- Email: [email protected]
Avian and Murine LR8B and Human Apolipoprotein E Receptor 2: Differentially Spliced Products from Corresponding Genes
GENOMICS
42, 185–191 (1997) GE974702
ARTICLE NO.
Avian and Murine LR8B and Human Apolipoprotein E Receptor 2: Differentially Spliced Products from Corresponding Genes Christian Brandes,*,1 Sabine Novak,*,1 Walter Stockinger,*,1 Joachim Herz,† Wolfgang J. Schneider,* and Johannes Nimpf*,2 *Department of Molecular Genetics, Biocenter and University of Vienna, A-1030 Vienna, Austria; and †Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas 75235 Received December 23, 1996; accepted February 25, 1997
Apolipoprotein E-mediated lipid metabolism in the central nervous system plays an important role in cholesterol and phospholipid homeostasis of this organ, which is separated from the circulation by the blood– brain barrier. Moreover, in late-onset familial Alzheimer disease the frequency of the apolipoprotein E4 allele is significantly increased and the apoprotein is localized to extracellular plaques, one of the histological hallmarks of this disease. Recently, two distinct novel members of the low-density lipoprotein (LDL) receptor family, with the potential to bind apolipoprotein E and preferentially expressed in brain, have been characterized from human (D. Kim et al., 1996, J. Biol. Chem. 271: 8373–8380) and chicken and mouse (S. Novak, et al., 1996, J. Biol. Chem. 271: 11732–11736). The human receptor, termed ‘‘apolipoprotein E receptor 2,’’ is a seven ligand-binding repeat receptor harboring a unique insertion in the cytoplasmic domain of the protein. The novel receptor characterized in chicken and mouse was found to have eight binding repeats without such a cytoplasmic insertion. Despite the overall identity of more than 73%, based upon their structural differences (seven versus eight ligand-binding repeats) these receptors have been considered independent entities. However, here we demonstrate that both receptors in fact are encoded by corresponding genes and that differential splicing gives rise to structurally and possibly functionally distinct variants of this brain-specific member of the LDL receptor family. q 1997 Academic Press INTRODUCTION
Apolipoprotein E (apo-E)3 is a plasma protein that is an integral part of distinct lipoprotein classes and is The approved mouse genome database symbol for the gene LR8B is Lr8b. 1 These authors contributed equally to this publication. 2 To whom correspondence should be addressed at the Department of Molecular Genetics, Biocenter and University of Vienna, Dr. Bohrgasse 9/II, A-1030 Vienna, Austria. Telephone: //43-1-79515-2111. Fax: //43-1-79515-2900. E-mail: [email protected]. 3 Abbreviations used: apo, apolipoprotein; (V)LDL, (very) low-density lipoprotein; IDL, intermediate-density lipoprotein; HDL, high-
involved in systemic lipid metabolism in at least three major pathways (for review see Mahley, 1988). First, apo-E plays a key role in the delivery of dietary lipids to the liver, being the ligand for receptor-mediated uptake of chylomicron remnants by the liver. Second, due to their apo-E content, a significant fraction of VLDL remnants and IDL are cleared by the liver, constituting a metabolic cycle for the delivery of free fatty acids to peripheral tissues. Third, apo-E is an integral part of the ‘‘reverse cholesterol’’ transport system, mediating the uptake by the liver of cholesterol-rich HDL. Since the discovery that in humans not only the liver but also the brain produces significant amounts of apo-E mRNA (Elshourbagy et al., 1985), it became widely appreciated that apo-E may also serve as mediator of local lipid transport in the central nervous system (for review see Weisgraber et al., 1994). The finding that the frequency of the type 4 allele for apo-E is significantly increased in late-onset familial Alzheimer disease (Strittmatter et al., 1993) has focused apo-E research activities largely to its metabolism in the brain. To no surprise, molecular characterization of two novel receptors belonging to the LDL receptor superfamily expressed in the brain with the potential to bind apo-E has recently been reported. The first of these proteins, termed apolipoprotein E receptor 2 (apoER2), was cloned from a human placenta library and was found to be expressed in placenta, in testis, and, to a high degree, in a variety of distinct regions of the brain (Kim et al., 1996). The modular structure of this receptor is highly related to that of the LDL receptor (Schneider, 1989; Yamamoto et al., 1984). Ligand-binding experiments using CHO cells expressing apoER2 show that this receptor binds b-VLDL, but not VLDL or LDL, suggesting that apoE might be a ligand for apoER2 (Kim et al., 1996). The second novel receptor, termed LR8B, was discovered in our laboratory (Novak et al., 1996); it is specifically expressed in brains from chicken and mouse and, hardensity lipoprotein; PCR, polymerase chain reaction; RT, reverse transcriptase.
185
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
gnmas
186
BRANDES ET AL.
boring eight ‘‘type-A repeats,’’ its modular structure is reminiscent of that of VLDL receptors (Bujo et al., 1994; Takahashi et al., 1992). In a ligand blot assay, LR8B, like other members of the LDL receptor family with at least eight ligand-binding repeats, binds receptorassociated protein. The current view holds that the number of binding repeats (LDL receptor versus VLDL receptor) and the particular arrangement of such clusters of binding repeats in the multidomain relatives of the LDL receptor (LDL receptor-related protein) (Herz et al., 1988), megalin (Saito et al., 1994), and LR11 (Yamazaki et al., 1996) specify the ligand-binding characteristics of these homologous receptors. Here we report that human apoER2 and LR8B in chicken and mouse are not two distinct new members of the LDL receptor family, as would be expected from their obvious structural differences (seven versus eight ligand-binding repeats), but rather are variants derived from the same gene. Furthermore, these results demonstrate, for the first time for members of the LDL receptor gene family, that receptors with potentially different ligand-binding specificities can be produced by differential splicing from one gene. MATERIALS AND METHODS cDNA preparation and PCR analysis. Poly(A)/ RNA was prepared from 200 mg frozen tissue (total brain from mature female White Leghorn chicken; total brain from mature female balb/C mice, and fresh human placenta) using the Micro-Fast Track mRNA isolation kit (Invitrogen) according to the manufacturer’s protocol. Firststrand cDNA synthesis was performed with 1 mg of poly(A)/ RNA and random hexamer primers using SuperScript reverse transcriptase (Life Technologies, Inc.). One-twentieth of the cDNA was used for subsequent PCR in the presence of 1.5 mM MgCl2 , 0.2 mM dNTPs, 2 units of Taq DNA polymerase (Perkin–Elmer), and 0.5 mM appropriate primers on a Gene Amp 2400 (Perkin–Elmer). PCR conditions were 2 min initial denaturing at 947C, 1 min denaturing at 947C, 1 min annealing (for specific annealing temperatures, see primers), and 1 min extension at 727C for 40 cycles. For the PCR experiments using a human brain cDNA lgt10 library (Clontech) as template, a 1-ml aliquot (105 PFU) of the library was used, and the initial denaturation was extended to 3 min. The following primers have been used: chicken cytoplasmic domain: A, 5*-AAGCCACGACTGCCATCCCG, B, 5*-TATGGCAACCCATCGTCTTC, annealing at 537C; mouse cytoplasmic domain: A, 5*-CAGTGGCTGTCCCTCACTCGG, B, CAGGGCAGTCCATCATCTTC, annealing at 537C; human cytoplasmic domain: A, 5*-AACCAGCAACCACTCCCAGC, B, 5*CATCATCTTCAAGGCTTAATGC, annealing at 607C; chicken ligand-binding domain: A, 5*-ACCGGATGAATTCCAGTGC, B, TAGGGACTCTTTCCTACAGC, annealing at 587C; mouse ligand-binding domain: A, 5*-CGAGAATGAGTTCCAGTGTGG, B, 5*-CGTGAAGATCAGAGATGGGC, annealing at 607C; human ligand-binding domain: A, 5*-GATGGGACATGTGTCCTTGC, B, 5*-CAGTTCTTGGTCAGTAGGTCC, annealing at 607C. PCR products were analyzed by agarose gel electrophoresis. Bands were isolated from the gel using the QIAEX II gel extraction kit (QIAGEN) and subcloned into the pCRII vector (Invitrogen). Several clones from each fragment were isolated; positive clones were identified by restriction analysis and sequenced. Cosmid library screening. A chicken cosmid library (PWE15, Clontech) was screened with a XbaI/HindIII fragment covering 1.2 kb of the 5* part of LR8B cDNA. The probe was labeled by random priming with the Oligolabeling kit (Pharmacia). Hybridization was
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
done at 427C according to Sambrook et al. (1989) using the following hybridization mixture: 50% formamide, 51 SSPE, 51 Denhardt, 0.1% SDS, 100 mg/ml denatured salmon sperm DNA. A number of clones equivalent to two genomes of the library were screened, and one positive cosmid was found. PCR and subcloning. Genomic DNA was amplified from the positive cosmid with primers located in the O-linked sugar domain and at the carboxyl terminus of LR8B (Novak et al., 1996) (sense primer, 5*-AAGCCACGACTGCCATCCCG; antisense primer, 5*-TATGGCAACCCATCGTCTTC). PCR was performed with 100 ng cosmid DNA, 50 pmol primers, 0.2 mM dNTPs, 2 mM MgCl2 , and 2 units of Taq DNA polymerase (Perkin–Elmer) on a Gene Amp 2400 (30 cycles: 30 s at 927C, 30 s at 517C, 5 min at 727C). The product was cloned into pCRII and sequenced.
RESULTS AND DISCUSSION
In our recent paper describing chicken LR8B we also presented a partial cDNA clone for mouse LR8B, which started approximately 40 nucleotides before the end of the last type-A repeat (Novak et al., 1996). In an attempt to clone the full-length cDNA for the murine homologue for LR8B, we obtained clones in which the eighth ligand-binding repeat was missing (not shown). Furthermore, sequence alignment of elements common to both human apoER2 (Kim et al., 1996) and chicken LR8B (Novak et al., 1996) show a surprising degree of homology (Fig. 1). The overall identity of 73% of both proteins is the same as that for LDL receptors in the evolutionarily less distant species, human versus rabbit (75%), and in the range of that for the VLDL receptors from human and chicken (84%) (Bujo et al., 1994). The fact that we have obtained murine clones for a sevenas well as for an eight-repeat version, together with the results obtained from the alignment, prompted experiments to investigate whether apoER2 and LR8B might be differentially spliced products of corresponding genes in human, mouse, and chicken. Number of Ligand-Binding Repeats To test this hypothesis, we first designed speciesspecific primers flanking a putative eighth ligand-binding repeat in LR8B and apoER2 and performed RTPCR experiments on mRNA derived from chicken and mouse brain, human placenta, and a human brain cDNA library. As shown in Fig. 2, when chicken brain mRNA was used as template this primer combination reproducibly produced two distinct bands. The length of the PCR products were 366 and 489 bp. Upon subcloning and sequencing (Fig. 2), the longer product turned out to be identical with the corresponding region of the published cDNA for chicken LR8B specifying an eight ligand-binding repeat receptor (Novak et al., 1996). From the shorter product, 123 bp exactly coding for repeat eight were missing; the rest of the sequence was identical with the long product. Using mouse brain mRNA and mouse-specific primers we obtained three distinct bands (Fig. 2): the 382-bp fragment and the 505-bp fragment corresponded to the two
gnmas
RECEPTOR VARIANTS DERIVED FROM CORRESPONDING GENES
187
FIG. 1. Comparison of the sequences of human apoER2 and chicken LR8B. The amino acid sequence of human apoER2 (Kim et al., 1996) and chicken LR8B (Novak et al., 1996) are aligned. Gaps have been introduced in regions where structural elements are missing in one or the other protein to optimize the alignment. Identical residues are boxed. Empty numbered boxes and shaded boxes of the underlining cartoon represent ligand-binding repeats 1 to 8 and cysteine-rich repeats A to C, respectively.
fragments amplified from chicken mRNA and represented seven-repeat and eight-repeat versions, respectively, of the murine receptor. The additional band with a size of 421 bp corresponds to the seven-repeat version, but contains an additional 39-bp insertion (boxed sequence in Fig.2) at exactly the position where the eighth repeat resides in the 505-bp product. These 39 bp show no homology to the eighth repeat. The RT-PCR for the human situation was even more complex and resulted in a mixture of four products with the respective lengths of 189, 320, 359, and 393 bp. The shortest product (189 bp), barely visible on the gel, turned out to be a version of human apoER2 (seven ligand-binding repeats) lacking the first cysteine-rich repeat (repeat A) of the EGF precursor homology domain. The most prominent band, however, with a length of 320 bp, is identical with the published sequence for apoER2 (Kim et al., 1996) coding for a sevenrepeat receptor with repeats A and B present. The 359bp band corresponds to the 421-bp band in mice that specifies a seven-repeat version with additional 13 amino acids (boxed sequence in Fig.2) present between repeat 7 and cysteine-rich repeat A. The high degree
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
of conservation of this insert from mouse to human is astonishing and might indicate a functional significance for this stretch of 13 amino acids. Indeed, the amino terminal part of the insertion is highly basic and contains the consensus signal (bold bars in Fig. 2) for precursor cleavage catalyzed by furin within the constitutive secretory pathway. The minimal requirement for furin cleavage in mammals was shown to be either R-X-K/R-R (Hosaka et al., 1991) or R-X-X-R (Molloy et al., 1992). This situation is reminiscent of that in LRP, another member of the LDL receptor family, which was demonstrated to be processed by furin at an extracellular site (Herz et al., 1990; Willnow et al., 1995). Further experiments will show whether the resulting parts of the receptor after cleavage remain noncovalently linked, as in LRP, or if a soluble domain containing all ligand-binding repeats is secreted. Such a fragment could act as a dominant negative receptor by blocking the ligand-binding site of certain ligands, thereby prolonging the half-life and activity in the circulation or extracellular space. Finally, the largest band seen on the gel (393 bp) is derived from a version with an insertion of 73 bp ex-
gnmas
188
BRANDES ET AL.
FIG. 2. Analysis of splice variants in the ligand-binding domain of chicken and mouse LR8B and human apoER2. mRNA from chicken and mouse brain was used for cDNA synthesis with reverse transcriptase. The resulting cDNAs and DNA from a human lgt10 brain cDNA library were used for PCR amplification with the indicated primer combinations (arrows). Amplified products were separated on 2% agarose gels. The sequences of the amplified products from chicken, mouse, and human are aligned below a cartoon highlighting the relevant structural features of the receptor. Empty numbered boxes and shaded boxes represent ligand-binding repeats and EGF-precursor repeats A and B, respectively. Boxed sequences contain the potential furin cleavage sites, which are marked by bars above the respective amino acids. The numbers refer to the length of the amplified products.
actly at the junction between the cysteine-rich repeats A and B. The insertion (not shown) introduces a frame shift leading to a premature stop codon, specifying a soluble protein that, if secreted, could also act as a dominant negative receptor as discussed above. Taken together, the RT-PCR analyses of the region surrounding the last ligand-binding repeat in both receptors demonstrate that chicken and mouse LR8B occur either as seven- or eight-ligand-binding repeat variants. Interestingly, we were not able to detect the human homologue for the eight-repeat variant present in chicken and mouse. This is apparently not due to selective splicing of the corresponding exon, but caused by the absence of this exon in the human gene (T. Yamamoto, Sendai, Japan, pers. comm., Oct. 1996.). Intracellular Domain Next, we examined the reported structural difference between the cytoplasmic domains of LR8B and
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
apoER2. As indicated in Fig. 3, primers were positioned in the O-linked sugar domain and at the carboxy termini of the three respective proteins to give products specifying the transmembrane and entire cytoplasmic domains of the receptors. As shown in Fig.3, the RTPCR using chicken brain mRNA consistently produced a single band (371 bp), whereas the same reaction with murine brain mRNA or human brain cDNA (lgt10) yielded two distinct bands with a length of 373 and 550 bp for mouse and 293 and 470 bp for human, respectively. Sequence analysis clearly demonstrated that the short band present in chicken, mouse, and human is derived from messages lacking 177 bp coding for the 59amino-acid insertion reported to be present in human apoER2 mRNA (Kim et al., 1996). The larger product, present only in human and mouse, is exactly 177 bp longer, and the sequence codes for the 59 amino acid insert. The sequence of the murine insert (Fig. 3) differs from that of the human (Kim et al., 1996) in only five
gnmas
RECEPTOR VARIANTS DERIVED FROM CORRESPONDING GENES
189
FIG. 3. Analysis of splice variants in the cytoplasmic domains of chicken and mouse LR8B and human apoER2. mRNA from chicken and mouse brain was used for cDNA synthesis with reverse transcriptase. The resulting cDNAs and DNA from a human lgt10 brain cDNA library were used for PCR amplification with the indicated primer combinations (arrows). Amplified products were separated on 2% agarose gels. The sequences of the amplified products from chicken, mouse, and human are aligned below a cartoon highlighting the relevant structural features of the receptor. The numbers refer to the length of the amplified products.
positions, all of them due to conservative substitutions. Homology searches revealed that the 59-aa insert represents a unique sequence not found in any published protein so far. However, the high degree of conservation between human and mouse possibly points to an important function, at least in mammals. In this respect, it was interesting to see if the absence of a corresponding variant in chicken is caused by the absence of variable splicing or by the fact that the corresponding exon (in analogy to the missing exon for repeat 8 in man) is missing in the chicken gene. Thus, the corresponding region of the chicken gene was amplified from a cosmid clone carrying the relevant portion of
the gene (Fig. 4). The chicken gene carries a 959-bp intron interrupting the coding sequence of the receptor exactly at the position where the 59-aa insertion resides in the receptors of mouse and human. This analysis shows that in chicken LR8B the unique cytosolic insert is indeed missing from the gene; the additional exon most likely was acquired by the mammalian gene during evolution. The current results strongly support our notion that LR8B from chicken and mouse and human apoER2 are indeed differentially spliced products of corresponding genes. The fact that these novel receptors, predominantly expressed in brain and belonging to the LDL
FIG. 4. Partial sequence of the 3* end of the chicken LR8B gene. The partial sequence of a chicken cosmid clone carrying the gene for LR8B is shown in relation to the corresponding parts of the receptor cDNAs as indicated. The position of the 59-aa cytoplasmic insert in the receptor cDNAs of mouse and human is indicated. Exon sequences are in capital letters and the specified amino acids are shown above the nucleotide sequence. Numbers above the exon sequences indicate their length. Introns are marked by black bars, and the intronic nucleotide sequences are in lowercase. Numbers above the intronic sequences refer to their lengths.
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
gnmas
190
BRANDES ET AL.
receptor gene family, apparently exist as seven- as well as eight-ligand-binding repeat versions may have farreaching implications. Structural comparison of both versions with known members of the LDL receptor family reveals that the seven-repeat variant resembles the LDL receptor, whereas the eight-repeat molecule is more closely related to VLDL receptors. The current view is that these structural differences provide the LDL receptor and the VLDL receptor with different ligand-binding specificities (Schneider and Nimpf, 1993). The LDL receptor is the receptor with the most restricted ligand-binding specificity, binding only apoE and apo-B with high affinity. The VLDL receptor with eight ligand-binding repeats mediates binding and uptake of a series of ligands such as apo-E-containing lipoproteins (Takahashi et al., 1992), lipoprotein lipase (Argraves et al., 1995; Takahashi et al., 1995), urokinase– plasminogen activator/inhibitor type 1 complexes (Argraves et al., 1995; Heegaard et al., 1995), and, as shown for the chicken homologue of the VLDL receptor, apolipoprotein B and vitellogenin (Bujo et al., 1994), a2-macroglobulin (Jacobsen et al., 1995), and lactoferrin (Hiesberger et al., 1995). Thus, these results demonstrate for the first time that a gene of the LDL receptor family primarily expressed in brain can give rise to structural variants with potentially distinct physiological functions. Considering the fact that (i) chickens do not produce apolipoprotein E (Hermier et al., 1985) and (ii) different versions of this receptor may have distinct and/or novel ligand-binding specificities other than for apo-E, we propose, according to our previous suggestion (Novak et al., 1996), the designation LR7/8B for the gene characterized here. In its product, LR7/8B, LR stands for LDLR-relative, the digits specify the number of type-A binding repeats, and the B indicates the brain-specific expression of the gene. ACKNOWLEDGMENTS We appreciate the expert technical assistance by Harald Rumpler. This work was supported by grants from the Austrian Science Foundation S-07105 (to J.N.) and S-07108 (to W.J.S.). We thank Dr. Franz Wohlrab and Dr. Reinhold Hofbauer for critically reading the manuscript.
REFERENCES Argraves, K. M., Battey, F. D., MacCalman, C. D., McCrae, K. R., Ga˚fvels, M., Kozarsky, K. F., Chappell, D. A., Strauss, III., J. F., and Strickland, D. K. (1995). The very low density lipoprotein receptor mediates the cellular catabolism of lipoprotein lipase and urokinase–plasminogen activator type I complexes. J. Biol. Chem. 270: 26550–26557. Bujo, H., Hermann, M., Kaderli, M. O., Jacobsen, L., Sugawara, S., Nimpf, J., Yamamoto, T., and Schneider, W. J. (1994). Chicken oocyte growth is mediated by an eight ligand binding repeat member of the LDL receptor family. EMBO J. 13: 5165–5175. Elshourbagy, N. A., Liao, W. S., Mahley, R. W., and Taylor, J. M. (1985). Apolipoprotein E mRNA is abundant in brain and adrenals,
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
as well as in liver, and is present in other peripheral tissues of rats and marmosets. Proc. Natl. Acad. Sci. USA 82: 203–207. Heegaard, C. W., Simonson, A. C. W., Oka, K., Kjøller, L., Christensen, A., Madsen, B., Ellgaard, L., Chan, L., and Andreasen, P. A. (1995). Very low density lipoprotein receptor binds and mediates endocytosis of urokinase-type plasminogen activator-type-1 plasminogen activator inhibitor complex. J. Biol. Chem. 270: 20855–20861. Hermier, D., Forgez, P., and Chapman, P. (1985). A density gradient study of the lipoprotein and apolipoprotein distribution in the chicken, Gallus domesticus. Biochim. Biophys. Acta 836: 105–118. Herz, J., Hamann, U., Rogne, S., Myklebost, O., Gausepohl, H., and Stanley, K. K. (1988). Surface location and high affinity for calcium of a 500-kd liver membrane protein closely related to the LDLreceptor suggest a physiological role as lipoprotein receptor. EMBO J. 7: 4119–4127. Herz, J., Kowal, R. C., Goldstein, J. L., and Brown, M. S. (1990). Proteolytic processing of the 600 kd low density lipoprotein receptor-related protein (LRP) occurs in a trans-Golgi compartment. EMBO J. 9: 1769–1776. Hiesberger, T., Hermann, M., Jacobsen, L., Novak, S., Hodits, R. A., Bujo, H., Meilinger, M., Hu¨ttinger, M., Schneider, W. J., and Nimpf, J. (1995). The chicken oocyte receptor for yolk precursors as model to study the action of receptor associated protein and lactoferrin. J. Biol. Chem. 270: 18219–18226. Hosaka, M., Nagahama, M., Kim, W. S., Watanabe, T., Hatsuzawa, K., Ikemizu, J., Murakami, K., and Nakayama, K. (1991). Arg-XLys/Arg-Arg motif as a signal for precursor cleavage catalyzed by furin within the constitutive secretory pathway. J. Biol. Chem. 266: 12127–12130. Jacobsen, L., Hermann, M., Vieira, P. M., Schneider, W. J., and Nimpf, J. (1995). The chicken oocyte receptor for lipoprotein deposition recognizes a2-macroglobulin. J. Biol. Chem. 270: 6468– 6475. Kim, D., Iijima, H., Goto, K., Sakai, J., Ishii, H., Kim, H.-J., Suzuki, H., Kondo, H., Saeki, S., and Yamamoto, T. (1996). Human apolipoprotein E receptor 2: A novel lipoprotein receptor of the low density lipoprotein receptor family predominantly expressed in brain. J. Biol. Chem. 271: 8373–8380. Mahley, R. W. (1988). Apolipoprotein E: Cholesterol transport protein with expanding role in cell biology. Science 240: 622–630. Molloy, S. S., Bresnahan, P. A., Leppla, S. H., Klimpel, K. R., and Thomas, G. (1992). Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-X-X-Arg and efficiently cleaves anthrax toxin protective antigen. J. Biol. Chem. 267: 16396–16402. Novak, S., Hiesberger, T., Schneider, W. J., and Nimpf, J. (1996). A new low density lipoprotein receptor homologue with 8 ligand binding repeats in brain of chicken and mouse. J. Biol. Chem. 271: 11732–11736. Saito, A., Pietromonaco, S., Loo, A. K., and Farquhar, M. G. (1994). Complete cloning and sequencing of rat gp330/‘‘megalin’’, a distinct member of the low density lipoprotein receptor gene family. Proc. Natl. Acad. Sci. USA 91: 9725–9729. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). ‘‘Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schneider, W. J. (1989). The low density lipoprotein receptor. Biochim. Biophys. Acta 988: 303–317. Schneider, W. J., and Nimpf, J. (1993). Lipoprotein receptors: Old relatives and new arrivals. Curr. Opin. Lipidol. 4: 205–209. Strittmatter, W. J., Saunders, A. M., Schmechel, D., Pericak, V. M., Salvesen, J., and Roses, A. D. (1993). Apolipoprotein E: High-avidity binding to b-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc. Natl. Acad. Sci. USA 90: 1977–1981.
gnmas
RECEPTOR VARIANTS DERIVED FROM CORRESPONDING GENES Takahashi, S., Kawarabayasi, Y., Nakai, T., Sakai, J., and Yamamoto, T. (1992). Rabbit very low density lipoprotein receptor: A low density lipoprotein receptor-like protein with distinct ligand specificity. Proc. Natl. Acad. Sci. USA 89: 9252–9256. Takahashi, S., Suzuki, J., Kohno, M., Oida, K., Tamai, T., Miyabo, S., Yamamoto, T., and Nakai, T. (1995). Enhancement of the binding of triglyceride-rich lipoproteins to the very low density lipoprotein receptor by apolipoprotein E and lipoprotein lipase. J. Biol. Chem. 270: 15747–15754. Weisgraber, K. H., Roses, A. D., and Strittmatter, W. J. (1994). The role of apolipoprotein E in the nervous system. Curr. Opin. Lipidol. 5: 110–116.
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
191
Willnow, T. E., Moehring, J. M., Inocencio, N. M., Moehring, T. J., and Herz, J. (1995). The low-density-lipoprotein receptor-related protein (LRP) is processed by furin in vivo and in vitro. Biochem. J. 312: 71–76. Yamamoto, T., Davis, C. G., Brown, M. S., Schneider, W. J., Casey, M. L., Goldstein, J. L., and Russell, D. W. (1984). The human LDL receptor: A cysteine-rich protein with multiple Alu sequences in its mRNA. Cell 39: 27–38. Yamazaki, H., Bujo, H., Kusunoki, J., Seimiya, K., Kanaki, T., Morisaki, N., Schneider, W. J., and Saito, Y. (1996). Elements of neural adhesion molecules and yeast vacuolar protein sorting receptor are present in a novel LDL receptor family member from man and rabbit. J. Biol. Chem. 271: 24761–24768.
gnmas
42, 185–191 (1997) GE974702
ARTICLE NO.
Avian and Murine LR8B and Human Apolipoprotein E Receptor 2: Differentially Spliced Products from Corresponding Genes Christian Brandes,*,1 Sabine Novak,*,1 Walter Stockinger,*,1 Joachim Herz,† Wolfgang J. Schneider,* and Johannes Nimpf*,2 *Department of Molecular Genetics, Biocenter and University of Vienna, A-1030 Vienna, Austria; and †Department of Molecular Genetics, University of Texas Southwestern Medical Center, Dallas, Texas 75235 Received December 23, 1996; accepted February 25, 1997
Apolipoprotein E-mediated lipid metabolism in the central nervous system plays an important role in cholesterol and phospholipid homeostasis of this organ, which is separated from the circulation by the blood– brain barrier. Moreover, in late-onset familial Alzheimer disease the frequency of the apolipoprotein E4 allele is significantly increased and the apoprotein is localized to extracellular plaques, one of the histological hallmarks of this disease. Recently, two distinct novel members of the low-density lipoprotein (LDL) receptor family, with the potential to bind apolipoprotein E and preferentially expressed in brain, have been characterized from human (D. Kim et al., 1996, J. Biol. Chem. 271: 8373–8380) and chicken and mouse (S. Novak, et al., 1996, J. Biol. Chem. 271: 11732–11736). The human receptor, termed ‘‘apolipoprotein E receptor 2,’’ is a seven ligand-binding repeat receptor harboring a unique insertion in the cytoplasmic domain of the protein. The novel receptor characterized in chicken and mouse was found to have eight binding repeats without such a cytoplasmic insertion. Despite the overall identity of more than 73%, based upon their structural differences (seven versus eight ligand-binding repeats) these receptors have been considered independent entities. However, here we demonstrate that both receptors in fact are encoded by corresponding genes and that differential splicing gives rise to structurally and possibly functionally distinct variants of this brain-specific member of the LDL receptor family. q 1997 Academic Press INTRODUCTION
Apolipoprotein E (apo-E)3 is a plasma protein that is an integral part of distinct lipoprotein classes and is The approved mouse genome database symbol for the gene LR8B is Lr8b. 1 These authors contributed equally to this publication. 2 To whom correspondence should be addressed at the Department of Molecular Genetics, Biocenter and University of Vienna, Dr. Bohrgasse 9/II, A-1030 Vienna, Austria. Telephone: //43-1-79515-2111. Fax: //43-1-79515-2900. E-mail: [email protected]. 3 Abbreviations used: apo, apolipoprotein; (V)LDL, (very) low-density lipoprotein; IDL, intermediate-density lipoprotein; HDL, high-
involved in systemic lipid metabolism in at least three major pathways (for review see Mahley, 1988). First, apo-E plays a key role in the delivery of dietary lipids to the liver, being the ligand for receptor-mediated uptake of chylomicron remnants by the liver. Second, due to their apo-E content, a significant fraction of VLDL remnants and IDL are cleared by the liver, constituting a metabolic cycle for the delivery of free fatty acids to peripheral tissues. Third, apo-E is an integral part of the ‘‘reverse cholesterol’’ transport system, mediating the uptake by the liver of cholesterol-rich HDL. Since the discovery that in humans not only the liver but also the brain produces significant amounts of apo-E mRNA (Elshourbagy et al., 1985), it became widely appreciated that apo-E may also serve as mediator of local lipid transport in the central nervous system (for review see Weisgraber et al., 1994). The finding that the frequency of the type 4 allele for apo-E is significantly increased in late-onset familial Alzheimer disease (Strittmatter et al., 1993) has focused apo-E research activities largely to its metabolism in the brain. To no surprise, molecular characterization of two novel receptors belonging to the LDL receptor superfamily expressed in the brain with the potential to bind apo-E has recently been reported. The first of these proteins, termed apolipoprotein E receptor 2 (apoER2), was cloned from a human placenta library and was found to be expressed in placenta, in testis, and, to a high degree, in a variety of distinct regions of the brain (Kim et al., 1996). The modular structure of this receptor is highly related to that of the LDL receptor (Schneider, 1989; Yamamoto et al., 1984). Ligand-binding experiments using CHO cells expressing apoER2 show that this receptor binds b-VLDL, but not VLDL or LDL, suggesting that apoE might be a ligand for apoER2 (Kim et al., 1996). The second novel receptor, termed LR8B, was discovered in our laboratory (Novak et al., 1996); it is specifically expressed in brains from chicken and mouse and, hardensity lipoprotein; PCR, polymerase chain reaction; RT, reverse transcriptase.
185
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
0888-7543/97 $25.00 Copyright q 1997 by Academic Press All rights of reproduction in any form reserved.
gnmas
186
BRANDES ET AL.
boring eight ‘‘type-A repeats,’’ its modular structure is reminiscent of that of VLDL receptors (Bujo et al., 1994; Takahashi et al., 1992). In a ligand blot assay, LR8B, like other members of the LDL receptor family with at least eight ligand-binding repeats, binds receptorassociated protein. The current view holds that the number of binding repeats (LDL receptor versus VLDL receptor) and the particular arrangement of such clusters of binding repeats in the multidomain relatives of the LDL receptor (LDL receptor-related protein) (Herz et al., 1988), megalin (Saito et al., 1994), and LR11 (Yamazaki et al., 1996) specify the ligand-binding characteristics of these homologous receptors. Here we report that human apoER2 and LR8B in chicken and mouse are not two distinct new members of the LDL receptor family, as would be expected from their obvious structural differences (seven versus eight ligand-binding repeats), but rather are variants derived from the same gene. Furthermore, these results demonstrate, for the first time for members of the LDL receptor gene family, that receptors with potentially different ligand-binding specificities can be produced by differential splicing from one gene. MATERIALS AND METHODS cDNA preparation and PCR analysis. Poly(A)/ RNA was prepared from 200 mg frozen tissue (total brain from mature female White Leghorn chicken; total brain from mature female balb/C mice, and fresh human placenta) using the Micro-Fast Track mRNA isolation kit (Invitrogen) according to the manufacturer’s protocol. Firststrand cDNA synthesis was performed with 1 mg of poly(A)/ RNA and random hexamer primers using SuperScript reverse transcriptase (Life Technologies, Inc.). One-twentieth of the cDNA was used for subsequent PCR in the presence of 1.5 mM MgCl2 , 0.2 mM dNTPs, 2 units of Taq DNA polymerase (Perkin–Elmer), and 0.5 mM appropriate primers on a Gene Amp 2400 (Perkin–Elmer). PCR conditions were 2 min initial denaturing at 947C, 1 min denaturing at 947C, 1 min annealing (for specific annealing temperatures, see primers), and 1 min extension at 727C for 40 cycles. For the PCR experiments using a human brain cDNA lgt10 library (Clontech) as template, a 1-ml aliquot (105 PFU) of the library was used, and the initial denaturation was extended to 3 min. The following primers have been used: chicken cytoplasmic domain: A, 5*-AAGCCACGACTGCCATCCCG, B, 5*-TATGGCAACCCATCGTCTTC, annealing at 537C; mouse cytoplasmic domain: A, 5*-CAGTGGCTGTCCCTCACTCGG, B, CAGGGCAGTCCATCATCTTC, annealing at 537C; human cytoplasmic domain: A, 5*-AACCAGCAACCACTCCCAGC, B, 5*CATCATCTTCAAGGCTTAATGC, annealing at 607C; chicken ligand-binding domain: A, 5*-ACCGGATGAATTCCAGTGC, B, TAGGGACTCTTTCCTACAGC, annealing at 587C; mouse ligand-binding domain: A, 5*-CGAGAATGAGTTCCAGTGTGG, B, 5*-CGTGAAGATCAGAGATGGGC, annealing at 607C; human ligand-binding domain: A, 5*-GATGGGACATGTGTCCTTGC, B, 5*-CAGTTCTTGGTCAGTAGGTCC, annealing at 607C. PCR products were analyzed by agarose gel electrophoresis. Bands were isolated from the gel using the QIAEX II gel extraction kit (QIAGEN) and subcloned into the pCRII vector (Invitrogen). Several clones from each fragment were isolated; positive clones were identified by restriction analysis and sequenced. Cosmid library screening. A chicken cosmid library (PWE15, Clontech) was screened with a XbaI/HindIII fragment covering 1.2 kb of the 5* part of LR8B cDNA. The probe was labeled by random priming with the Oligolabeling kit (Pharmacia). Hybridization was
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
done at 427C according to Sambrook et al. (1989) using the following hybridization mixture: 50% formamide, 51 SSPE, 51 Denhardt, 0.1% SDS, 100 mg/ml denatured salmon sperm DNA. A number of clones equivalent to two genomes of the library were screened, and one positive cosmid was found. PCR and subcloning. Genomic DNA was amplified from the positive cosmid with primers located in the O-linked sugar domain and at the carboxyl terminus of LR8B (Novak et al., 1996) (sense primer, 5*-AAGCCACGACTGCCATCCCG; antisense primer, 5*-TATGGCAACCCATCGTCTTC). PCR was performed with 100 ng cosmid DNA, 50 pmol primers, 0.2 mM dNTPs, 2 mM MgCl2 , and 2 units of Taq DNA polymerase (Perkin–Elmer) on a Gene Amp 2400 (30 cycles: 30 s at 927C, 30 s at 517C, 5 min at 727C). The product was cloned into pCRII and sequenced.
RESULTS AND DISCUSSION
In our recent paper describing chicken LR8B we also presented a partial cDNA clone for mouse LR8B, which started approximately 40 nucleotides before the end of the last type-A repeat (Novak et al., 1996). In an attempt to clone the full-length cDNA for the murine homologue for LR8B, we obtained clones in which the eighth ligand-binding repeat was missing (not shown). Furthermore, sequence alignment of elements common to both human apoER2 (Kim et al., 1996) and chicken LR8B (Novak et al., 1996) show a surprising degree of homology (Fig. 1). The overall identity of 73% of both proteins is the same as that for LDL receptors in the evolutionarily less distant species, human versus rabbit (75%), and in the range of that for the VLDL receptors from human and chicken (84%) (Bujo et al., 1994). The fact that we have obtained murine clones for a sevenas well as for an eight-repeat version, together with the results obtained from the alignment, prompted experiments to investigate whether apoER2 and LR8B might be differentially spliced products of corresponding genes in human, mouse, and chicken. Number of Ligand-Binding Repeats To test this hypothesis, we first designed speciesspecific primers flanking a putative eighth ligand-binding repeat in LR8B and apoER2 and performed RTPCR experiments on mRNA derived from chicken and mouse brain, human placenta, and a human brain cDNA library. As shown in Fig. 2, when chicken brain mRNA was used as template this primer combination reproducibly produced two distinct bands. The length of the PCR products were 366 and 489 bp. Upon subcloning and sequencing (Fig. 2), the longer product turned out to be identical with the corresponding region of the published cDNA for chicken LR8B specifying an eight ligand-binding repeat receptor (Novak et al., 1996). From the shorter product, 123 bp exactly coding for repeat eight were missing; the rest of the sequence was identical with the long product. Using mouse brain mRNA and mouse-specific primers we obtained three distinct bands (Fig. 2): the 382-bp fragment and the 505-bp fragment corresponded to the two
gnmas
RECEPTOR VARIANTS DERIVED FROM CORRESPONDING GENES
187
FIG. 1. Comparison of the sequences of human apoER2 and chicken LR8B. The amino acid sequence of human apoER2 (Kim et al., 1996) and chicken LR8B (Novak et al., 1996) are aligned. Gaps have been introduced in regions where structural elements are missing in one or the other protein to optimize the alignment. Identical residues are boxed. Empty numbered boxes and shaded boxes of the underlining cartoon represent ligand-binding repeats 1 to 8 and cysteine-rich repeats A to C, respectively.
fragments amplified from chicken mRNA and represented seven-repeat and eight-repeat versions, respectively, of the murine receptor. The additional band with a size of 421 bp corresponds to the seven-repeat version, but contains an additional 39-bp insertion (boxed sequence in Fig.2) at exactly the position where the eighth repeat resides in the 505-bp product. These 39 bp show no homology to the eighth repeat. The RT-PCR for the human situation was even more complex and resulted in a mixture of four products with the respective lengths of 189, 320, 359, and 393 bp. The shortest product (189 bp), barely visible on the gel, turned out to be a version of human apoER2 (seven ligand-binding repeats) lacking the first cysteine-rich repeat (repeat A) of the EGF precursor homology domain. The most prominent band, however, with a length of 320 bp, is identical with the published sequence for apoER2 (Kim et al., 1996) coding for a sevenrepeat receptor with repeats A and B present. The 359bp band corresponds to the 421-bp band in mice that specifies a seven-repeat version with additional 13 amino acids (boxed sequence in Fig.2) present between repeat 7 and cysteine-rich repeat A. The high degree
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
of conservation of this insert from mouse to human is astonishing and might indicate a functional significance for this stretch of 13 amino acids. Indeed, the amino terminal part of the insertion is highly basic and contains the consensus signal (bold bars in Fig. 2) for precursor cleavage catalyzed by furin within the constitutive secretory pathway. The minimal requirement for furin cleavage in mammals was shown to be either R-X-K/R-R (Hosaka et al., 1991) or R-X-X-R (Molloy et al., 1992). This situation is reminiscent of that in LRP, another member of the LDL receptor family, which was demonstrated to be processed by furin at an extracellular site (Herz et al., 1990; Willnow et al., 1995). Further experiments will show whether the resulting parts of the receptor after cleavage remain noncovalently linked, as in LRP, or if a soluble domain containing all ligand-binding repeats is secreted. Such a fragment could act as a dominant negative receptor by blocking the ligand-binding site of certain ligands, thereby prolonging the half-life and activity in the circulation or extracellular space. Finally, the largest band seen on the gel (393 bp) is derived from a version with an insertion of 73 bp ex-
gnmas
188
BRANDES ET AL.
FIG. 2. Analysis of splice variants in the ligand-binding domain of chicken and mouse LR8B and human apoER2. mRNA from chicken and mouse brain was used for cDNA synthesis with reverse transcriptase. The resulting cDNAs and DNA from a human lgt10 brain cDNA library were used for PCR amplification with the indicated primer combinations (arrows). Amplified products were separated on 2% agarose gels. The sequences of the amplified products from chicken, mouse, and human are aligned below a cartoon highlighting the relevant structural features of the receptor. Empty numbered boxes and shaded boxes represent ligand-binding repeats and EGF-precursor repeats A and B, respectively. Boxed sequences contain the potential furin cleavage sites, which are marked by bars above the respective amino acids. The numbers refer to the length of the amplified products.
actly at the junction between the cysteine-rich repeats A and B. The insertion (not shown) introduces a frame shift leading to a premature stop codon, specifying a soluble protein that, if secreted, could also act as a dominant negative receptor as discussed above. Taken together, the RT-PCR analyses of the region surrounding the last ligand-binding repeat in both receptors demonstrate that chicken and mouse LR8B occur either as seven- or eight-ligand-binding repeat variants. Interestingly, we were not able to detect the human homologue for the eight-repeat variant present in chicken and mouse. This is apparently not due to selective splicing of the corresponding exon, but caused by the absence of this exon in the human gene (T. Yamamoto, Sendai, Japan, pers. comm., Oct. 1996.). Intracellular Domain Next, we examined the reported structural difference between the cytoplasmic domains of LR8B and
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
apoER2. As indicated in Fig. 3, primers were positioned in the O-linked sugar domain and at the carboxy termini of the three respective proteins to give products specifying the transmembrane and entire cytoplasmic domains of the receptors. As shown in Fig.3, the RTPCR using chicken brain mRNA consistently produced a single band (371 bp), whereas the same reaction with murine brain mRNA or human brain cDNA (lgt10) yielded two distinct bands with a length of 373 and 550 bp for mouse and 293 and 470 bp for human, respectively. Sequence analysis clearly demonstrated that the short band present in chicken, mouse, and human is derived from messages lacking 177 bp coding for the 59amino-acid insertion reported to be present in human apoER2 mRNA (Kim et al., 1996). The larger product, present only in human and mouse, is exactly 177 bp longer, and the sequence codes for the 59 amino acid insert. The sequence of the murine insert (Fig. 3) differs from that of the human (Kim et al., 1996) in only five
gnmas
RECEPTOR VARIANTS DERIVED FROM CORRESPONDING GENES
189
FIG. 3. Analysis of splice variants in the cytoplasmic domains of chicken and mouse LR8B and human apoER2. mRNA from chicken and mouse brain was used for cDNA synthesis with reverse transcriptase. The resulting cDNAs and DNA from a human lgt10 brain cDNA library were used for PCR amplification with the indicated primer combinations (arrows). Amplified products were separated on 2% agarose gels. The sequences of the amplified products from chicken, mouse, and human are aligned below a cartoon highlighting the relevant structural features of the receptor. The numbers refer to the length of the amplified products.
positions, all of them due to conservative substitutions. Homology searches revealed that the 59-aa insert represents a unique sequence not found in any published protein so far. However, the high degree of conservation between human and mouse possibly points to an important function, at least in mammals. In this respect, it was interesting to see if the absence of a corresponding variant in chicken is caused by the absence of variable splicing or by the fact that the corresponding exon (in analogy to the missing exon for repeat 8 in man) is missing in the chicken gene. Thus, the corresponding region of the chicken gene was amplified from a cosmid clone carrying the relevant portion of
the gene (Fig. 4). The chicken gene carries a 959-bp intron interrupting the coding sequence of the receptor exactly at the position where the 59-aa insertion resides in the receptors of mouse and human. This analysis shows that in chicken LR8B the unique cytosolic insert is indeed missing from the gene; the additional exon most likely was acquired by the mammalian gene during evolution. The current results strongly support our notion that LR8B from chicken and mouse and human apoER2 are indeed differentially spliced products of corresponding genes. The fact that these novel receptors, predominantly expressed in brain and belonging to the LDL
FIG. 4. Partial sequence of the 3* end of the chicken LR8B gene. The partial sequence of a chicken cosmid clone carrying the gene for LR8B is shown in relation to the corresponding parts of the receptor cDNAs as indicated. The position of the 59-aa cytoplasmic insert in the receptor cDNAs of mouse and human is indicated. Exon sequences are in capital letters and the specified amino acids are shown above the nucleotide sequence. Numbers above the exon sequences indicate their length. Introns are marked by black bars, and the intronic nucleotide sequences are in lowercase. Numbers above the intronic sequences refer to their lengths.
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
gnmas
190
BRANDES ET AL.
receptor gene family, apparently exist as seven- as well as eight-ligand-binding repeat versions may have farreaching implications. Structural comparison of both versions with known members of the LDL receptor family reveals that the seven-repeat variant resembles the LDL receptor, whereas the eight-repeat molecule is more closely related to VLDL receptors. The current view is that these structural differences provide the LDL receptor and the VLDL receptor with different ligand-binding specificities (Schneider and Nimpf, 1993). The LDL receptor is the receptor with the most restricted ligand-binding specificity, binding only apoE and apo-B with high affinity. The VLDL receptor with eight ligand-binding repeats mediates binding and uptake of a series of ligands such as apo-E-containing lipoproteins (Takahashi et al., 1992), lipoprotein lipase (Argraves et al., 1995; Takahashi et al., 1995), urokinase– plasminogen activator/inhibitor type 1 complexes (Argraves et al., 1995; Heegaard et al., 1995), and, as shown for the chicken homologue of the VLDL receptor, apolipoprotein B and vitellogenin (Bujo et al., 1994), a2-macroglobulin (Jacobsen et al., 1995), and lactoferrin (Hiesberger et al., 1995). Thus, these results demonstrate for the first time that a gene of the LDL receptor family primarily expressed in brain can give rise to structural variants with potentially distinct physiological functions. Considering the fact that (i) chickens do not produce apolipoprotein E (Hermier et al., 1985) and (ii) different versions of this receptor may have distinct and/or novel ligand-binding specificities other than for apo-E, we propose, according to our previous suggestion (Novak et al., 1996), the designation LR7/8B for the gene characterized here. In its product, LR7/8B, LR stands for LDLR-relative, the digits specify the number of type-A binding repeats, and the B indicates the brain-specific expression of the gene. ACKNOWLEDGMENTS We appreciate the expert technical assistance by Harald Rumpler. This work was supported by grants from the Austrian Science Foundation S-07105 (to J.N.) and S-07108 (to W.J.S.). We thank Dr. Franz Wohlrab and Dr. Reinhold Hofbauer for critically reading the manuscript.
REFERENCES Argraves, K. M., Battey, F. D., MacCalman, C. D., McCrae, K. R., Ga˚fvels, M., Kozarsky, K. F., Chappell, D. A., Strauss, III., J. F., and Strickland, D. K. (1995). The very low density lipoprotein receptor mediates the cellular catabolism of lipoprotein lipase and urokinase–plasminogen activator type I complexes. J. Biol. Chem. 270: 26550–26557. Bujo, H., Hermann, M., Kaderli, M. O., Jacobsen, L., Sugawara, S., Nimpf, J., Yamamoto, T., and Schneider, W. J. (1994). Chicken oocyte growth is mediated by an eight ligand binding repeat member of the LDL receptor family. EMBO J. 13: 5165–5175. Elshourbagy, N. A., Liao, W. S., Mahley, R. W., and Taylor, J. M. (1985). Apolipoprotein E mRNA is abundant in brain and adrenals,
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
as well as in liver, and is present in other peripheral tissues of rats and marmosets. Proc. Natl. Acad. Sci. USA 82: 203–207. Heegaard, C. W., Simonson, A. C. W., Oka, K., Kjøller, L., Christensen, A., Madsen, B., Ellgaard, L., Chan, L., and Andreasen, P. A. (1995). Very low density lipoprotein receptor binds and mediates endocytosis of urokinase-type plasminogen activator-type-1 plasminogen activator inhibitor complex. J. Biol. Chem. 270: 20855–20861. Hermier, D., Forgez, P., and Chapman, P. (1985). A density gradient study of the lipoprotein and apolipoprotein distribution in the chicken, Gallus domesticus. Biochim. Biophys. Acta 836: 105–118. Herz, J., Hamann, U., Rogne, S., Myklebost, O., Gausepohl, H., and Stanley, K. K. (1988). Surface location and high affinity for calcium of a 500-kd liver membrane protein closely related to the LDLreceptor suggest a physiological role as lipoprotein receptor. EMBO J. 7: 4119–4127. Herz, J., Kowal, R. C., Goldstein, J. L., and Brown, M. S. (1990). Proteolytic processing of the 600 kd low density lipoprotein receptor-related protein (LRP) occurs in a trans-Golgi compartment. EMBO J. 9: 1769–1776. Hiesberger, T., Hermann, M., Jacobsen, L., Novak, S., Hodits, R. A., Bujo, H., Meilinger, M., Hu¨ttinger, M., Schneider, W. J., and Nimpf, J. (1995). The chicken oocyte receptor for yolk precursors as model to study the action of receptor associated protein and lactoferrin. J. Biol. Chem. 270: 18219–18226. Hosaka, M., Nagahama, M., Kim, W. S., Watanabe, T., Hatsuzawa, K., Ikemizu, J., Murakami, K., and Nakayama, K. (1991). Arg-XLys/Arg-Arg motif as a signal for precursor cleavage catalyzed by furin within the constitutive secretory pathway. J. Biol. Chem. 266: 12127–12130. Jacobsen, L., Hermann, M., Vieira, P. M., Schneider, W. J., and Nimpf, J. (1995). The chicken oocyte receptor for lipoprotein deposition recognizes a2-macroglobulin. J. Biol. Chem. 270: 6468– 6475. Kim, D., Iijima, H., Goto, K., Sakai, J., Ishii, H., Kim, H.-J., Suzuki, H., Kondo, H., Saeki, S., and Yamamoto, T. (1996). Human apolipoprotein E receptor 2: A novel lipoprotein receptor of the low density lipoprotein receptor family predominantly expressed in brain. J. Biol. Chem. 271: 8373–8380. Mahley, R. W. (1988). Apolipoprotein E: Cholesterol transport protein with expanding role in cell biology. Science 240: 622–630. Molloy, S. S., Bresnahan, P. A., Leppla, S. H., Klimpel, K. R., and Thomas, G. (1992). Human furin is a calcium-dependent serine endoprotease that recognizes the sequence Arg-X-X-Arg and efficiently cleaves anthrax toxin protective antigen. J. Biol. Chem. 267: 16396–16402. Novak, S., Hiesberger, T., Schneider, W. J., and Nimpf, J. (1996). A new low density lipoprotein receptor homologue with 8 ligand binding repeats in brain of chicken and mouse. J. Biol. Chem. 271: 11732–11736. Saito, A., Pietromonaco, S., Loo, A. K., and Farquhar, M. G. (1994). Complete cloning and sequencing of rat gp330/‘‘megalin’’, a distinct member of the low density lipoprotein receptor gene family. Proc. Natl. Acad. Sci. USA 91: 9725–9729. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). ‘‘Molecular cloning: A laboratory manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Schneider, W. J. (1989). The low density lipoprotein receptor. Biochim. Biophys. Acta 988: 303–317. Schneider, W. J., and Nimpf, J. (1993). Lipoprotein receptors: Old relatives and new arrivals. Curr. Opin. Lipidol. 4: 205–209. Strittmatter, W. J., Saunders, A. M., Schmechel, D., Pericak, V. M., Salvesen, J., and Roses, A. D. (1993). Apolipoprotein E: High-avidity binding to b-amyloid and increased frequency of type 4 allele in late-onset familial Alzheimer disease. Proc. Natl. Acad. Sci. USA 90: 1977–1981.
gnmas
RECEPTOR VARIANTS DERIVED FROM CORRESPONDING GENES Takahashi, S., Kawarabayasi, Y., Nakai, T., Sakai, J., and Yamamoto, T. (1992). Rabbit very low density lipoprotein receptor: A low density lipoprotein receptor-like protein with distinct ligand specificity. Proc. Natl. Acad. Sci. USA 89: 9252–9256. Takahashi, S., Suzuki, J., Kohno, M., Oida, K., Tamai, T., Miyabo, S., Yamamoto, T., and Nakai, T. (1995). Enhancement of the binding of triglyceride-rich lipoproteins to the very low density lipoprotein receptor by apolipoprotein E and lipoprotein lipase. J. Biol. Chem. 270: 15747–15754. Weisgraber, K. H., Roses, A. D., and Strittmatter, W. J. (1994). The role of apolipoprotein E in the nervous system. Curr. Opin. Lipidol. 5: 110–116.
AID
GENO 4702
/
6r34$$$$81
05-16-97 17:27:27
191
Willnow, T. E., Moehring, J. M., Inocencio, N. M., Moehring, T. J., and Herz, J. (1995). The low-density-lipoprotein receptor-related protein (LRP) is processed by furin in vivo and in vitro. Biochem. J. 312: 71–76. Yamamoto, T., Davis, C. G., Brown, M. S., Schneider, W. J., Casey, M. L., Goldstein, J. L., and Russell, D. W. (1984). The human LDL receptor: A cysteine-rich protein with multiple Alu sequences in its mRNA. Cell 39: 27–38. Yamazaki, H., Bujo, H., Kusunoki, J., Seimiya, K., Kanaki, T., Morisaki, N., Schneider, W. J., and Saito, Y. (1996). Elements of neural adhesion molecules and yeast vacuolar protein sorting receptor are present in a novel LDL receptor family member from man and rabbit. J. Biol. Chem. 271: 24761–24768.
gnmas