- Email: [email protected]
Bacteraemias in HIV-positive patients
877
CLINICAL AND MICROBIOLOGICAL FINDINGS
Bacteraemias in HIV-positive patients StR,-—Dr Gilks and his colleagues (Sept 1, p 545), reporting on bacteraemias seen in emergency admissions in Nairobi, clearly increase in pneumococcal and Salmonella bacteraemias among HIV-positive patients. typhimurium Unfortunately, they mar their discussion by regarding these two organisms as "non-opportunistic bacteria". Opportunistic infection arises where organisms take advantage of a defect in host defence, the type of organism depending on the nature of the defect. Any organism can be opportunist where there is an appropriate defect, its intrinsic pathogenicity being enhanced or changed by the altered state of host defences. S typhimurium bacteraemia is a well documented opportunist infection in hosts with defective cell-mediated immunity, including patients with AIDS or AIDS-related complex. Pneumococci act as opportunist pathogens in patients with hypogammaglobulinaemia or dysglobulinaemia, some early complement deficiencies, and after splenectomy. Dysglobulinaemia is well recognised in HIV disease; pneumococci and other capsulated bacteria have been shown to be "humoral" opportunists in this disease. These organisms, like many others, are pathogenic to apparently normal hosts and are facultative, not obligate, opportunists. It is notable that in Gilks and
demonstrate
an
colleagues’ investigation staphylococcal infections, typically associated in opportunist infections with neutropenia or neutrophil functional defects or with indwelling cannulas and prostheses, are not increased in HIV-infected subjects. Gilks and colleagues’ data are concordant with those of studies in other countries and with current views on the biological nature of the immune defects seen in HIV disease. The frequency of pneumococcal and S typhimurium bacteraemias in HIV-positive patients in Nairobi does seem higher than elsewhere, which may, as Gilks et al suggest, indicate a greater community prevalence of these organisms, analogous to Mycobacterium tuberculosis. Regional differences in manifestations of immunodeficiency due to HIV are indicative of the local prevalence of potential opportunist organisms rather than a fundamentally different host response to the immunopathologic effects of HIV. Department of Immunology, St Mary’s Hospital Medical School, London W2 1PG, UK
ANTHONY
J. PINCHING
SIR,-Bacterial infections cause a substantial burden in patients infected with HIV but they can be eradicated by drugs. In the USA and Europe, non-typhoid salmonellae are important opportunists in patients infected with HIV but little is known about the importance of acute bacterial infections in HIV-infected patients in African Observations from African AIDS patients treated in Europe and the recent report from Nairobi3 indicate that bacteraemia due to non-typhoid salmonellae may be important. At the University Teaching Hospital Lusaka, Zambia, only select clinical samples from patients with focal sepsis or pyrexia of unknown origin can be examined microbiologically. We looked for clinical details, including HIV serology, in the case-records of patients admitted to this hospital from whose clinical specimens non-typhoid Salmonella spp had been cultured between June, 1988, and December, 1989. Where an HIV result was not available attempts were made to retrieve stored sera for anti-HIV testing. For twenty patients from whom non-typhoid salmonellae were isolated sixteen sets of case notes were available (table). No patient had evidence of schistosomiasis, chronic liver disease, or sickle cell anaemia. The following cases show that the unusual features of non-typhoid salmonella infection in HIV-infected patients in Africa resemble those seen in the USA and Europe. Case 1 (29, M). Admitted with cough, chest pain, fever, night sweats, and weight loss. He was toxic, febrile, normotensive, and had clinical signs of a pericardial effusion, with cardiomegaly and a large effusion. A pericardial tap yielded 1200 ml of brownish aspirate. Despite intravenous antibiotics and intensive care, the patient died the next day. The pericardial fluid grew S typhimuriu11l phage type 1. Myocbacterial cultures were negative. Retrospectively he was found to be HIV seropositive.
i
i
I
*Died in hospital. NA = data not available tand phage type, RDNC=reacts with typing
I
phages
but does not conform to
a
recognised pattern. Case detailed
m
text
Case 2 (31, M). Admitted with severe abdominal pain and non-bloody diarrhoea. He was febrile, thin, and normotensive. He had clinical and radiological signs of small bowel obstruction. Laparotomy revealed large para-aortic and mesenteric lymph nodes which were necrotic with caseation and abscess formation. ZiehlNeilson staining of nodes revealed acid-fast bacilli (later identified as Mycobacterium tuberculosis). Further pockets of pus were found in the small intestine. Culture yielded S typhimurium phage type 135. Stool cultures were sterile. He was HIV seropositive. He died a week later despite chloramphenicol and anti-tuberculosis
chemotherapy. Case 3 (18, F). Admitted with a painful right groin and fever. Apart from clinical evidence of psoas muscle spasm, examination was normal. Abdominal X-ray revealed a shadow in the region of the right psoas muscle. An abscess was drained but the pus grew no organisms. She was treated with ampicillin and gentamicin. 6 weeks after discharge she was readmitted with recurrence of the abscess. Pus grew S bonn. She was treated with ampicillin. HIV serology was positive. 3 months after discharge she was clinically well. Our observations indicate that non-typhoid salmonella infection can present as a life-threatening illness in young African adults. Bacteriology reports at this hospital show that until 1985 extraintestinal focal manifestations of non-typhoid salmonella infection were rare and usually presented as bone and joint infections in patients with sickle cell anaemia. Unlike the Nairobi study,3 in which only S typhimurium was isolated, our findings suggest that other non-typhoid Salmonella spp may also be important opportunists. Extraintestinal sepsis due to non-typhoid salmonellae may be
an underestimated contributor to the acute bacterial complications of AIDS.l,4 Early recognition and treatment may prolong survival. In the west, the high frequency of relapse after initial therapy of non-typhoid salmonella infections in AIDS patients has led to consideration of prophylaxis.’
We acknowledge the support of Prof J. 0. M. Pobee, department of medicine, and Dr E. Libambala, executive director, Board of Management, University Teaching Hospital, Lusaka; and British Airways. Dr B. Rowe (Public Health Laboratory Service, London) kindly typed the salmonella isolates. Department of Pathology and Microbiology, University Teaching Hospital, Lusaka, Zambia
C. U. PERERA N. P. Luo
Departments of Medicine and Immunology, Royal Postgraduate Medical School, Hammersmith Hospital, London W12 0NN, UK
A. ZUMLA
AF Opportunistic infections in AIDS in developing and developed countries Trans R Soc Trop Med Hyg 1990, 84 (suppl 1) 1-6. 2. De Wit S, Taclman H, Van de Perre P, Rouvroy D, Clumeck N. Salmonella bacteremia in African patients with human immunodeficiency virus infection. Eur J Clin Microbiol Infect Dis 1988; 7: 45-47 1.
Fleming
878
3. Gilks CF, Brindle RJ, Otieno LS, et al. Life threatening bacteraemia in HIV-1 seropositive adults admitted to hospital in Nairobi, Kenya. Lancet 1990, 336: 545-49. 4. Blaser MJ, Cohn DL. Opportunistic infections in patients with AIDS: clues to the epidemiology of AIDS and the relative virulence of pathogens. Rev Infect Dis 1986; 8: 21-30. 5. Celum CL, Chaisson RE, Rutherford GW, Barnhart JL, Echenberg DF. Incidence of salmonellosis in patients with AIDS. Rev Infect Dis 1987; 156: 998-1002. 6. Jacobs JL, Gold JW, Murray HW, Roberts RB, Armstrong D. Salmonella infections in patients with the acquired immunodeficiency syndrome. Ann Intern Med 1985; 102: 186-88. 7. Sperber SJ, Schleupner CJ. Salmonellosis during infection with human immunodeficiency virus. Rev Infect Dis 1987; 9: 925-32.
Resurgent gonorrhoea in homosexual
men
SIR,-Dr van den Hoek and colleagues (July 21, p 179) record a resurgence of gonorrhoea among male homosexuals in Amsterdam. We have evidence of the same trend in the State of Victoria, Australia. A major public awareness campaign for AIDS was conducted in Australia in April and May, 1987. Coincidentally, the proportion of cases of gonorrhoea that were in homosexual males in Victoria fell from a median of 13.2% (quarterly range 6-1-27 -2%) in the previous 4 years to a record low of 4-6% by June, 1987. There followed a sharp rebound to 29-3% by the third quarter. This was sustained throughout 1988. In 1989 the proportion had risen to 58-9% by the second quarter, remaining as high as 37-0% twelve months later. This extraordinary trend has been observed against a steadily declining incidence of gonorrhoea in women and heterosexual men.12 Consistent with this observation, the male/female ratio has increased from 3-0 in 1987 to 5-5 in 1989. Although many of the isolates from homosexual men were from the urethra, a proportional increase in rectal isolates has been observed over the same
without
with
urea
urea
ELISA anti-HCV assay results, without and with
step.
Results for the 2 controls and for all 3 patients with anti-HCV positive post-transfusion hepatitis remained basically unaltered by addition of the urea wash. 12 sera of patients with RA became negative, however; in the other RA patient optical density readings were much reduced but still above the cut-off (figure). This suggests that most patients with RA have no antibodies binding with high affinity to the antigen, despite significantly raised optical density readings in the original ELISA. The urea wash seems to increase specificity while not altering sensitivity. We conclude that modification of the commercial ELISA might help to exclude false-positive results in patients without liver disease, until a confirmatory test for anti-HCV becomes available.
period.
These trends have clear implications for the spread of HIV and we support the need for continuous monitoring of sexually transmitted diseases as a rapid method for indicating changes in sexual behaviour.
urea
Department of Internal Medicine, University of Heidelberg, D-6900 Heidelberg, Germany
Microbiological Diagnostic Unit, University of Melbourne,
J. R. L. FORSYTH J. SHERRARD
1 Theilmann
Parkville, Victoria 3052, Australia
P. TRAYNOR
2.
T. GOESER M. BLAZEK K. GMELIN B. KOMMERELL L. THEILMANN
L, Blazek M, Goeser T, Gmelin K, Kommerell B, Fiehn W.
False-positive anti-HCV tests m rheumatoid arthritis Lancet 1990; 335: 1346. Gray JJ, Wreghitt TG, Friend PJ, Wight DGD, Sundaresan V, Calne RY Differentiation between specific and non-specific hepatitis C antibodies in chronic liver disease. Lancet 1990; 335: 609-610.
N, Carlin J, Guest C, Norris M, Traynor P Surveillance of sexually transmissible diseases in Victona, 1989. Melbourne Health Department, Victoria,
1. Crofts
1990. 2. Monheit B, Noms M, Forsyth J Notificaton of sexually transmissible diseases Victoria: annual report 1988 Melbourne Health Department, Victoria 1989
in
Washing with 8 mol/l urea to correct false-positive anti-HCV results SIR,-We have found that 61% of sera from 41 patients with rheumatoid arthritis (RA) recorded positive for hepatitis C virus (HCV) antibody in the commercial ELISA (Ortho Diagnostics). None of the patients had evidence of liver disease or a history of transfusion of blood products or drug abuse. We concluded that in patients with autoimmune disease, anti-HCV testing might give false-positive results.1 Gray et al2 showed that a wash with 8 mol/1I urea might help to differentiate between specific and non-specific HCV antibodies in chronic liver disease. Since this additional wash should dissociate low-affinity antibodies from the antigen or remove non-specific binding to the plastic well, we re-evaluated some of these patients with RA. 13 anti-HCV positive and 3 anti-HCV negative patients with RA (13 females and 3 males, mean age 48 [SD16]) were selected from the group mentioned above. Besides a positive and negative control provided by the manufacturer, sera of 3 patients with anti-HCV
positive post-transfusional non-A, non-B hepatitis were tested. Anti-HCV testing was done once following manufacturer’s instructions. A second assay was done in the same way except that after incubation of the diluted samples in the microtitre plates, the wells were washed twice with the phosphate buffered saline (PBS) provided twice with 8 mol/1 urea, and again twice with PBS. The procedure was then completed as usual.
Enhanced detection by PCR of virus RNA
hepatitis C
SIR,-We have described a "nested" polymerase chain reaction (PCR) for the detection of hepatitis C virus (HCV) RNA in serum and factor VIII concentrates (June 16, p 1419, p 1473). The oligonucleotide primers (D94, D95, N1, N2) were derived from a region of the HCV genome that encodes a non-structural protein (NS5). It is now apparent that there are HCV sequence variants which may not be recognised by these primers. Similar difficulties with HCV-PCR primers due to sequence variation are described by others (Jan 6, p 1 ; April 21, p 976; Aug 4, p 309). To overcome this problem we designed and synthesised nested primers (NCR1, NCR2, NCR3, NCR4) based on the highly conserved (>99%) 5’ noncoding region (July 28, p 245). The sequences of the outer primers and are NCR1 NCR2 (anti-sense) (sense) 5’GTATCTCGAGGCGACACTCCACCATAGAT3’ (base 10 of primer nucleotide position 1 according to the revised of numbering system Okamoto’) and 5’ATACTCGAGGTGCACGGTCTACGAGACCT3’ (base 9 = nucleotide position 323), respectively. The inner primers NCR3 and NCR4 are (sense) (antisense) 5’CCACCATAGATCTCTCCCCTGT3’ (base 1=nudeotide position 10) and 5’CACTCTCGAGCACCCTATCAGGCAGT3’ (base 1 =nucleotide position 296). Restriction sites introduced to facilitate subsequent cloning of PCR products are italicised. An annealing temperature of 50°C was used in the first round (35 cycles) and 46°C in the second round (30 cycles). RNA was =
CLINICAL AND MICROBIOLOGICAL FINDINGS
Bacteraemias in HIV-positive patients StR,-—Dr Gilks and his colleagues (Sept 1, p 545), reporting on bacteraemias seen in emergency admissions in Nairobi, clearly increase in pneumococcal and Salmonella bacteraemias among HIV-positive patients. typhimurium Unfortunately, they mar their discussion by regarding these two organisms as "non-opportunistic bacteria". Opportunistic infection arises where organisms take advantage of a defect in host defence, the type of organism depending on the nature of the defect. Any organism can be opportunist where there is an appropriate defect, its intrinsic pathogenicity being enhanced or changed by the altered state of host defences. S typhimurium bacteraemia is a well documented opportunist infection in hosts with defective cell-mediated immunity, including patients with AIDS or AIDS-related complex. Pneumococci act as opportunist pathogens in patients with hypogammaglobulinaemia or dysglobulinaemia, some early complement deficiencies, and after splenectomy. Dysglobulinaemia is well recognised in HIV disease; pneumococci and other capsulated bacteria have been shown to be "humoral" opportunists in this disease. These organisms, like many others, are pathogenic to apparently normal hosts and are facultative, not obligate, opportunists. It is notable that in Gilks and
demonstrate
an
colleagues’ investigation staphylococcal infections, typically associated in opportunist infections with neutropenia or neutrophil functional defects or with indwelling cannulas and prostheses, are not increased in HIV-infected subjects. Gilks and colleagues’ data are concordant with those of studies in other countries and with current views on the biological nature of the immune defects seen in HIV disease. The frequency of pneumococcal and S typhimurium bacteraemias in HIV-positive patients in Nairobi does seem higher than elsewhere, which may, as Gilks et al suggest, indicate a greater community prevalence of these organisms, analogous to Mycobacterium tuberculosis. Regional differences in manifestations of immunodeficiency due to HIV are indicative of the local prevalence of potential opportunist organisms rather than a fundamentally different host response to the immunopathologic effects of HIV. Department of Immunology, St Mary’s Hospital Medical School, London W2 1PG, UK
ANTHONY
J. PINCHING
SIR,-Bacterial infections cause a substantial burden in patients infected with HIV but they can be eradicated by drugs. In the USA and Europe, non-typhoid salmonellae are important opportunists in patients infected with HIV but little is known about the importance of acute bacterial infections in HIV-infected patients in African Observations from African AIDS patients treated in Europe and the recent report from Nairobi3 indicate that bacteraemia due to non-typhoid salmonellae may be important. At the University Teaching Hospital Lusaka, Zambia, only select clinical samples from patients with focal sepsis or pyrexia of unknown origin can be examined microbiologically. We looked for clinical details, including HIV serology, in the case-records of patients admitted to this hospital from whose clinical specimens non-typhoid Salmonella spp had been cultured between June, 1988, and December, 1989. Where an HIV result was not available attempts were made to retrieve stored sera for anti-HIV testing. For twenty patients from whom non-typhoid salmonellae were isolated sixteen sets of case notes were available (table). No patient had evidence of schistosomiasis, chronic liver disease, or sickle cell anaemia. The following cases show that the unusual features of non-typhoid salmonella infection in HIV-infected patients in Africa resemble those seen in the USA and Europe. Case 1 (29, M). Admitted with cough, chest pain, fever, night sweats, and weight loss. He was toxic, febrile, normotensive, and had clinical signs of a pericardial effusion, with cardiomegaly and a large effusion. A pericardial tap yielded 1200 ml of brownish aspirate. Despite intravenous antibiotics and intensive care, the patient died the next day. The pericardial fluid grew S typhimuriu11l phage type 1. Myocbacterial cultures were negative. Retrospectively he was found to be HIV seropositive.
i
i
I
*Died in hospital. NA = data not available tand phage type, RDNC=reacts with typing
I
phages
but does not conform to
a
recognised pattern. Case detailed
m
text
Case 2 (31, M). Admitted with severe abdominal pain and non-bloody diarrhoea. He was febrile, thin, and normotensive. He had clinical and radiological signs of small bowel obstruction. Laparotomy revealed large para-aortic and mesenteric lymph nodes which were necrotic with caseation and abscess formation. ZiehlNeilson staining of nodes revealed acid-fast bacilli (later identified as Mycobacterium tuberculosis). Further pockets of pus were found in the small intestine. Culture yielded S typhimurium phage type 135. Stool cultures were sterile. He was HIV seropositive. He died a week later despite chloramphenicol and anti-tuberculosis
chemotherapy. Case 3 (18, F). Admitted with a painful right groin and fever. Apart from clinical evidence of psoas muscle spasm, examination was normal. Abdominal X-ray revealed a shadow in the region of the right psoas muscle. An abscess was drained but the pus grew no organisms. She was treated with ampicillin and gentamicin. 6 weeks after discharge she was readmitted with recurrence of the abscess. Pus grew S bonn. She was treated with ampicillin. HIV serology was positive. 3 months after discharge she was clinically well. Our observations indicate that non-typhoid salmonella infection can present as a life-threatening illness in young African adults. Bacteriology reports at this hospital show that until 1985 extraintestinal focal manifestations of non-typhoid salmonella infection were rare and usually presented as bone and joint infections in patients with sickle cell anaemia. Unlike the Nairobi study,3 in which only S typhimurium was isolated, our findings suggest that other non-typhoid Salmonella spp may also be important opportunists. Extraintestinal sepsis due to non-typhoid salmonellae may be
an underestimated contributor to the acute bacterial complications of AIDS.l,4 Early recognition and treatment may prolong survival. In the west, the high frequency of relapse after initial therapy of non-typhoid salmonella infections in AIDS patients has led to consideration of prophylaxis.’
We acknowledge the support of Prof J. 0. M. Pobee, department of medicine, and Dr E. Libambala, executive director, Board of Management, University Teaching Hospital, Lusaka; and British Airways. Dr B. Rowe (Public Health Laboratory Service, London) kindly typed the salmonella isolates. Department of Pathology and Microbiology, University Teaching Hospital, Lusaka, Zambia
C. U. PERERA N. P. Luo
Departments of Medicine and Immunology, Royal Postgraduate Medical School, Hammersmith Hospital, London W12 0NN, UK
A. ZUMLA
AF Opportunistic infections in AIDS in developing and developed countries Trans R Soc Trop Med Hyg 1990, 84 (suppl 1) 1-6. 2. De Wit S, Taclman H, Van de Perre P, Rouvroy D, Clumeck N. Salmonella bacteremia in African patients with human immunodeficiency virus infection. Eur J Clin Microbiol Infect Dis 1988; 7: 45-47 1.
Fleming
878
3. Gilks CF, Brindle RJ, Otieno LS, et al. Life threatening bacteraemia in HIV-1 seropositive adults admitted to hospital in Nairobi, Kenya. Lancet 1990, 336: 545-49. 4. Blaser MJ, Cohn DL. Opportunistic infections in patients with AIDS: clues to the epidemiology of AIDS and the relative virulence of pathogens. Rev Infect Dis 1986; 8: 21-30. 5. Celum CL, Chaisson RE, Rutherford GW, Barnhart JL, Echenberg DF. Incidence of salmonellosis in patients with AIDS. Rev Infect Dis 1987; 156: 998-1002. 6. Jacobs JL, Gold JW, Murray HW, Roberts RB, Armstrong D. Salmonella infections in patients with the acquired immunodeficiency syndrome. Ann Intern Med 1985; 102: 186-88. 7. Sperber SJ, Schleupner CJ. Salmonellosis during infection with human immunodeficiency virus. Rev Infect Dis 1987; 9: 925-32.
Resurgent gonorrhoea in homosexual
men
SIR,-Dr van den Hoek and colleagues (July 21, p 179) record a resurgence of gonorrhoea among male homosexuals in Amsterdam. We have evidence of the same trend in the State of Victoria, Australia. A major public awareness campaign for AIDS was conducted in Australia in April and May, 1987. Coincidentally, the proportion of cases of gonorrhoea that were in homosexual males in Victoria fell from a median of 13.2% (quarterly range 6-1-27 -2%) in the previous 4 years to a record low of 4-6% by June, 1987. There followed a sharp rebound to 29-3% by the third quarter. This was sustained throughout 1988. In 1989 the proportion had risen to 58-9% by the second quarter, remaining as high as 37-0% twelve months later. This extraordinary trend has been observed against a steadily declining incidence of gonorrhoea in women and heterosexual men.12 Consistent with this observation, the male/female ratio has increased from 3-0 in 1987 to 5-5 in 1989. Although many of the isolates from homosexual men were from the urethra, a proportional increase in rectal isolates has been observed over the same
without
with
urea
urea
ELISA anti-HCV assay results, without and with
step.
Results for the 2 controls and for all 3 patients with anti-HCV positive post-transfusion hepatitis remained basically unaltered by addition of the urea wash. 12 sera of patients with RA became negative, however; in the other RA patient optical density readings were much reduced but still above the cut-off (figure). This suggests that most patients with RA have no antibodies binding with high affinity to the antigen, despite significantly raised optical density readings in the original ELISA. The urea wash seems to increase specificity while not altering sensitivity. We conclude that modification of the commercial ELISA might help to exclude false-positive results in patients without liver disease, until a confirmatory test for anti-HCV becomes available.
period.
These trends have clear implications for the spread of HIV and we support the need for continuous monitoring of sexually transmitted diseases as a rapid method for indicating changes in sexual behaviour.
urea
Department of Internal Medicine, University of Heidelberg, D-6900 Heidelberg, Germany
Microbiological Diagnostic Unit, University of Melbourne,
J. R. L. FORSYTH J. SHERRARD
1 Theilmann
Parkville, Victoria 3052, Australia
P. TRAYNOR
2.
T. GOESER M. BLAZEK K. GMELIN B. KOMMERELL L. THEILMANN
L, Blazek M, Goeser T, Gmelin K, Kommerell B, Fiehn W.
False-positive anti-HCV tests m rheumatoid arthritis Lancet 1990; 335: 1346. Gray JJ, Wreghitt TG, Friend PJ, Wight DGD, Sundaresan V, Calne RY Differentiation between specific and non-specific hepatitis C antibodies in chronic liver disease. Lancet 1990; 335: 609-610.
N, Carlin J, Guest C, Norris M, Traynor P Surveillance of sexually transmissible diseases in Victona, 1989. Melbourne Health Department, Victoria,
1. Crofts
1990. 2. Monheit B, Noms M, Forsyth J Notificaton of sexually transmissible diseases Victoria: annual report 1988 Melbourne Health Department, Victoria 1989
in
Washing with 8 mol/l urea to correct false-positive anti-HCV results SIR,-We have found that 61% of sera from 41 patients with rheumatoid arthritis (RA) recorded positive for hepatitis C virus (HCV) antibody in the commercial ELISA (Ortho Diagnostics). None of the patients had evidence of liver disease or a history of transfusion of blood products or drug abuse. We concluded that in patients with autoimmune disease, anti-HCV testing might give false-positive results.1 Gray et al2 showed that a wash with 8 mol/1I urea might help to differentiate between specific and non-specific HCV antibodies in chronic liver disease. Since this additional wash should dissociate low-affinity antibodies from the antigen or remove non-specific binding to the plastic well, we re-evaluated some of these patients with RA. 13 anti-HCV positive and 3 anti-HCV negative patients with RA (13 females and 3 males, mean age 48 [SD16]) were selected from the group mentioned above. Besides a positive and negative control provided by the manufacturer, sera of 3 patients with anti-HCV
positive post-transfusional non-A, non-B hepatitis were tested. Anti-HCV testing was done once following manufacturer’s instructions. A second assay was done in the same way except that after incubation of the diluted samples in the microtitre plates, the wells were washed twice with the phosphate buffered saline (PBS) provided twice with 8 mol/1 urea, and again twice with PBS. The procedure was then completed as usual.
Enhanced detection by PCR of virus RNA
hepatitis C
SIR,-We have described a "nested" polymerase chain reaction (PCR) for the detection of hepatitis C virus (HCV) RNA in serum and factor VIII concentrates (June 16, p 1419, p 1473). The oligonucleotide primers (D94, D95, N1, N2) were derived from a region of the HCV genome that encodes a non-structural protein (NS5). It is now apparent that there are HCV sequence variants which may not be recognised by these primers. Similar difficulties with HCV-PCR primers due to sequence variation are described by others (Jan 6, p 1 ; April 21, p 976; Aug 4, p 309). To overcome this problem we designed and synthesised nested primers (NCR1, NCR2, NCR3, NCR4) based on the highly conserved (>99%) 5’ noncoding region (July 28, p 245). The sequences of the outer primers and are NCR1 NCR2 (anti-sense) (sense) 5’GTATCTCGAGGCGACACTCCACCATAGAT3’ (base 10 of primer nucleotide position 1 according to the revised of numbering system Okamoto’) and 5’ATACTCGAGGTGCACGGTCTACGAGACCT3’ (base 9 = nucleotide position 323), respectively. The inner primers NCR3 and NCR4 are (sense) (antisense) 5’CCACCATAGATCTCTCCCCTGT3’ (base 1=nudeotide position 10) and 5’CACTCTCGAGCACCCTATCAGGCAGT3’ (base 1 =nucleotide position 296). Restriction sites introduced to facilitate subsequent cloning of PCR products are italicised. An annealing temperature of 50°C was used in the first round (35 cycles) and 46°C in the second round (30 cycles). RNA was =