cessation of neural crest cell proliferation (Zhang et al., 1997) and an increase in qNET expression (Fig. 2). TGF-s are synthesized by neural crest cells (Fig. 3) and may thus also act as autocrine factors. The avian notochord synthesizes NE (Strudel et al., 1977). As NET-expressing neural crest cells migrate past the notochord, they are likely to encounter and transport NE. NE transport causes an increase in Ca 2⫹ transients and eventually leads to the expression of the NE biosynthetic enzymes, tyrosine hydroxylase (TH) and dopamine--hydroxylase (DBH; Zhang et al., 1997b).
crest cells on the substratum. The culture medium was exchanged every day. The cultures were incubated at 37°C in a humidified atmosphere of 5% CO 2 and 10% O 2. The defined culture medium consisted of MCDB 201 and was supplemented with transport factors, hormones, vitamins, and small molecular nutrients as described (Sieber-Blum and Chokshi, 1985; Sieber-Blum, 1999). It did not contain any serum or embryo extract except where indicated (Table 1). TGF 1 (Upstate Biotechnology, Lake Placid, NY) was used at 1 ng/ml (Zhang et al., 1997b), FGF-2 (Up-
Neural crest cell colony assays were performed as described (e.g., Sieber-Blum and Cohen, 1980; Zhang et al., 1997a; Sieber-Blum, 1999). Briefly, cells from 18 –24 h primary explants were resuspended by trypsinization and the cell density adjusted to 500 cells per milliliter. One-milliliter aliquots were then placed into each of 10 collagen- and fibronectin-coated plates per experimental group. The cells attached to the substratum within half an hour. One hour after plating, a second milliliter of culture medium, which in experimental groups contained a 2⫻ concentration of growth factor(s), was added to each plate. The culture medium and growth factors were replaced every other day. At day 10, the cultures were processed for norepinephrine uptake as detailed below. Norepinephrine Uptake and Autoradiography Neural crest cells with a functional norepinephrine transporter were identified in situ in colony assays exactly as described previously (Zhang and Sieber-Blum, 1992). Briefly, the cultures were rinsed with Hanks’ balanced salt solution (HBSS) containing 1% bovine serum albumin (BSA). They were then incubated for 2 h at 37°C with 0.5 ml of 0.5 M [ 3H]norepinephrine (sp act, 40.8 Ci/mmol) in HBSS that also contained 1 mM ascorbic acid and 0.1 mM monoamine oxidase inhibitor, pargyline (Sigma). Subsequently, uptake of radioactive norepinephrine was terminated by rinsing the cultures three times with HBSS that contained 24 mM nonradioactive norepinephrine (d,l-arterenol; Sigma), fixed with 4% paraformaldehyde in calcium-magnesium-free PBS for 20 min at room temperature, and rinsed again. The cultures were then dried in a stream of cold air, coated in the dark with NTB2 emulsion (Kodak) for 2.5 min, and air-dried in the dark. After 10 days of exposure at 4°C, autoradiograms were developed with D-19 (Kodak) for 2.5 min, rinsed with 1% acetic acid, and fixed with Rapid Fix (Kodak). Plates were mounted with mineral oil and a coverslip. The total number of
547
Autocrine Regulation of NET Expression
colonies per plate and the number of colonies that contained grain-positive cells were scored and the data statistically analyzed by 1-factor analysis of variance.
RT-PCR Primers were synthesized by Operon Technologies, Inc. (Alameda, CA). The following primer pairs were used. TGF-1; CAAGCTGAGCGTGCACTGT and TCCTTGCGGAAGTCGATGT (product length, 281 bp; Jakowlew et al., 1988a). TGF-2; AGGAATGTGCAGGATAATT and ATTTTGGGTGTTTTGCCAA (product length, 269 bp; Burt and Paton, 1991). TGF-3; GAGCAGAGTTCCGGGTGCT and GTGCAGAAGCCACTCACGC (product length, 200 bp; Jakowlew et al., 1988b). NT-3; CATATCTTCGTGGCATTCAG and CCAGTGGTGTGTTGTCACTT (product length, 306 bp; Maisonpierre et al., 1992). qNET; GGATTGATGCGGCTACTCAGA and GCTTCCATGCCACCCATAGA (product length, 358 bp). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH); ACG CCA TCA CTA TCT TCC AG and TCAGCTCAGGGATGACTTTC (product length, 458 bp; Panabieres et al., 1984). Total RNA was isolated using the RNA STAT-60 kit (TEL-TEST Inc.). For RT-PCR, the “Access RT-PCR System” (Promega) was used. Template RNA was reverse transcribed with AMV RT for 45 min at 48°C, followed by 2 min of inactivation of RT and denaturation at 94°C. The conditions for PCR reactions are described below. Denaturation NET GAPDH TGF-1 TGF-2 TGF-3 NT-3
94°C, 94°C, 94°C, 94°C, 94°C, 94°C,
30 s 30 s 1 min 1 min 1 min 30 s
Annealing 60°C, 60°C, 55°C, 55°C, 50°C, 60°C,
1 1 1 1 2 1
min min min min min min
Extension 68°C, 68°C, 72°C, 72°C, 72°C, 68°C,
2 2 2 2 3 2
min min min min min min
NET (TKYSKYKFTPAAEFY), which is highly conserved in qNET (identical except for F 3 L in qNET). Anti-NT-3 antibodies used for immunocytochemistry and immunohistochemistry (rabbit antiserum, 1:400; Pepro Tech Inc., Rocky Hill, NJ). Anti-panTGF  antibodies; rabbit IgG (used at 1:400; AB-100-NA; R&D Systems Inc., Minneapolis, MN). HNK-1; mouse monoclonal IgM (used at 1:1000; N-202RBI; Research Biochemicals International); Rhodamine-conjugated goat antibody to mouse (used at 1:100; Cappel 55540, Organon Teknika Corp., West Chester, PA). Fluoresceinconjugated goat antibody to rabbit (used at 1:80; Jackson Immunoresearch Laboratories, Inc., West Grove, PA). Method. The cell culture plates were rinsed with PBS, incubated with 5% normal goat serum in PBS for 30 min, and subsequently incubated overnight at 10°C with primary antibodies in PBS that contained 5% goat serum and 0.1% Triton-⫻100. For multiple stains, the primary antibodies were pooled. The sections/cultures were rinsed three times for 10 min each with PBS. The secondary antibodies were diluted in 5% normal goat serum in PBS, added to the sections/cultures, and incubated in the dark for 1 h at room temperature. For multiple stains the secondary antibodies were pooled. After three more rinses at 10 min each, the slides/ culture plates were mounted with 50% glycerol [containing 1 mg/ml paraphenylene diamine (PPD) in PBS, pH 8.5] and a cover slip and were observed with the confocal microscope.
Cycles 36 36 40 40 40 40
PCR products were analyzed by agarose gel (2%) electrophoresis, sequenced, and found to be correct. For controls, the PCR reaction was carried out without a template and without reverse transcriptase. The PCR conditions were optimized in pilot experiments to assure linear amplification.
Immunocytochemistry and Immunohistochemistry Antibodies. NET rabbit antiserum 43408 (used at 1:2000; Schroeter et al., 2000) is an anti-peptide antibody that was raised against an external epitope of human
In Situ Hybridization In situ hybridization was performed as described by Tessarollo and Parada (1995), except for the following modifications: The embryos/cultures were fixed with 4% paraformaldehyde 4 –12 h, incubated with 0.2% glycine in DEPC-PBS for 2 min, and permeabilized with 0.2% Triton X-100 for 30 min. For probe preparation, qNET was linearized with BamHI. The Genius 4 RNA Labeling kit (Boehringer-Mannheim) was used to synthesize digoxigenin-labeled RNA according to manufacturer instruction. For hybridization, the cultures were prehybridized with 50% formamide, 4⫻ SSC, 10% Dextran sulfate, 1⫻ Denhardts’ solution, 0.25% mg/ml yeast RNA, and 10 mg/ml sperm DNA (without probe) for 2 h at 50°C. The probe was used at 0.5–1 mg/ml. For visualization, we used alkaline phosphatase-conjugated anti-digoxigenin-antibodies and BM purple according to manufacturer instruction. The tissue was then rinsed
548
Ren et al.
FIG. 6. NET immunoreactivity in neural crest cell cultures and in the embryo. Culture: Neural crest cells were grown in defined culture medium in the absence of added growth factors. (a) NET-immunoreactivity in 6-h neural crest cell cultures. Whereas many cells show low levels of fluorescein-immunofluorescence, a few cells are intensely fluorescent (arrow). (b) Negative control (no primary antibody). (c) In day 4 cultures, neuronal cells are NET-immunoreactive. (d) Anti-neuron specific beta III-tubulin immunofluorescence in the same field as in (c) to identify neuronal cells. Arrowhead marks the same cell in both images. Bar, 20 m. Day 2.5 Embryo: (e) In day 2.5 embryos, NET immunofluorescence is high in neural crest cells that are leaving the neural tube, in the roof plate of the neural tube and in the myotome. (f) Corresponding HNK-1 immunoreactivity in the same section. (g, h) Higher magnification of (e, f) . Two qNET⫹/HNK-1⫹ neural crest cells are marked by arrows. Day 3.5 embryo: (i) qNET immunoreactivity. (k) Corresponding HNK-1 stain in the same section. The neural crest derivatives, dorsal root ganglion (drg), sympathetic ganglion (sg), and putative Schwann cell precursors in the ventral root (vr) are qNET immunoreactive, as well as the neural tube (nt) and the notochord (n). NET-immunoreactive noncrest tissues include the neural tube (nt), myotome (m), and dorsal aorta (da). Bars: (e, f, i, k), 200 m; (g, h), 25 m.
briefly with water, air dried, and then mounted with 70% glycerol and a cover slip and sealed. The intensity of reaction product was determined with Metamorph software (n ⫽ 20–40 cells per experimental group).
ACKNOWLEDGMENTS We thank Drs. Yves-Alain Barde and Ilse Bartke for a generous gift of NT-3 blocking antibody, Dr. Sally Schroeter for her advice on
Autocrine Regulation of NET Expression
NET-immunohistochemistry and Dr. Stephen Duncan for his advice with in situ hybridization. MSB thanks Dr. Joe Besharse for his support. The work was supported by a research grant from the Medical College of Wisconsin (MSB) and USPHS grants from the National Institute of Neurological Disease and Stroke (NS38281, MSB), the National Institute of Drug Abuse (DA07595, SGA) and the National Institute for Mental Health (MH58921, RDB). PP received funding from the Deutsche Forschungsgemeinschaft. SGA is an investigator with the Howard Hughes Medical Institute.
REFERENCES Amara, S. G. (1995). Monoamine transporters: Basic biology with clinical implications. Neuroscientist 1: 259 –267. Axelrod, J. (1965). The metabolism, storage, and release of catecholamines. Recent Progr. Hormone Res. 21: 597– 619. Axelrod, J., Weil-Malherbe, H., and Tomchick, R. (1959). The physiological disposition of H3-epinphrine and its metabolite metanephrine. J. Pharmacol. Exp. Ther. 127: 251–256. Blakely, R. D., Ramamoorthy, S., Schroeter, S., Qian, Y., Aparsundaram, S., Galli, A., and DeFelice, L. J. (1998). Regulated phosphorylation and trafficking of antidepressant-sensitive serotonin transporter proteins. Biol. Psychiatry 44: 169 –178. Buchman, V. L., Sporn, M., and Davies, A. M. (1994). Role of transforming growth factor-beta in regulating the expression of nerve growth factor and neurotrophin-3 mRNA levels in embryonic cutaneous cells at different stages of development. Development 120: 1621–1629. Brauer, P. R., and Yee, J. A. (1993). Cranial neural crest cells synthesize and secrete a latent form of transforming growth factor  that can be activated by neural crest cell proteolysis. Dev. Biol. 155: 281–285. Bru¨ss, M., Po¨rzgen, P., Bryan-Lluka, L. J., and Bo¨nisch, H. (1997). The rat norepinephrine transporter: Molecular cloning from PC12 cells and functional expression. Brain Res. Mol. Brain Res. 52: 257–262. Burt, D. W., and Paton, I. R. (1991). Molecular cloning and primary structure of the chicken transforming growth factor-2 gene. DNA Cell Biol. 10: 723–734. Cai, F., Campana W. M., Tomlinson, D. R., and Fernyhough, P. (1999). Transforming growth factor-beta1 and glial growth factor 2 reduce neurotrophin-3 mRNA expression in cultured Schwann cells via a cAMP-dependent pathway. Brain Res. Mol. Brain Res. 71: 256 –264. Farin˜as, I., Jones, K. R., Mackus, C., and Reichardt, L. F. (1994). Severe sensory and sympathetic deficits in mice lacking neurotrophin-3. Nature 369: 658 – 661. Fritz, J. D., Jayanthi, L. D., Thoreson, M. A., and Blakely, R. D. (1998). Cloning and chromosomal mapping of the murine norepinephrine transporter. J. Neurochem. 70: 2241–2251. Gaese, F., Kolbeck, R., and Barde, Y.-A. (1994). Sensory ganglia require neurotrophin-3 early in development. Development 120: 1613– 1619. Gershon, M. D., Rothman, T. P., Joh, T. H., and Teitelman, G. N. (1984). Transient and differential expression of aspects of the catecholaminergic phenotype during development of the fetal bowel of rats and mice. J. Neurosci. 4: 2269 –2280. Hamburger, V., and Hamilton, H. (1951). A series of normal stages in the development of the chick embryo. J. Morphol. 88: 49 –92. Henion, P. D., Garner, A. S., Large, T. H., and Weston, J. A. (1995). TrkC-mediated NT-3 signaling is required for the early development of a subpopulation of neurogenic neural crest cells. Dev. Biol. 172: 602– 613.
549 Heuer, J. G., von Bartheld, C. S., Kinoshita, Y., Evers, P., and Bothwell, M. (1990). Alternating phases of FGF receptor and NGF receptor expression in the developing chicken nervous system. Neuron 5: 283–296. Howard, M. J., and Gershon, M. D. (1993). Role of growth factors in catecholaminergic expression by neural crest cells: In vitro effects of transforming growth factor beta 1. Dev. Dynam. 196: 1–10. Iversen, L. L. (1967). The Uptake and Storage of Noradrenaline in Sympathetic Nerves. Cambridge Univ. Press, New York. Jakowlew, S. B., Dillard, P. J., Sporn, M. B., and Roberts, A. B. (1988a). Complementary deoxyribonucleic acid cloning of a messenger ribonucleic acid encoding transforming growth factor  4 from chicken embryo chondrocytes. Mol. Endocrinol. 2: 1186 –1195. Jakowlew, S. B., Dillard, P. J., Kondaiah, P., Sporn, M. B., and Roberts, A. B. (1988b). Complementary deoxyribonucleic acid cloning of a novel transforming growth factor- messenger ribonucleic acid from chicken embryo chondrocytes. Mol. Endocrinol. 2: 747–755. Lo, L, Tiveron, M.-C., and Anderson, D. J. (1998). Mash 1 activates expression of the paired homeodomain transcription factor Phox2a, and couples pan-neuronal and subtype-specific components of autonomic neuronal identity. Development 125: 609 – 620. Maisonpierre, P. C., Belluscio, L., Conover, J. C., and Yancopoulos, G. D. (1992). Gene sequences of chicken BDNF and NT-3. DNA Seq. 3(1): 49 –54. Murphy, M., Reid, K., Ford, M., Furness, J. B., and Bartlett, P. F. (1994). FGF2 regulates proliferation of neural crest cells, with subsequent neuronal differentiation regulated by LIF or related factors. Development 120: 3519 –3528. Pacholczyk, T., Blakely, R. D., and Amara, S. G. (1991). Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter. Nature 350: 350 –353. Panabieres, F., Piechaczyk, M., Rainer, B., Dani, C., Fort, P., Riaad, S., Marti, L., Imbach, J. L., Jeanteur, P., and Blanchard, J.-M. M. (1984). Complete nucelotide sequence of the messenger RNA coding for chicken muscle glyceraldehyde-3-phosphate dehydrogenase. Biochem. Biophys. Res. Commun. 118: 767–773. Pinco, O., Carmeli, C., Rosenthal, A., and Kalcheim, C. (1993). Neurotrophin-3 affects proliferation and differentiation of distinct neural crest cells and is present in the early neural tube of avian embryos. J. Neurobiol. 24: 1626 –1641. Rothman, T. P., Gershon, M. D., and Holtzer, H. (1978). The relationship of cell division to the acquisition of adrenergic characteristics by developing sympathetic ganglion cell precursors. Dev. Biol. 65: 322–341. Roux, K. H. (1995). Optimization and troubleshooting in PCR. PCR Methods Appl. 4(5): S185–S194. Schroeter, S., Apparsundaram, S., Wiley, R. G., Miner, L. A. H., Sesack, S. R., and Blakely, R. D. (2000). Immunolocalization of the cocaine- and antidepressant-sensitive l-norepinephrine transporter. J. Comp. Neurol. 420: 211–232. Sieber-Blum, M. (1989a). Inhibition of the adrenergic phenotype in cultured neural crest cells by norepinephrine uptake inhibitors. Dev. Biol. 136: 372–380. Sieber-Blum, M. (1989b). Commitment of neural crest cells to the sensory neuron lineage. Science 243: 1608 –1611. Sieber-Blum, M. (1999). The neural crest colony assay: Assessing molecular influences on development in culture. In The Neuron in Tissue Culture, IBRO, pp 5–22. Wiley. Sieber-Blum, M., and Chokshi, H. R. (1985). In vitro proliferation and terminal differentiation of quail neural crest cells in a defined culture medium. Exp. Cell Res. 158: 267–272. Sieber-Blum, M., and Cohen, A. M. (1980). Clonal analysis of quail
550 neural crest cells: They are pluripotent and differentiate in vitro in the absence of non-crest cells. Dev. Biol. 80: 96 –106. Sieber-Blum, M., and Sieber, F. (1984). Heterogeneity among early quail neural crest cells. Dev. Brain Res. 14: 241–246. Snyder, S. H. (1970). Putative neurotransmitters in the brain: Selective neuronal uptake, subcellular localization, and interactions with centrally acting drugs. Biol. Psychiatry 2: 367–389. Strudel, G., Recasens, M., and Mandel, P. (1997). Identification de catecholamines et de serotonine dans les chordes d’embryons de poulet. C.R. Acad. Sci. Paris 284: 967–969. Tessarollo, L., Tsoulfas, P., Martin-Zanca, D., Gilbert, D. J., Jenkins, N. A., Copeland, N. G., and Parada, L. F. (1993). TrkC, a receptor for neurotrophin-3 is widely expressed in the developing nervous system. Development 118: 463– 475. Tessarollo, L., and Parada, L. F. (1995). In situ hybridization. Methods Enzymol. 254: 419 – 430. Whitby, L. G., Hertting, G., and Axelrod, J. (1960). Effect of cocaine on the disposition of noradrenaline labelled with tritium. Nature 187: 604 – 605. Xue, Z.-G., Smith, J., and Le Douarin, N. M. (1985). Differentiation of catecholaminergic cells in cultures of embryonic avian sensory ganglia. Proc. Natl. Acad. Sci. USA 82: 8800 – 8804.
Ren et al.
Zaremba, S., Naegele, J. R., Barnstable, C. J., and Hockfield, S. (1990). Neuronal subsets express multiple high-molecular-weight cell-surface glycoconjugates defined by monoclonal antibodies Cat-301 and VD1.1. J. Neurosci. 10: 2985–2995. Zhang, Y., and Derynck, R. (1999). Regulation of Smad signaling by protein associations and signaling crosstalk. Trends Cell Biol. 9: 274 –279. Zhang, J.-M., and Sieber-Blum, M. (1992). Characterization of the norepinephrine uptake system and the role of norepinephrine in the expression of the adrenergic phenotype by quail neural crest cells in clonal culture. Brain Res. 570: 251–258. Zhang, J.-M., Dix, J., Langtimm-Sedlak, C. J., Trusk, T., Schroeder, B., Hoffmann, R., Strosberg, A. D., Winslow, J. W., and Sieber-Blum, M. (1997a). Neurotrophin-3 and Norepinephrine-mediated adrenergic differentiation and the inhibitory action of desipramine and cocaine. J. Neurobiol. 32: 262–280. Zhang, J. M., Hoffmann, R., and M. Sieber-Blum, M. (1997b). Mitogenic and anti-proliferative signals for neural crest cells and the neurogenic action of TGF-1. Dev. Biol. 208: 375–386. Zhang, D. Yao, L., and Bernd, P. (1994). Expression of trk and neurotrophin RNA in dorsal root and sympathetic ganglia of the quail during development. J. Neurobiol. 25: 1517–1532. Received September 11, 2000 Revised November 20, 2000 Accepted December 4, 2000
MCN
Autocrine Regulation of Norepinephrine Transporter Expression Z. G. Ren,* P. Po¨rzgen, † J. M. Zhang,* X. R. Chen,* S. G. Amara, †,‡ R. D. Blakely, § and M. Sieber-Blum* ,1 *Department of Cell Biology, Neurobiology and Anatomy, Medical College of Wisconsin, Milwaukee, Wisconsin 53226; †Vollum Institute and ‡Howard Hughes Medical Institute, Oregon Health Sciences University, Portland, Oregon 97201; and §Department of Pharmacology, Vanderbilt University, Nashville, Tennessee 37232
The1 norepinephrine transporter (NET) is a neurotransmitter scavenger and site of drug action in noradrenergic neurons. The aim of this study was to identify mechanisms that regulate NET expression during the development of quail (q) sympathetic neuroblasts, which develop from neural crest stem cells. Neurotrophin-3 (NT-3) and transforming growth factor 1 (TGF-1) cause an increase of qNET mRNA levels in neural crest cells. When combined, the growth factors are additive in increasing qNET mRNA levels. Both NT-3 and TGF-1 are synthesized by neural crest cells. Onset of NET expression precedes the onset of neural crest stem cell emigration from the neural tube. In older embryos, qNET is expressed by several crest-derived and noncrest tissues. The data show that qNET expression in presumptive sympathetic neurons is initiated early in embryonic development by growth factors that are produced by neural crest cells themselves. Moreover, the results support our previous observations that norepinephrine transport contributes to the regulation of the differentiation of neural crest stem cells into sympathetic neurons.
INTRODUCTION In adult neurons, NET serves to remove excess transmitter from the synaptic cleft (Axelrod, 1965; Iversen, 1967; Snyder, 1970) and is a site of action of drugs that block norepinephrine transport, such as tricyclic antidepressants and cocaine, (Axelrod et al., 1961; Whitby et al., 1960). The human (Pacholczyk et al., 1991), mouse (Fritz et al., 1998), and rat (Bru¨ss et al., 1997) NET genes have been cloned and characterized. In the adult mammalian organism, the same NET gene is expressed in the
peripheral and central nervous systems in sympathetic neurons, the adrenal gland, and the locus ceruleus in the brain stem (Amara, 1995). In developing noradrenergic neurons, norepinephrine transport leads to the expression of tyrosine hydroxylase and dopamine--hydroxylase in differentiating neural crest cells, suggesting that NET is involved in promoting the differentiation of neural crest stem cells into sympathetic neurons (Sieber-Blum, 1989; Zhang and Sieber-Blum, 1992; Zhang et al., 1997a). After leaving the dorsal aspect of the neural tube, presumptive noradrenergic neural crest cells migrate dorsoventrally between the somite and the neural tube and past the notochord. Ultimately they settle near the dorsal aorta, where they start to synthesize catecholamines and differentiate into the primary sympathetic ganglia. Despite the importance of NET function, the mechanisms that regulate NET expression, the time course of NET expression, and the NET expression patterns in the embryo are not well defined. We have cloned a partial qNET cDNA and used it to determine the function of candidate growth factors in NET expression. Our data show that NT-3 and TGF-1 cause an increase in NET mRNA levels in an additive manner. Both growth factors are expressed by migratory neural crest cells, thus indicating that they have autocrine or paracrine function. Moreover, NET is expressed in a number of neural crest-derived and noncrest embryonic tissues of both ectodermal and mesodermal origin.
RESULTS Cloning of a Partial Quail NET cDNA
1 To whom correspondence and reprint requests should be addressed. Fax: 414-456-6517. E-mail: [email protected].
1044-7431/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
A partial qNET cDNA was cloned from RNA of cultured quail neural crest cells (Genbank Accession
539
FIG. 1. Sequence of partial qNET clone. Deduced amino acid sequence and clustal align with human NET (hNET), mouse NET (mNET), human dopamine transporter (hDAT), and human serotonin transporter (hSERT). Sequence marked blue, extracellular loop. Sequence marked red (W124 –T373) was used for in situ hybridization. Sequence marked with yellow was used as an immunogen to raise antibody 43408.
540 Ren et al.
Autocrine Regulation of NET Expression
541 that the cloned transporter fragment is part of the quail NET gene. This notion is further supported by a positive in situ hybridization signal in the locus ceruleus (data not shown).
Increase in NET mRNA Levels in the Presence of NT-3 and TGF-1 Neural crest cell explants were grown in a chemically defined culture medium (Sieber-Blum and Chokshi, 1985; Sieber-Blum, 1999). RNA from 24-h cultures that were grown in the presence and absence of growth factors was isolated and amplified by RT-PCR with qNET-specific and GAPDH-specific primers. In contrast FIG. 2. RT-PCR amplification of qNET, TGF-, and NT-3 mRNA from 24-h neural crest cell cultures. (A) qNET RT-PCR. Each panel shows five independent experiments, in which 18 –22 neural crest cell cultures served as a starting material for the RT-PCR experiments. The band densities were quantified by fluorimaging, expressed as ratio NET:GAPDH, and statistically analyzed by 1-factor analysis of variance. Top panel: In this control the cells were grown in defined culture medium in the absence of added growth factors. Upper bands, GAPDH; lower bands, qNET. A qNET band was observed, suggesting either an autocrine mechanism of qNET expression or qNET expression prior to the onset of neural crest cell migration. Second panel: Cells were grown in defined culture medium in the presence of anti-NT-3 blocking antibodies (4 g/ml) and anti-pan TGF- blocking antibodies (4 g/ml). The qNET band is significantly reduced, suggesting that neural crest cells synthesize NT-3 and TGF- and that the growth factors increase qNET mRNA levels by an autocrine mechanism. Third panel: Cells were grown in the presence of FGF-2 (2.5 ng/ml) and NT-3 (10 ng/ml). The qNET band is significantly increased compared to the control without growth factors and the control with blocking antibodies. Fourth panel: When cells were grown in the presence of TGF-1 (1 ng/ml), the qNET band was increased. Fifth panel: When the cells were grown in the presence of all three factors, FGF-2, NT-3, and TGF-1, the band intensity was further increased, indicating an additive mechanism. All values were significantly different from each other (P ⱕ 0.006). (B) TGF- and NT-3 RT-PCR. RNA was isolated from 24-h neural crest cell cultures that had been grown in defined culture medium in the absence of noncrest cells and in the absence of added growth factors. The data suggest that early migratory neural crest cells synthesize all three TGF-s, as well as NT-3.
No. AF230787). The cloned fragment encodes 515 amino acids (aa) and shows 88% aa identity to human NET (hNET), 88% to mouse NET (mNET), 71% to the human dopamine transporter (hDAT), and 52% to the human serotonin transporter (hSERT; Fig. 1). The moderately conserved large extracellular loop domain of the transporters shows a high degree of identity between the qNET and the mammalian NETs, but significant differences to hDAT and hSERT, strongly suggesting
FIG. 3. qNET in situ hybridization of cultured neural crest cells. (a) Cells were grown for in the presence of FGF-2 and NT-3 for 48 h (h 0 – 48) to promote proliferation. At 24 h, TGF-1, which inhibits cell proliferation, was added as well (h 24 – 48). At 48 h of culture, the cells were processed for in situ hybridization with anti-sense probe. (b) Cells were grown in the presence of NT-3 blocking antibodies and pan-TGF- blocking antibodies and subsequently hybridized with anti-sense probe. (c) Control in which cells were grown in the presence of FGF-2, NT-3, and TGF-1 and hybridization was done with sense probe. The hybridization signal is significantly reduced in (b) and (c). Bar, 25 m.
542 to expectation, a qNET band was present in RNA from control neural crest cell cultures that were grown in the absence of added growth factors (Fig. 2A; top panel). This indicated either expression of qNET prior to onset of migration of neural crest cells or autocrine regulation of NET expression. To investigate autocrine regulation, neural crest cells were grown in the presence of antiNT-3 and anti-pan TGF- blocking antibodies. The viability of the cells was not affected (not shown), but the qNET band was significantly decreased (P ⫽ 0.0001; Fig. 2A, second panel), suggesting autocrine regulation of NET expression. Both the FGF-2/NT-3 combination and TGF-1 caused a significant increase in NET mRNA levels over the antibody control (P ⫽ 0.0001 for both; Fig. 2A, panels 3 and 4). FGF-2 by itself does not affect NE transport but potentiates NT-3 action (Zhang et al., 1997a, b). When the cells were grown in the presence of all three growth factors, NET mRNA levels were elevated significantly (P ⫽ 0.0001; Fig. 2A, bottom panel) compared to FGF-2 ⫹ NT-3 and to TGF-1, indicating that FGF-2/NT-3 and TGF-1 synergize in increasing NET mRNA levels. Data from all control and experimental groups were significantly different from each other (P ⱕ 0.006). Equivalent results were obtained by in situ hybridization of cultured neural crest cells with a NET probe (Fig. 3). Cells were grown in the presence of FGF-2, NT-3, and TGF-1 (Figs. 3a and 3c) or in the presence of NT-3 blocking antibodies and pan TGF- blocking antibodies (Fig. 3b) and processed for in situ hybridization. The relative intensity of the alkaline phosphatase reaction product was high with antisense probe in cells grown in the presence of the growth factors (141.3 ⫾ 5.7; Fig. 3a), but significantly lower when the cells were grown in the presence of the blocking antibodies (63.3 ⫾ 2.5; P ⬍ 0.001; Fig. 3b), comparable to the staining intensity with sense probe (negative control; 57.5 ⫾ 1.7; P ⬍ 0.001; Fig. 3c). The combination of FGF-2 and NT-3 increases NET function as measured by high-affinity uptake of tritiated NE and subsequent autoradiography in neural crest cell colony assays (Zhang et al., 1997a; SieberBlum, 1999). Here we show by the same method that TGF-1 also promotes NE transport activity and that the FGF-2/NT-3 plus TGF-1 combination is additive (Table 1). In these experiments the cells were grown in the presence of 4% horse serum and 2.5% chick embryo extract. It is thus possible that under those culture conditions additional mechanisms, such as activation of the transporter, might operate in addition to the NT-3 and TGF--mediated increase of NET expression.
Ren et al.
NT-3 and TGF- Expression in Neural Crest Cells and Noncrest Cells in Vitro and in Vivo The idea of autocrine growth factor production was confirmed at the mRNA and protein levels in neural crest cell cultures and in the embryo. RNA isolated from 24 h neural crest cell cultures that were grown in defined culture medium was amplified by RT-PCR with growth factor-specific primer pairs. RT-PCR products were obtained for NT-3, TGF-1, TGF-2, and TGF-3 (Fig. 2B). Virtually all neural crest cells in culture and in the 3.5-day-old quail embryo were strongly immunoreactive for NT-3 as detected by confocal microscopy (Fig. 4). During advanced development, the neural tube (see also Pinco et al., 1993), the dorsal root ganglion, the ventral root, the sympathetic ganglion (see also Zhang et al., 1994), the dorsal aorta, and the myotome (stationary somitic cells adjacent to the neural tube and migratory somitic cells on course to the limb bud) were intensely NT-3 immunoreactive (Fig. 4f). Figure 4g shows HNK-1 stain in the same section as in f. HNK-1 immunoreactivity is characteristic for migrating avian neural crest cells. This particular HNK-1 hybridoma clone (VC1.1) recognizes N-CAM and other cell-adhesion molecules and therefore also binds to the neural tube and the notochord (Zaremba et al., 1990). Virtually all neural crest cells also expressed TGF- both in vitro (see also Brauer and Yee, 1993) and in vivo, as determined with anti-pan TGF- antibodies (Fig. 5). Figure 5a shows TGF- immunoreactivity in cultured neural crest cells. Specificity of antibody binding is shown in the controls in Fig. 5b (no primary antibody) and Fig. 5c (preabsorbed primary antibody). Dorsoventrally migrating neural crest cells in the embryo were immunoreactive for TGF- (Fig. 5), as were the dorsal root ganglion, neural tube, ventral root, sympathetic ganglion, and the myotome cells (cells in somites adjacent to the neural tube and cells migrating into the limb bud; Fig. 5d). Figure 5e shows HNK-1 binding in the same section as in Fig. 5d. Figure 5f shows a higher magnification of the area marked in Fig. 5a, in which TGF- immunoreactive migrating neural crest cells and cells in the nascent dorsal root ganglion are visible.
NET Expression in the Neural Crest and in Neural Crest-Derivatives Since NET mRNA is expressed early in neural crest development (Figs. 2 and 3), we determined by confocal microscopy the time course of qNET protein expression. In culture, some neural crest cells expressed NET
543
Autocrine Regulation of NET Expression
TABLE 1 Increase in Norepinephrine Transport Activity in the Presence of NT-3 and TGF-
Experimental condition
Number of colonies per plate containing grainpositive cells
Total number of colonies per plate
Control (no growth factors) NT-3 TGF-1 NT-3 plus TGF-1
2.0 ⫾ 0.4 4.5 ⫾ 0.6* 4.3 ⫾ 0.7* 7.0 ⫾ 0.7*
32.0 ⫾ 1.4 34.3 ⫾ 1.2 29.8 ⫾ 0.6 35.4 ⫾ 1.5
Note. Cells in colony assay were cultured in the presence of 4% horse serum and 2.5% chick embryo extract. The data are averages from colony counts from 10 plates in each group. The total number of colonies per plate was unchanged (P ⫽ 0.38–0.76). *Significantly different from the control, P ⬍ 0.01.
at high levels already 6 h after explantation of the neural tube, the earliest time point postexplantation at which immunocytochemistry can be performed (Figs. 6a and 6b). Staining appeared to be predominantly intracellular. In 4-day-old cultures that had been grown in the presence of FGF-2 and NT-3, NET was expressed by neuronal cells (Figs. 6c and 6d). Immunoreactivity was stronger in neurites than in cell bodies. Similar to cultured neural crest cells, some neural crest cells in vivo expressed NET already at the onset of their emigration from the neural tube. Figures 6e– 6h shows a cross section through the trunk region of a 2.5-day-old embryo. Virtually all cells that form the leading edge of migratory neural crest cells are NET immunoreactive (Fig. 6e, NET fluoresceine fluorescence; Fig. 6f, HNK-1 rhodamine fluorescence). This subset of neural crest cells consists primarily of stem cells (Sieber-Blum, 1989b). Interestingly, the dorsal aspect of the neural tube, from which neural crest cells delaminate, is intensely immunoreactive (Figs. 6e and 6g), suggesting that premigratory neural crest cells are already NET-immunoreactive. In addition, myotome cells are NET-positive (Figs. 6e and 6g). In Figs. 6g and 6h, a higher magnification of part of Fig. 6e and 6f is shown. Two neural crest cells that express both NET and HNK-1 are marked by arrows. In 3.5-day-old embryos (Figs. 6i and 6k), NET was expressed by several neural crest-derived tissues, including the sympathetic ganglion, as expected, but also the dorsal root ganglion (drg), and putative Schwann cell precursors in the ventral root (vr). In addition, several noncrest tissues were NET-immunoreactive. The entire cross-section of the neural tube (nt) shows variable intensities of NET immunoreactivity. Moreover, the myotome (mt) and the lining of the dorsal
aorta (da) are NET-immunoreactive. Controls for immunohistochemistry included omitting one of the two first antibodies and indicated that immunofluorescene was NET-specific and HNK-1-specific, respectively (data not shown).
DISCUSSION The main observation in this report is that both the FGF-2/NT-3 combination and TGF-1 regulate expression of the norepinephrine transporter, as indicated by an increase in steady state qNET mRNA levels. Their action is additive. Moreover, the growth factors are synthesized by neural crest cells, the precursors of sympathetic neurons. Therefore they are likely to act as neural crest-autocrine factors. Since the early migratory neural crest already is a heterogeneous population consisting of pluripotent stem cells, committed cells and cells with restricted developmental potentials (SieberBlum and Sieber, 1984), it remains to be determined whether the neural crest cells that express NET also express the three growth factors, or whether some or all factors are supplied by neighboring cells in a paracrine fashion. Moreover, it is possible that the mechanism of growth factor-mediated increase in qNET mRNA levels is indirect, insofar as NT-3 and/or TGF-1 could induce another factor, which in turn promotes NET expression. NT-3 and TGF-1 activate independent signaling pathways, which may, however, converge as they share downstream mediators. For example, MAP kinase kinase-1 (MEKK-1), which is a member of a neurotrophinactivated pathway, can activate Smad2, a signaling mediator downstream of TGF- (reviewed by Zhang and Derynck, 1999). Alternatively it is conceivable that TGF- promotes expression of NT-3. This possibility, however, is unlikely for two reasons. One, in both neurons (Buchman et al., 1994) and Schwann cells (Cai et al., 1999), TGF- inhibits expression of NT-3. Two, we have shown that the 10 ng/ml concentration of NT-3 that was used in this study elicits a maximal response in cultured neural crest cells (Zhang et al., 1997a). Neural crest cells express the NT-3 receptor, TrkC, when they leave the neural tube (Tessarollo et al., 1993; Henion et al., 1995) and require NT-3 (Farinas et al., 1994). NT-3 is unique among neurotrophins of the NGF family in promoting NE transport (Zhang et al., 1997a). In contrast, it remains to be determined whether TGF-1 is the sole active physiological member of this family of growth factors, in particular since TGF-2 and TGF-3 are also produced by neural crest cells. In addition to promoting NET expression, the three growth
544
Ren et al.
FIG. 4. NT-3 immunoreactivity in 12-h neural crest cell cultures and in the embryo. Culture: (a) Virtually all neural crest cells are strongly immunoreactive (fluorescein fluorescence). (b) Negative control for secondary antibody: no first antibody. (c) Negative control for primary antibody: preabsorbed first antibody. Bar, 20 m. Embryo: (d) Cross-section through the rostral trunk region of a day 3.5 embryo during early neural crest cell migration. Migrating neural crest cells are NT-3 immunoreactive. (e) Higher magnification of area marked by white square in (d). (f) NT-3 immunoreactivity in caudal axial levels during late neural crest cell migration. (g) HNK-1 immunoreactivity (rhodamine fluorescence) in the same section as (f) to mark neural crest cells and their derivatives. The entire cross section of the neural tube, the sympathetic ganglion (sg), dorsal root ganglion (drg), ventral root (vr), myotome (mt) adjacent to neural tube and migrating into limb bud and the dorsal aorta (da) are immunoreactive. Bar (d, f, g), 200 m; (e), 25 m.
factors regulate neural crest cell proliferation. FGF-2 is a mitogen for neural crest cells and renders them dependent on neurotrophins (Zhang et al., 1997b). Neurotrophins, including NT-3, rescue neural crest cells that proliferate in response to FGF-2 action (Zhang et al., 1997b). In contrast, TGF-1 is a potent anti-proliferative agent that dominates over the FGF-2/NT-3 proliferative effect (Zhang et al., 1997b). In addition, TGF-1 promotes expression of neuronal traits (Howard and Gershon, 1993; Zhang et al., 1997b). Thus FGF-2, NT-3, and TGF-1, alone and in combination, have multiple functions in neural crest cell development. Figure 7 summarizes the functions of FGF-2, NT-3, TGF-, and NET in sympathetic neuron differentiation. A second observation in the present study is that NET is already expressed in sympathetic neuron progenitor cells, the neural crest. NET protein is expressed in the roof plate of the neural tube, from which neural
crest cells delaminate, and in early migratory neural crest cells in vitro and in vivo, suggesting that qNET is expressed by neural crest cells before they leave the neural tube. The leading edge of the migrating neural crest cell population consists primarily of two classes of pluripotent stem cell (Sieber-Blum, 1989b), suggesting that at least some neural crest stem cells express qNET. Rothman et al. (1978) have shown that avian neural crest cells acquire the capacity to transport NE during advanced migration, when they arrive in the vicinity of the notochord. Thus there appears to be a lag phase during which neural crest cells express qNET protein, but not yet a functional transporter. It is conceivable that NET protein trafficking is involved in regulating NET function, as has been shown for the serotonin transporter (Blakely et al., 1998). It is interesting to note that several crest-derived and noncrest qNET-expressing tissues also express
545
Autocrine Regulation of NET Expression
FIG. 5. TGF- immunoreactivity in 12 h neural crest cell cultures and in the embryo. Culture: (a) Virtually all neural crest cells in 12-h cultures bind anti-pan TGF- antibodies. (b) Negative control for second antibody: no primary antibody. (c) Negative control for first antibody: preabsorbed primary antibody. Bar, 20 m. Embryo: (d) pan-TGF- immunoreactivity in day 3.5 embryo. The sympathetic ganglion (sg), dorsal root ganglion (drg), ventral root (vr), neural tube (nt), and myotome (m) are immunoreactive. (e) HNK-1 immunoreactivity in the same embryonic section to identify neural crest cells and neural crest derivatives. (f) Higher magnification of area marked by white square in (e) shows migrating neural crest cells and the dorsal part of the dorsal root ganglion. Bars: (d, e) 200 m; (f) 25 m.
both NT-3 and TGF-. They include the dorsal root ganglion, the sympathetic ganglion, the ventral root, the neural tube, and the somitic myotome. It is thus conceivable that autocrine regulation of NET expression is not limited to the neural crest, but occurs in several or all NET-expressing tissues. The significance of qNET expression in tissues other than the sympathetic ganglion remains to be determined. In this context it is interesting, however, that both sensory neuroblasts in the dorsal root ganglion and enteric neuroblasts express NET and become transiently adrenergic during embryonic development (Gershon et al., 1984; Xue et al., 1985). In summary, our data indicate that the quail NET is highly homologous to mammalian NETs and that its expression is mediated by autocrine FGF-2, NT-3, and TGF-. They further suggest that NET is expressed already in some premigratory neural crest cells, most likely in stem cells.
EXPERIMENTAL PROCEDURES Cloning of a Partial Quail NET Quail neural crest cells were grown for 4 days in culture and total RNA was isolated using the RNA STAT-60 kit (TEL-TEST Inc., Friendswood, TX). A cDNA pool was generated using hexamers and oligo dT12-18mer as primers (cDNA Synthesis System, Life
Technologies), followed by touch-down RT-PCR (Roux KH, 1995) with degenerated NET-specific oligos: NETEL2s (5⬘TGG ACC ASY CCM AAY TGY ACN GAC CC3⬘) and NET-IL4as (5⬘GTG ATR ACH GCY TCC ATR CCW CCC AT3⬘). A 750-bp PCR products was subcloned into pCRII (Invitrogen) and sequenced. From this fragment we designed two outward facing primers, which were subsequently used together with degenerated NET primers from TM1 (5⬘GRG AGM MYT GGG GCA AGR ARA TYG A3⬘) and TM12 (5⬘TAG RYR GGB ACC AGR ABC ATG GAK GA3⬘) to clone 3 overlapping fragments that encode 515aa of the qNET gene. For the in situ hybridization experiments we used the initial 750-bp PCR product, cloned in both orientations into pCRII, reverse-transcribed from the vector’s T7 promoter.
Neural Crest Primary Cultures Neural crest cell cultures were prepared and maintained in chemically defined culture medium as described previously (Sieber-Blum and Cohen, 1980; Sieber-Blum, 1999). Thirty-five-millimeter culture plates were coated with collagen, laminin (28 g per plate), and fibronectin (100 g plasma fibronectin from horse serum). The last six segments of Hamburger-Hamilton (1951) stage 14 quail embryos (49 h of incubation) were excised and isolated. At 24 h postexplantation, the neural tubes were removed, leaving the emigrated neural
546
Ren et al.
state Biotechnology) at 2.5 ng/ml, and hrNT-3 (gift of Genentech Inc., South San Francisco, CA and from Promega, Madison, WI) at 10 ng/ml. Where indicated anti-NT-3 blocking antibody (mouse monoclonal IgG, 2 mg/ml; gift of Y.-A. Barde and I. Bartke; Gaese et al. 1994) were added to the cultures at 1:500 and pan-TGF- blocking antibodies (rabbit IgG, 1 mg/ml, Research Biochemicals International, Natick, MA) at 1:250. Neural Crest Colony Assay
FIG. 7. Summary of FGF-2, NT-3, TGF-1, and NET action in the differentiation of quail neural crest cells into sympathetic neuroblasts. FGF-2 is synthesized by early migratory neural crest cells, which express FGF receptor (Heuer et al., 1990; Murphy et al., 1994). FGF-2 is mitogenic for all neural crest cells (Zhang et al., 1997b). However, proliferating presumptive neuronal cells do not survive unless a neurotrophin (NGF, BDNF, or NT-3) is present as well. NT-3 is synthesized by neural crest cells (Fig. 3). NT-3 causes an increase in qNET mRNA levels (Fig. 2). TGF-1 causes cessation of neural crest cell proliferation (Zhang et al., 1997) and an increase in qNET expression (Fig. 2). TGF-s are synthesized by neural crest cells (Fig. 3) and may thus also act as autocrine factors. The avian notochord synthesizes NE (Strudel et al., 1977). As NET-expressing neural crest cells migrate past the notochord, they are likely to encounter and transport NE. NE transport causes an increase in Ca 2⫹ transients and eventually leads to the expression of the NE biosynthetic enzymes, tyrosine hydroxylase (TH) and dopamine--hydroxylase (DBH; Zhang et al., 1997b).
crest cells on the substratum. The culture medium was exchanged every day. The cultures were incubated at 37°C in a humidified atmosphere of 5% CO 2 and 10% O 2. The defined culture medium consisted of MCDB 201 and was supplemented with transport factors, hormones, vitamins, and small molecular nutrients as described (Sieber-Blum and Chokshi, 1985; Sieber-Blum, 1999). It did not contain any serum or embryo extract except where indicated (Table 1). TGF 1 (Upstate Biotechnology, Lake Placid, NY) was used at 1 ng/ml (Zhang et al., 1997b), FGF-2 (Up-
Neural crest cell colony assays were performed as described (e.g., Sieber-Blum and Cohen, 1980; Zhang et al., 1997a; Sieber-Blum, 1999). Briefly, cells from 18 –24 h primary explants were resuspended by trypsinization and the cell density adjusted to 500 cells per milliliter. One-milliliter aliquots were then placed into each of 10 collagen- and fibronectin-coated plates per experimental group. The cells attached to the substratum within half an hour. One hour after plating, a second milliliter of culture medium, which in experimental groups contained a 2⫻ concentration of growth factor(s), was added to each plate. The culture medium and growth factors were replaced every other day. At day 10, the cultures were processed for norepinephrine uptake as detailed below. Norepinephrine Uptake and Autoradiography Neural crest cells with a functional norepinephrine transporter were identified in situ in colony assays exactly as described previously (Zhang and Sieber-Blum, 1992). Briefly, the cultures were rinsed with Hanks’ balanced salt solution (HBSS) containing 1% bovine serum albumin (BSA). They were then incubated for 2 h at 37°C with 0.5 ml of 0.5 M [ 3H]norepinephrine (sp act, 40.8 Ci/mmol) in HBSS that also contained 1 mM ascorbic acid and 0.1 mM monoamine oxidase inhibitor, pargyline (Sigma). Subsequently, uptake of radioactive norepinephrine was terminated by rinsing the cultures three times with HBSS that contained 24 mM nonradioactive norepinephrine (d,l-arterenol; Sigma), fixed with 4% paraformaldehyde in calcium-magnesium-free PBS for 20 min at room temperature, and rinsed again. The cultures were then dried in a stream of cold air, coated in the dark with NTB2 emulsion (Kodak) for 2.5 min, and air-dried in the dark. After 10 days of exposure at 4°C, autoradiograms were developed with D-19 (Kodak) for 2.5 min, rinsed with 1% acetic acid, and fixed with Rapid Fix (Kodak). Plates were mounted with mineral oil and a coverslip. The total number of
547
Autocrine Regulation of NET Expression
colonies per plate and the number of colonies that contained grain-positive cells were scored and the data statistically analyzed by 1-factor analysis of variance.
RT-PCR Primers were synthesized by Operon Technologies, Inc. (Alameda, CA). The following primer pairs were used. TGF-1; CAAGCTGAGCGTGCACTGT and TCCTTGCGGAAGTCGATGT (product length, 281 bp; Jakowlew et al., 1988a). TGF-2; AGGAATGTGCAGGATAATT and ATTTTGGGTGTTTTGCCAA (product length, 269 bp; Burt and Paton, 1991). TGF-3; GAGCAGAGTTCCGGGTGCT and GTGCAGAAGCCACTCACGC (product length, 200 bp; Jakowlew et al., 1988b). NT-3; CATATCTTCGTGGCATTCAG and CCAGTGGTGTGTTGTCACTT (product length, 306 bp; Maisonpierre et al., 1992). qNET; GGATTGATGCGGCTACTCAGA and GCTTCCATGCCACCCATAGA (product length, 358 bp). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH); ACG CCA TCA CTA TCT TCC AG and TCAGCTCAGGGATGACTTTC (product length, 458 bp; Panabieres et al., 1984). Total RNA was isolated using the RNA STAT-60 kit (TEL-TEST Inc.). For RT-PCR, the “Access RT-PCR System” (Promega) was used. Template RNA was reverse transcribed with AMV RT for 45 min at 48°C, followed by 2 min of inactivation of RT and denaturation at 94°C. The conditions for PCR reactions are described below. Denaturation NET GAPDH TGF-1 TGF-2 TGF-3 NT-3
94°C, 94°C, 94°C, 94°C, 94°C, 94°C,
30 s 30 s 1 min 1 min 1 min 30 s
Annealing 60°C, 60°C, 55°C, 55°C, 50°C, 60°C,
1 1 1 1 2 1
min min min min min min
Extension 68°C, 68°C, 72°C, 72°C, 72°C, 68°C,
2 2 2 2 3 2
min min min min min min
NET (TKYSKYKFTPAAEFY), which is highly conserved in qNET (identical except for F 3 L in qNET). Anti-NT-3 antibodies used for immunocytochemistry and immunohistochemistry (rabbit antiserum, 1:400; Pepro Tech Inc., Rocky Hill, NJ). Anti-panTGF  antibodies; rabbit IgG (used at 1:400; AB-100-NA; R&D Systems Inc., Minneapolis, MN). HNK-1; mouse monoclonal IgM (used at 1:1000; N-202RBI; Research Biochemicals International); Rhodamine-conjugated goat antibody to mouse (used at 1:100; Cappel 55540, Organon Teknika Corp., West Chester, PA). Fluoresceinconjugated goat antibody to rabbit (used at 1:80; Jackson Immunoresearch Laboratories, Inc., West Grove, PA). Method. The cell culture plates were rinsed with PBS, incubated with 5% normal goat serum in PBS for 30 min, and subsequently incubated overnight at 10°C with primary antibodies in PBS that contained 5% goat serum and 0.1% Triton-⫻100. For multiple stains, the primary antibodies were pooled. The sections/cultures were rinsed three times for 10 min each with PBS. The secondary antibodies were diluted in 5% normal goat serum in PBS, added to the sections/cultures, and incubated in the dark for 1 h at room temperature. For multiple stains the secondary antibodies were pooled. After three more rinses at 10 min each, the slides/ culture plates were mounted with 50% glycerol [containing 1 mg/ml paraphenylene diamine (PPD) in PBS, pH 8.5] and a cover slip and were observed with the confocal microscope.
Cycles 36 36 40 40 40 40
PCR products were analyzed by agarose gel (2%) electrophoresis, sequenced, and found to be correct. For controls, the PCR reaction was carried out without a template and without reverse transcriptase. The PCR conditions were optimized in pilot experiments to assure linear amplification.
Immunocytochemistry and Immunohistochemistry Antibodies. NET rabbit antiserum 43408 (used at 1:2000; Schroeter et al., 2000) is an anti-peptide antibody that was raised against an external epitope of human
In Situ Hybridization In situ hybridization was performed as described by Tessarollo and Parada (1995), except for the following modifications: The embryos/cultures were fixed with 4% paraformaldehyde 4 –12 h, incubated with 0.2% glycine in DEPC-PBS for 2 min, and permeabilized with 0.2% Triton X-100 for 30 min. For probe preparation, qNET was linearized with BamHI. The Genius 4 RNA Labeling kit (Boehringer-Mannheim) was used to synthesize digoxigenin-labeled RNA according to manufacturer instruction. For hybridization, the cultures were prehybridized with 50% formamide, 4⫻ SSC, 10% Dextran sulfate, 1⫻ Denhardts’ solution, 0.25% mg/ml yeast RNA, and 10 mg/ml sperm DNA (without probe) for 2 h at 50°C. The probe was used at 0.5–1 mg/ml. For visualization, we used alkaline phosphatase-conjugated anti-digoxigenin-antibodies and BM purple according to manufacturer instruction. The tissue was then rinsed
548
Ren et al.
FIG. 6. NET immunoreactivity in neural crest cell cultures and in the embryo. Culture: Neural crest cells were grown in defined culture medium in the absence of added growth factors. (a) NET-immunoreactivity in 6-h neural crest cell cultures. Whereas many cells show low levels of fluorescein-immunofluorescence, a few cells are intensely fluorescent (arrow). (b) Negative control (no primary antibody). (c) In day 4 cultures, neuronal cells are NET-immunoreactive. (d) Anti-neuron specific beta III-tubulin immunofluorescence in the same field as in (c) to identify neuronal cells. Arrowhead marks the same cell in both images. Bar, 20 m. Day 2.5 Embryo: (e) In day 2.5 embryos, NET immunofluorescence is high in neural crest cells that are leaving the neural tube, in the roof plate of the neural tube and in the myotome. (f) Corresponding HNK-1 immunoreactivity in the same section. (g, h) Higher magnification of (e, f) . Two qNET⫹/HNK-1⫹ neural crest cells are marked by arrows. Day 3.5 embryo: (i) qNET immunoreactivity. (k) Corresponding HNK-1 stain in the same section. The neural crest derivatives, dorsal root ganglion (drg), sympathetic ganglion (sg), and putative Schwann cell precursors in the ventral root (vr) are qNET immunoreactive, as well as the neural tube (nt) and the notochord (n). NET-immunoreactive noncrest tissues include the neural tube (nt), myotome (m), and dorsal aorta (da). Bars: (e, f, i, k), 200 m; (g, h), 25 m.
briefly with water, air dried, and then mounted with 70% glycerol and a cover slip and sealed. The intensity of reaction product was determined with Metamorph software (n ⫽ 20–40 cells per experimental group).
ACKNOWLEDGMENTS We thank Drs. Yves-Alain Barde and Ilse Bartke for a generous gift of NT-3 blocking antibody, Dr. Sally Schroeter for her advice on
Autocrine Regulation of NET Expression
NET-immunohistochemistry and Dr. Stephen Duncan for his advice with in situ hybridization. MSB thanks Dr. Joe Besharse for his support. The work was supported by a research grant from the Medical College of Wisconsin (MSB) and USPHS grants from the National Institute of Neurological Disease and Stroke (NS38281, MSB), the National Institute of Drug Abuse (DA07595, SGA) and the National Institute for Mental Health (MH58921, RDB). PP received funding from the Deutsche Forschungsgemeinschaft. SGA is an investigator with the Howard Hughes Medical Institute.
REFERENCES Amara, S. G. (1995). Monoamine transporters: Basic biology with clinical implications. Neuroscientist 1: 259 –267. Axelrod, J. (1965). The metabolism, storage, and release of catecholamines. Recent Progr. Hormone Res. 21: 597– 619. Axelrod, J., Weil-Malherbe, H., and Tomchick, R. (1959). The physiological disposition of H3-epinphrine and its metabolite metanephrine. J. Pharmacol. Exp. Ther. 127: 251–256. Blakely, R. D., Ramamoorthy, S., Schroeter, S., Qian, Y., Aparsundaram, S., Galli, A., and DeFelice, L. J. (1998). Regulated phosphorylation and trafficking of antidepressant-sensitive serotonin transporter proteins. Biol. Psychiatry 44: 169 –178. Buchman, V. L., Sporn, M., and Davies, A. M. (1994). Role of transforming growth factor-beta in regulating the expression of nerve growth factor and neurotrophin-3 mRNA levels in embryonic cutaneous cells at different stages of development. Development 120: 1621–1629. Brauer, P. R., and Yee, J. A. (1993). Cranial neural crest cells synthesize and secrete a latent form of transforming growth factor  that can be activated by neural crest cell proteolysis. Dev. Biol. 155: 281–285. Bru¨ss, M., Po¨rzgen, P., Bryan-Lluka, L. J., and Bo¨nisch, H. (1997). The rat norepinephrine transporter: Molecular cloning from PC12 cells and functional expression. Brain Res. Mol. Brain Res. 52: 257–262. Burt, D. W., and Paton, I. R. (1991). Molecular cloning and primary structure of the chicken transforming growth factor-2 gene. DNA Cell Biol. 10: 723–734. Cai, F., Campana W. M., Tomlinson, D. R., and Fernyhough, P. (1999). Transforming growth factor-beta1 and glial growth factor 2 reduce neurotrophin-3 mRNA expression in cultured Schwann cells via a cAMP-dependent pathway. Brain Res. Mol. Brain Res. 71: 256 –264. Farin˜as, I., Jones, K. R., Mackus, C., and Reichardt, L. F. (1994). Severe sensory and sympathetic deficits in mice lacking neurotrophin-3. Nature 369: 658 – 661. Fritz, J. D., Jayanthi, L. D., Thoreson, M. A., and Blakely, R. D. (1998). Cloning and chromosomal mapping of the murine norepinephrine transporter. J. Neurochem. 70: 2241–2251. Gaese, F., Kolbeck, R., and Barde, Y.-A. (1994). Sensory ganglia require neurotrophin-3 early in development. Development 120: 1613– 1619. Gershon, M. D., Rothman, T. P., Joh, T. H., and Teitelman, G. N. (1984). Transient and differential expression of aspects of the catecholaminergic phenotype during development of the fetal bowel of rats and mice. J. Neurosci. 4: 2269 –2280. Hamburger, V., and Hamilton, H. (1951). A series of normal stages in the development of the chick embryo. J. Morphol. 88: 49 –92. Henion, P. D., Garner, A. S., Large, T. H., and Weston, J. A. (1995). TrkC-mediated NT-3 signaling is required for the early development of a subpopulation of neurogenic neural crest cells. Dev. Biol. 172: 602– 613.
549 Heuer, J. G., von Bartheld, C. S., Kinoshita, Y., Evers, P., and Bothwell, M. (1990). Alternating phases of FGF receptor and NGF receptor expression in the developing chicken nervous system. Neuron 5: 283–296. Howard, M. J., and Gershon, M. D. (1993). Role of growth factors in catecholaminergic expression by neural crest cells: In vitro effects of transforming growth factor beta 1. Dev. Dynam. 196: 1–10. Iversen, L. L. (1967). The Uptake and Storage of Noradrenaline in Sympathetic Nerves. Cambridge Univ. Press, New York. Jakowlew, S. B., Dillard, P. J., Sporn, M. B., and Roberts, A. B. (1988a). Complementary deoxyribonucleic acid cloning of a messenger ribonucleic acid encoding transforming growth factor  4 from chicken embryo chondrocytes. Mol. Endocrinol. 2: 1186 –1195. Jakowlew, S. B., Dillard, P. J., Kondaiah, P., Sporn, M. B., and Roberts, A. B. (1988b). Complementary deoxyribonucleic acid cloning of a novel transforming growth factor- messenger ribonucleic acid from chicken embryo chondrocytes. Mol. Endocrinol. 2: 747–755. Lo, L, Tiveron, M.-C., and Anderson, D. J. (1998). Mash 1 activates expression of the paired homeodomain transcription factor Phox2a, and couples pan-neuronal and subtype-specific components of autonomic neuronal identity. Development 125: 609 – 620. Maisonpierre, P. C., Belluscio, L., Conover, J. C., and Yancopoulos, G. D. (1992). Gene sequences of chicken BDNF and NT-3. DNA Seq. 3(1): 49 –54. Murphy, M., Reid, K., Ford, M., Furness, J. B., and Bartlett, P. F. (1994). FGF2 regulates proliferation of neural crest cells, with subsequent neuronal differentiation regulated by LIF or related factors. Development 120: 3519 –3528. Pacholczyk, T., Blakely, R. D., and Amara, S. G. (1991). Expression cloning of a cocaine- and antidepressant-sensitive human noradrenaline transporter. Nature 350: 350 –353. Panabieres, F., Piechaczyk, M., Rainer, B., Dani, C., Fort, P., Riaad, S., Marti, L., Imbach, J. L., Jeanteur, P., and Blanchard, J.-M. M. (1984). Complete nucelotide sequence of the messenger RNA coding for chicken muscle glyceraldehyde-3-phosphate dehydrogenase. Biochem. Biophys. Res. Commun. 118: 767–773. Pinco, O., Carmeli, C., Rosenthal, A., and Kalcheim, C. (1993). Neurotrophin-3 affects proliferation and differentiation of distinct neural crest cells and is present in the early neural tube of avian embryos. J. Neurobiol. 24: 1626 –1641. Rothman, T. P., Gershon, M. D., and Holtzer, H. (1978). The relationship of cell division to the acquisition of adrenergic characteristics by developing sympathetic ganglion cell precursors. Dev. Biol. 65: 322–341. Roux, K. H. (1995). Optimization and troubleshooting in PCR. PCR Methods Appl. 4(5): S185–S194. Schroeter, S., Apparsundaram, S., Wiley, R. G., Miner, L. A. H., Sesack, S. R., and Blakely, R. D. (2000). Immunolocalization of the cocaine- and antidepressant-sensitive l-norepinephrine transporter. J. Comp. Neurol. 420: 211–232. Sieber-Blum, M. (1989a). Inhibition of the adrenergic phenotype in cultured neural crest cells by norepinephrine uptake inhibitors. Dev. Biol. 136: 372–380. Sieber-Blum, M. (1989b). Commitment of neural crest cells to the sensory neuron lineage. Science 243: 1608 –1611. Sieber-Blum, M. (1999). The neural crest colony assay: Assessing molecular influences on development in culture. In The Neuron in Tissue Culture, IBRO, pp 5–22. Wiley. Sieber-Blum, M., and Chokshi, H. R. (1985). In vitro proliferation and terminal differentiation of quail neural crest cells in a defined culture medium. Exp. Cell Res. 158: 267–272. Sieber-Blum, M., and Cohen, A. M. (1980). Clonal analysis of quail
550 neural crest cells: They are pluripotent and differentiate in vitro in the absence of non-crest cells. Dev. Biol. 80: 96 –106. Sieber-Blum, M., and Sieber, F. (1984). Heterogeneity among early quail neural crest cells. Dev. Brain Res. 14: 241–246. Snyder, S. H. (1970). Putative neurotransmitters in the brain: Selective neuronal uptake, subcellular localization, and interactions with centrally acting drugs. Biol. Psychiatry 2: 367–389. Strudel, G., Recasens, M., and Mandel, P. (1997). Identification de catecholamines et de serotonine dans les chordes d’embryons de poulet. C.R. Acad. Sci. Paris 284: 967–969. Tessarollo, L., Tsoulfas, P., Martin-Zanca, D., Gilbert, D. J., Jenkins, N. A., Copeland, N. G., and Parada, L. F. (1993). TrkC, a receptor for neurotrophin-3 is widely expressed in the developing nervous system. Development 118: 463– 475. Tessarollo, L., and Parada, L. F. (1995). In situ hybridization. Methods Enzymol. 254: 419 – 430. Whitby, L. G., Hertting, G., and Axelrod, J. (1960). Effect of cocaine on the disposition of noradrenaline labelled with tritium. Nature 187: 604 – 605. Xue, Z.-G., Smith, J., and Le Douarin, N. M. (1985). Differentiation of catecholaminergic cells in cultures of embryonic avian sensory ganglia. Proc. Natl. Acad. Sci. USA 82: 8800 – 8804.
Ren et al.
Zaremba, S., Naegele, J. R., Barnstable, C. J., and Hockfield, S. (1990). Neuronal subsets express multiple high-molecular-weight cell-surface glycoconjugates defined by monoclonal antibodies Cat-301 and VD1.1. J. Neurosci. 10: 2985–2995. Zhang, Y., and Derynck, R. (1999). Regulation of Smad signaling by protein associations and signaling crosstalk. Trends Cell Biol. 9: 274 –279. Zhang, J.-M., and Sieber-Blum, M. (1992). Characterization of the norepinephrine uptake system and the role of norepinephrine in the expression of the adrenergic phenotype by quail neural crest cells in clonal culture. Brain Res. 570: 251–258. Zhang, J.-M., Dix, J., Langtimm-Sedlak, C. J., Trusk, T., Schroeder, B., Hoffmann, R., Strosberg, A. D., Winslow, J. W., and Sieber-Blum, M. (1997a). Neurotrophin-3 and Norepinephrine-mediated adrenergic differentiation and the inhibitory action of desipramine and cocaine. J. Neurobiol. 32: 262–280. Zhang, J. M., Hoffmann, R., and M. Sieber-Blum, M. (1997b). Mitogenic and anti-proliferative signals for neural crest cells and the neurogenic action of TGF-1. Dev. Biol. 208: 375–386. Zhang, D. Yao, L., and Bernd, P. (1994). Expression of trk and neurotrophin RNA in dorsal root and sympathetic ganglia of the quail during development. J. Neurobiol. 25: 1517–1532. Received September 11, 2000 Revised November 20, 2000 Accepted December 4, 2000