- Email: [email protected]
Bartonella quintana prosthetic valve endocarditis detected by blood culture incubation beyond 10 days
European Journal of Internal Medicine 17 (2006) 441 – 443 www.elsevier.com/locate/ejim
Brief report
Bartonella quintana prosthetic valve endocarditis detected by blood culture incubation beyond 10 days Hugo P. Sondermeijer a , Eric C.J. Claas c , Jurgen M. Orendi c,d , Jouke T. Tamsma b,⁎ a
Department of Surgery, Columbia University Medical Center, New York, NY 10032 USA Department of General Medicine, LUMC, Albinusdreef 2, 2300 RC Leiden, The Netherlands c Department of Medical Microbiology, LUMC, Leiden, The Netherlands Microbiology and Public Health Laboratory, Central Pathology Laboratory, University Hospital of North Staffordshire NHS Trust, Stoke on Trent, United Kingdom b
d
Received 24 October 2005; received in revised form 6 February 2006; accepted 20 February 2006
Abstract We describe the case of a 45-year-old man with mitral and aortic prosthetic valve replacement who presented with symptoms of subacute bacterial endocarditis. Bartonella quintana was grown from blood after prolonged culture. The course of the disease was complicated by splenic infarction, glomerulonephritis resulting in progressive renal insufficiency, and cerebroventricular hemorrhage. Notably, cardiac ultrasonography showed no extensive vegetations but a strand-like lesion. Culture-positive B. quintana prosthetic valve endocarditis in a formerly healthy subject represents a newly observed entity. It should be added to the differential diagnosis of prosthetic valve endocarditis, especially when it presents with features suggesting subacute bacterial endocarditis. © 2006 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved. Keywords: Bartonella; Prosthetic valve; Endocarditis
1. Introduction Bartonella species are small, Gram-negative bacilli that have recently been shown to be able to cause endocarditis [1]. Bartonella quintana (formerly known as Rochalimaea quintana) is a fastidious Gram-negative bacterium first identified as the cause of louse-born epidemic trench fever in Europe during World War I. Descriptions of the clinical manifestations of this disease have varied, with an insidious onset of nonspecific symptoms reported in some patients and a more sudden illness characterized by fever, malaise, headache, bone pain, and a transient macular rash reported in others [2]. The current report represents the first known case of culture-positive B. quintana prosthetic valve endocarditis in
⁎ Corresponding author. Tel.: +31 71 5 262 085; fax: +31 71 5 248 140. E-mail address: [email protected] (J.T. Tamsma).
a patient who was not considered to belong to a known risk group. 2. Case report A 45-year-old Moroccan man, residing in the Netherlands for almost 20 years, was admitted to the hospital with a prolonged history of malaise and microscopic hematuria. His medical history included Medtronic Hall mitral and aortic valve replacement in 1994 for rheumatic heart disease. Three months before admission, he had been admitted to another department with left-sided abdominal pain caused by splenic infarction. Endocarditis was considered, but not established. One out of six blood cultures taken at that time became positive with a Gram-negative rod after prolonged culture. This microorganism could not be identified by routine phenotypic methods and was considered to be due to contamination. At the current admission, the patient reported night sweats for 2 months, weight loss, and dizziness without
0953-6205/$ - see front matter © 2006 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.ejim.2006.02.022
442
H.P. Sondermeijer et al. / European Journal of Internal Medicine 17 (2006) 441–443
associated collapse. He worked as a social worker but did not have contact with the homeless or with alcohol or drug abusers. On admission body temperature ranged from 37.3 °C to 39.1 °C with normal vital signs. His resting heart rate was 78 beats/min, blood pressure 105/65 mm Hg, and prosthetic heart sounds (clicks) were heard with a systolic murmur grade 3/6 at the 4th left intercostal space. He had mild hepatosplenomegaly. No peripheral stigmata of infective endocarditis were found. Laboratory results showed a normocytic anemia, hemoglobin of 4.2 mmol/L (normal range: 8.5–11.0 mmol/L), ESR 90 mm/h, and serum creatinine 336 μmol/L (normal range: 70–133 μmol/L). The international normalized ratio (INR) was between 1.8 and 4.9 (target level: 3–4). Urinalysis showed several erythrocyte casts and proteinuria (1.19–4.88 g/24h) and calculated creatinine clearance was 19.0 ml/min (normal range 97–137 ml/min). An electrocardiogram showed sinus rhythm with a left-sided electrical axis and a left anterior hemiblock. The QTc interval was just within the normal range (440 ms); no ST segment or T-wave changes were found. A chest X-ray was unremarkable. Transesophageal echocardiography revealed a strand at the atrial side of the mitral valve. Six blood culture sets were collected and, after 10– 12 days, growth of a small, Gram-negative rod, which was sensitive to ceftazidime and penicillin, was observed in all sets. The patient was treated accordingly with high-dose ceftazidime intravenously, aiming at a HACEK positive endocarditis. In view of progressive renal dysfunction, a renal biopsy was performed that showed diffuse intra- and extra-capillary proliferative necrotizing glomerulonephritis, compatible with a parainfectious glomerulonephritis as seen in infectious endocarditis. On day 30 after admission, the patient became inattentive and deteriorated neurologically, due to cerebroventricular hemorrhage. Despite attempted neurosurgical drainage, he did not recover and died in the ICU. Permission for autopsy was not granted. DNA was extracted from a colony of the isolated fastidious Gram-negative rod and subjected to PCR amplification using conserved, broad reactive primers on the 16S rRNA gene, as described previously [3], with one additional primer (CCTTGTTACGACTTCACCCC). Nucleotide sequence analysis (1156 nt) and a BLAST search of the EMBL/GENBANK database revealed a greater than 99.5% homology with B. quintana and 98% homology with Bartonella henselae 16S rRNA gene. Since both B. quintana and B. henselae have been associated with endocarditis, the Bartonella hrtA gene, which allows differentiation between B. quintana and B. henselae [4], was partially sequenced. This revealed a sequence that was identical to the sequence of the B. quintana RQ1 probe [4], confirming its identity as B. quintana. In addition, a serum sample tested positive for IgM and highly positive for IgG anti-Bartonella antibodies (titers 1:374 and 1:3000, respectively) in an enzyme-linked immunoassay (EIA). Molecular analysis from frozen
samples of the microorganism previously cultured revealed it was the same pathogen as that finally isolated. 3. Discussion B. quintana endocarditis in developed countries is confined to specific groups, e.g., alcoholics, the homeless, and HIV-infected individuals [1,2,5]. B. quintana can cause trench fever, endocarditis, cerebral abscess, and chronic bacteremia. B. quintana infection is extremely rare in the Netherlands, including in the known risk groups. However, North Africa is considered to be still endemic for trench fever. Our patient was of Moroccan origin. He had visited Morocco 2 years before admission and may have stayed with local residents. Most reported cases of B. quintana endocarditis have affected native valves. Here, we report the first culturepositive B. quintana prosthetic valve endocarditis. This case emphasizes the importance of extending blood cultures for more than 10 days in suspected endocarditis. Of interest is that B. quintana endocarditis appears to present with features reminiscent of viridans streptococcal endocarditis with lowgrade fever, night sweats, weight loss, and otherwise nonspecific systemic complaints. The course of the disease was complicated by splenic infarction, glomerulonephritis resulting in progressive renal insufficiency, and cerebroventricular hemorrhage. Notably, cardiac ultrasonography showed no extensive vegetations but a strand-like lesion. This has previously been observed in Bartonella endocarditis and corresponds to the more fibrotic, less extensive, and chronic inflammatory lesions observed at pathologic examination [6]. Despite the absence of clear vegetations, the intracranial bleeding was probably due to a combination of cardioembolism and mildly elevated INRs. Culture-positive B. quintana prosthetic valve endocarditis in a formerly healthy subject represents a newly observed entity. It should be added to the differential diagnosis of prosthetic valve endocarditis, especially when it presents with features suggesting subacute bacterial endocarditis. 3.1. Learning points: • B. quintana can cause prosthetic valve endocarditis and should be considered in formerly healthy patients. • B. quintana endocarditis may present with symptoms of subacute endocarditis complicated by splenic infarction and glomerulonephritis. • B. quintana endocarditis can be detected by blood culture incubation beyond 10 days. References [1] Drancourt M, Mainardi JL, Brouqui P, Vandenesch F, Carta A, Lehnert F, et al. Bartonella (Rochalimaea) quintana endocarditis in three homeless men. N Engl J Med 1995;332(7):419–23. [2] Brouqui P, Lascola B, Roux V, Raoult D. Chronic Bartonella quintana bacteremia in homeless patients. N Engl J Med 1999;340(3):184–9.
H.P. Sondermeijer et al. / European Journal of Internal Medicine 17 (2006) 441–443 [3] Kuijper EJ, Stevens S, Imamura T, De Wever B, Claas EC. Genotypic identification of erythromycin-resistant Campylobacter isolates as Helicobacter species and analysis of resistance mechanism. J Clin Microbiol 2003;41(8):3732–6. [4] Anderson B, Sims K, Regnery R, Robinson L, Schmidt MJ, Goral S, et al. Detection of Rochalimaea henselae DNA in specimens from cat scratch disease patients by PCR. J Clin Microbiol 1994;32(4):942–8.
443
[5] Spach DH, Kanter AS, Dougherty MJ, Larson AM, Coyle MB, Brenner DJ, et al. Bartonella (Rochalimaea) quintana bacteremia in inner-city patients with chronic alcoholism. N Engl J Med 1995;332(7):424–8. [6] Lepidi H, Fournier PE, Raoult D. Quantitative analysis of valvular lesions during Bartonella endocarditis. Am J Clin Pathol 2000;114 (6):880–9.
Brief report
Bartonella quintana prosthetic valve endocarditis detected by blood culture incubation beyond 10 days Hugo P. Sondermeijer a , Eric C.J. Claas c , Jurgen M. Orendi c,d , Jouke T. Tamsma b,⁎ a
Department of Surgery, Columbia University Medical Center, New York, NY 10032 USA Department of General Medicine, LUMC, Albinusdreef 2, 2300 RC Leiden, The Netherlands c Department of Medical Microbiology, LUMC, Leiden, The Netherlands Microbiology and Public Health Laboratory, Central Pathology Laboratory, University Hospital of North Staffordshire NHS Trust, Stoke on Trent, United Kingdom b
d
Received 24 October 2005; received in revised form 6 February 2006; accepted 20 February 2006
Abstract We describe the case of a 45-year-old man with mitral and aortic prosthetic valve replacement who presented with symptoms of subacute bacterial endocarditis. Bartonella quintana was grown from blood after prolonged culture. The course of the disease was complicated by splenic infarction, glomerulonephritis resulting in progressive renal insufficiency, and cerebroventricular hemorrhage. Notably, cardiac ultrasonography showed no extensive vegetations but a strand-like lesion. Culture-positive B. quintana prosthetic valve endocarditis in a formerly healthy subject represents a newly observed entity. It should be added to the differential diagnosis of prosthetic valve endocarditis, especially when it presents with features suggesting subacute bacterial endocarditis. © 2006 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved. Keywords: Bartonella; Prosthetic valve; Endocarditis
1. Introduction Bartonella species are small, Gram-negative bacilli that have recently been shown to be able to cause endocarditis [1]. Bartonella quintana (formerly known as Rochalimaea quintana) is a fastidious Gram-negative bacterium first identified as the cause of louse-born epidemic trench fever in Europe during World War I. Descriptions of the clinical manifestations of this disease have varied, with an insidious onset of nonspecific symptoms reported in some patients and a more sudden illness characterized by fever, malaise, headache, bone pain, and a transient macular rash reported in others [2]. The current report represents the first known case of culture-positive B. quintana prosthetic valve endocarditis in
⁎ Corresponding author. Tel.: +31 71 5 262 085; fax: +31 71 5 248 140. E-mail address: [email protected] (J.T. Tamsma).
a patient who was not considered to belong to a known risk group. 2. Case report A 45-year-old Moroccan man, residing in the Netherlands for almost 20 years, was admitted to the hospital with a prolonged history of malaise and microscopic hematuria. His medical history included Medtronic Hall mitral and aortic valve replacement in 1994 for rheumatic heart disease. Three months before admission, he had been admitted to another department with left-sided abdominal pain caused by splenic infarction. Endocarditis was considered, but not established. One out of six blood cultures taken at that time became positive with a Gram-negative rod after prolonged culture. This microorganism could not be identified by routine phenotypic methods and was considered to be due to contamination. At the current admission, the patient reported night sweats for 2 months, weight loss, and dizziness without
0953-6205/$ - see front matter © 2006 European Federation of Internal Medicine. Published by Elsevier B.V. All rights reserved. doi:10.1016/j.ejim.2006.02.022
442
H.P. Sondermeijer et al. / European Journal of Internal Medicine 17 (2006) 441–443
associated collapse. He worked as a social worker but did not have contact with the homeless or with alcohol or drug abusers. On admission body temperature ranged from 37.3 °C to 39.1 °C with normal vital signs. His resting heart rate was 78 beats/min, blood pressure 105/65 mm Hg, and prosthetic heart sounds (clicks) were heard with a systolic murmur grade 3/6 at the 4th left intercostal space. He had mild hepatosplenomegaly. No peripheral stigmata of infective endocarditis were found. Laboratory results showed a normocytic anemia, hemoglobin of 4.2 mmol/L (normal range: 8.5–11.0 mmol/L), ESR 90 mm/h, and serum creatinine 336 μmol/L (normal range: 70–133 μmol/L). The international normalized ratio (INR) was between 1.8 and 4.9 (target level: 3–4). Urinalysis showed several erythrocyte casts and proteinuria (1.19–4.88 g/24h) and calculated creatinine clearance was 19.0 ml/min (normal range 97–137 ml/min). An electrocardiogram showed sinus rhythm with a left-sided electrical axis and a left anterior hemiblock. The QTc interval was just within the normal range (440 ms); no ST segment or T-wave changes were found. A chest X-ray was unremarkable. Transesophageal echocardiography revealed a strand at the atrial side of the mitral valve. Six blood culture sets were collected and, after 10– 12 days, growth of a small, Gram-negative rod, which was sensitive to ceftazidime and penicillin, was observed in all sets. The patient was treated accordingly with high-dose ceftazidime intravenously, aiming at a HACEK positive endocarditis. In view of progressive renal dysfunction, a renal biopsy was performed that showed diffuse intra- and extra-capillary proliferative necrotizing glomerulonephritis, compatible with a parainfectious glomerulonephritis as seen in infectious endocarditis. On day 30 after admission, the patient became inattentive and deteriorated neurologically, due to cerebroventricular hemorrhage. Despite attempted neurosurgical drainage, he did not recover and died in the ICU. Permission for autopsy was not granted. DNA was extracted from a colony of the isolated fastidious Gram-negative rod and subjected to PCR amplification using conserved, broad reactive primers on the 16S rRNA gene, as described previously [3], with one additional primer (CCTTGTTACGACTTCACCCC). Nucleotide sequence analysis (1156 nt) and a BLAST search of the EMBL/GENBANK database revealed a greater than 99.5% homology with B. quintana and 98% homology with Bartonella henselae 16S rRNA gene. Since both B. quintana and B. henselae have been associated with endocarditis, the Bartonella hrtA gene, which allows differentiation between B. quintana and B. henselae [4], was partially sequenced. This revealed a sequence that was identical to the sequence of the B. quintana RQ1 probe [4], confirming its identity as B. quintana. In addition, a serum sample tested positive for IgM and highly positive for IgG anti-Bartonella antibodies (titers 1:374 and 1:3000, respectively) in an enzyme-linked immunoassay (EIA). Molecular analysis from frozen
samples of the microorganism previously cultured revealed it was the same pathogen as that finally isolated. 3. Discussion B. quintana endocarditis in developed countries is confined to specific groups, e.g., alcoholics, the homeless, and HIV-infected individuals [1,2,5]. B. quintana can cause trench fever, endocarditis, cerebral abscess, and chronic bacteremia. B. quintana infection is extremely rare in the Netherlands, including in the known risk groups. However, North Africa is considered to be still endemic for trench fever. Our patient was of Moroccan origin. He had visited Morocco 2 years before admission and may have stayed with local residents. Most reported cases of B. quintana endocarditis have affected native valves. Here, we report the first culturepositive B. quintana prosthetic valve endocarditis. This case emphasizes the importance of extending blood cultures for more than 10 days in suspected endocarditis. Of interest is that B. quintana endocarditis appears to present with features reminiscent of viridans streptococcal endocarditis with lowgrade fever, night sweats, weight loss, and otherwise nonspecific systemic complaints. The course of the disease was complicated by splenic infarction, glomerulonephritis resulting in progressive renal insufficiency, and cerebroventricular hemorrhage. Notably, cardiac ultrasonography showed no extensive vegetations but a strand-like lesion. This has previously been observed in Bartonella endocarditis and corresponds to the more fibrotic, less extensive, and chronic inflammatory lesions observed at pathologic examination [6]. Despite the absence of clear vegetations, the intracranial bleeding was probably due to a combination of cardioembolism and mildly elevated INRs. Culture-positive B. quintana prosthetic valve endocarditis in a formerly healthy subject represents a newly observed entity. It should be added to the differential diagnosis of prosthetic valve endocarditis, especially when it presents with features suggesting subacute bacterial endocarditis. 3.1. Learning points: • B. quintana can cause prosthetic valve endocarditis and should be considered in formerly healthy patients. • B. quintana endocarditis may present with symptoms of subacute endocarditis complicated by splenic infarction and glomerulonephritis. • B. quintana endocarditis can be detected by blood culture incubation beyond 10 days. References [1] Drancourt M, Mainardi JL, Brouqui P, Vandenesch F, Carta A, Lehnert F, et al. Bartonella (Rochalimaea) quintana endocarditis in three homeless men. N Engl J Med 1995;332(7):419–23. [2] Brouqui P, Lascola B, Roux V, Raoult D. Chronic Bartonella quintana bacteremia in homeless patients. N Engl J Med 1999;340(3):184–9.
H.P. Sondermeijer et al. / European Journal of Internal Medicine 17 (2006) 441–443 [3] Kuijper EJ, Stevens S, Imamura T, De Wever B, Claas EC. Genotypic identification of erythromycin-resistant Campylobacter isolates as Helicobacter species and analysis of resistance mechanism. J Clin Microbiol 2003;41(8):3732–6. [4] Anderson B, Sims K, Regnery R, Robinson L, Schmidt MJ, Goral S, et al. Detection of Rochalimaea henselae DNA in specimens from cat scratch disease patients by PCR. J Clin Microbiol 1994;32(4):942–8.
443
[5] Spach DH, Kanter AS, Dougherty MJ, Larson AM, Coyle MB, Brenner DJ, et al. Bartonella (Rochalimaea) quintana bacteremia in inner-city patients with chronic alcoholism. N Engl J Med 1995;332(7):424–8. [6] Lepidi H, Fournier PE, Raoult D. Quantitative analysis of valvular lesions during Bartonella endocarditis. Am J Clin Pathol 2000;114 (6):880–9.