- Email: [email protected]
Behavioral changes following antisense oligonucleotide-induced reduction of organic cation transporter-3 in mice
Neuroscience Letters 382 (2005) 195–200
Behavioral changes following antisense oligonucleotide-induced reduction of organic cation transporter-3 in mice Kiyoyuki Kitaichi ∗ , Masaya Fukuda, Hironao Nakayama, Nagisa Aoyama, Yukiko Ito, Yohei Fujimoto, Kenji Takagi, Kenzo Takagi, Takaaki Hasegawa a Department
of Medical Technology, Nagoya University School of Health Sciences, 1-1-20, Daikominami, Higashi-ku, Nagoya 461-8673, Japan Received 7 December 2004; received in revised form 4 March 2005; accepted 7 March 2005
Abstract The organic cation transporter-3 (OCT3) can transport monoamines, similar to neuronal monoamine transporters. Due to the lack of selective ligands, however, the functional role of OCT3 is still unknown. Thus, we investigated behavioral effects of antisense against OCT3 (AS) in mice. AS (0.075-0.25 g/0.25 l/h, for 7 days) dose-dependently decreased immobility time. Moreover, although neither AS (0.075 g/0.25 l/h, for 7 days) or imipramine (4 mg/kg, i.p.) were effective, imipramine (4 mg/kg, i.p.) significantly decreased immobility time in mice treated with AS (0.075 g/0.25 l/h, for 7 days). Additionally, AS (0.25 g/0.25 l/h, for 7 days) significantly increased locomotor activity induced by methamphetamine (1 mg/kg, s.c.), but did not affect spontaneous locomotor activity. These results suggest that OCT3 might become a novel molecular target to treat depression and other diseases related to monoaminergic neuronal systems. © 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: Antidepressants; Organic cation transporter-3; Forced swimming test; Mice
There are currently 12 known members of the solute carrier 22 (SLC22) family in humans and rats. These encompass the organic cation transporters (OCTs), the carnitine transporter (OCTN2/SLC22A5) [22], the urate anion-exchanger (URAT1/SLC22A12) [2] as well as several organic anion transporters [6,12]. Among SLC22 family members, OCTs are unique in there ability to transport monoamines [12]. Recently, several groups have identified OCTs in the brain [12]. Thus, it is of interest to investigate the effect of OCTs in central nervous system (CNS). Due to the lack of selective ligands, however, there are only a few reports that have demonstrated CNS effects of OCTs to date [11,19]. Among OCTs, OCT3 is a likely candidate for CNS effects since OCT3 was expressed in brain [3,7,19] and showed to have a functional role in the CNS [11,19]. For example, the function of OCT3 in CNS was evaluated by Vialou et Abbreviations: OCT3, organic cation transporter-3; AS, antisense against OCT3; FST, forced swimming test; IMI, imipramine ∗ Corresponding author. Tel.: +81 52 719 1341; fax: +81 52 719 3009. E-mail address: [email protected] (K. Kitaichi). 0304-3940/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2005.03.014
al. [19], who showed differential regulation of salt intake in OCT3-knockout mice. Moreover, we have demonstrated that repeated exposure to a psychostimulant, methamphetamine, alters the expression of OCT3 in brain [10,11]. Additionally, considering the crucial role of OCT3 on the clearance of noradrenaline (NA) at sympathetic nerve terminals [12], a role for OCT3 on CNS neurotransmission has also been proposed [11]. However, the neurobehavioral effects of OCT3 have not been fully evaluated. In the present studies, we used antisense against OCT3 to evaluate the role of OCT3 in CNS. Considering that OCT3 can transport monoamines [7,21], two typical monoaminergic behavioral tasks, the forced swimming test (FST) and psychostimulant-induced hyperlocomotion, were selected. Our data using antisense against OCT3 suggest that OCT3 is an important regulator of these behaviors. Male ddY mice weighing 28–33 g from Japan SLC Inc. (Hamamatsu, Japan) were used. The animals were maintained in a temperature- and humidity-regulated room (22–24 ◦ C and 55 ± 5%, respectively) with food and water ad libitum under controlled lighting (lights on:
196
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
08:00–20:00 h) for at least 3 days before the experiment. 21-mer phosphorothioate-modified antisense oligodeoxynucleotides against OCT3 (AS) were designed from the cDNA sequences of OCT3 (nucleotides −3 to +18, GenBank Database accession NM 019230) targeting the area spanning the initiation codon (5 TGGTCGAACGTGGGCATGGTG 3 ). Phosphorothioate-modified oligodeoxynucleotides having the same proportion of DNA bases as AS but in a scrambled order (5 TAGTCGGAGGTGAGCGGCGTT 3 , ScrAS) were also prepared as controls. The selected sequences have little or no homology to other known cDNA sequences registered in the GenBank Database (NIH, Bethesda, MD). AS and ScrAS were synthesized, purified and lyophilized by Sigma-Aldrich Japan K.K. Genosys Division (Ishikari, Hokkaido, Japan). Both oligodeoxynucleotides were dissolved in filtered sterile buffered-Ringer solution (140 mM NaCl, 3.0 mM KCl, 1.5 mM NaH2 PO4 , 1.2 mM MgCl2 , 1.2 mM CaCl2 , pH 7.4. Imipramine (IMI) was purchased from Sigma-Alldrich Co. (St. Louis, MO, USA) and was administered 30 min before the post-test. Control animals received only saline. Drugs were dissolved in saline and injected in a volume of 0.1 ml/10 g of body weight. All behavioral tasks were conducted between 11:00 and 19:00 in a temperature-controlled room (22–24 ◦ C) after habituation to the test room for over 2 h. The forced swimming test in mice (FST) [14], with some modification, was used to evaluate potential antidepressant effects of AS, ScrAS and/or IMI. Glass cylinders (height 17 cm, diameter 15.5 cm) containing water 12 cm deep at 25 ◦ C were used for FST. The water was changed between testing individual animals to avoid methodological artifacts like the existence of pheromones or other products excreted by mice. FST consist of two tests: the pre- and post-tests. In pre-test, mice without any drug treatment were placed individually in the cylinders and left there for 5 min. A mouse was judged to be immobile when it remained floating in the water and made only the movements necessary to keep its head above the surface. The total duration of immobility during the test was evaluated. After the pre-test, animals were divided into groups by adjusting the mean ± S.E. of immobility time in the pre-test to the same values between groups. Mice having longer or shorter immobility time than the average time (over 60-s difference from the average time) was removed since they show much different immobility time in post-test from others (data not shown). One day after the pre-test, osmotic minipumps (model 1002, Alza, Palo Alto, CA) containing AS or ScrAS were implanted for infusion into the third ventricle, as described elsewhere [9]. Briefly, under pentobarbital (50 mg/kg, i.p.) anesthesia, infusion cannulas (Alza) were implanted into the third ventricle according to coordinates obtained from the atlas of Paxinos and Watson [13]. The osmotic minipumps were continuously infused at a rate 0.25 l/h until the end of the behavioral experiments. The dose and infusion period of AS and ScrAS used in this study did not produce any abnormal behavior or weight loss. Mice that were continuously
infused with filtered sterile buffered-Ringer solution by osmotic minipumps were used as a vehicle-treated control group. Seven days after the start of the infusion, the post-test was performed. Typically in the FST, the post-test is performed one day after the pre-test. However, we modified the posttest timing to coincide with the maximal inhibitory effect of AS against the targeting protein expression, which would thus be expected to demonstrate maximal behavioral changes. Briefly, similar to the pre-test, the post-test was performed by a blind researcher. IMI (4–16 mg/kg, i.p.) was administered 30 min before post-test. Doses of IMI were selected based on previous reports [1]. Psychostimulant-induced hyperlocomotion was evaluated as reported elsewhere [11,18]. Briefly, mice were received continuously with vehicle, AS or ScrAS, as described above. Seven days after the infusion, mice were individually habituated to plastic cages (30 cm × 35 cm × 17 cm) for 2 h. Then, methamphetamine (METH, 1 mg/kg, s.c.) was administered and locomotor activity was monitored for 3 h at 30-min intervals. Locomotor activity was automatically measured using electrical digital counters with infrared cell sensors placed on the walls (SCANET SV-10, Melquest Inc., Toyama, Japan) before and after giving METH. The expression of OCT3 in mice treated with vehicle, AS or ScrAS was evaluated by Western blotting using antirat OCT3 antibody (Transgenic Inc., Kumamoto, Japan), a horseradish peroxidase-labeled anti-rabbit IgG antibody (Amersham Biosciences, UK, Ltd.) and ECL plus (Amersham Biosciences, UK, Ltd.) with the quantification by NIH image program (National Institutes of Health, Bethesda, MD, USA). Unfortunately, our antibody detected several nonspecific bands. Accordingly, bands for OCT3 protein were confirmed by applying a mixture of OCT3 antibody with the peptide recognized by that antibody during the incubation period. Results are expressed as the mean ± S.E.M. Data from FST and Western blotting were analyzed by one-way analysis of variance (ANOVA). Post hoc comparison of means was performed with Scheffe’s post hoc test. Regarding data from locomotor activity, all data are expressed as mean ± S.E.M. One-way ANOVA with repeated measures was used to test for a drug-effect over time-effect on spontaneous and METHinduced locomotor activity. When ANOVA’s F ratios were significant (P < 0.05), post hoc analysis for each time-point was carried out using Scheffe’s post hoc test. All statistics reported in these experiments were generated using StatView (version 4.5, Abacus Concepts, Berkeley, CA, USA) and p-values less than 0.05 were considered statistically significant. Initially, we evaluated the effect of AS on OCT3 expression in brain. The continuous infusion of AS (0.25 Hg/0.25 l/h) for 7 days showed significant reduction of OCT3 protein in brain, compared to vehicle-treated group (p < 0.01, Fig. 1). ScrAS did not show any reduction of OCT3 protein (Fig. 1). Thus, these results suggest that the dosing
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
Fig. 1. Effects of AS and ScrAS on the expression of OCT3 in the brain of mice. Seven days after the start of continuous infusion of vehicle, AS (0.25 g/0.25 l/h) or ScrAS (0.25 g/0.25 l/h) into the third ventricle, the expression of OCT3 in brain was evaluated. OCT3 expression was assessed by Western blotting and is expressed as a percent of vehicle-treated group. Typical bands of OCT3 in corresponding groups were also represented. Data represent the mean ± S.E.M. (n = 3). a p < 0.01 vs. vehicle-treated group, b p < 0.01 vs. ScrAS-treated group (Scheffe’s post hoc test).
regimen used here is useful to evaluate the effect of AS in FST and psychostimulant-induced hyperlocomotion. Secondly, the antidepressant effect of IMI in FST was evaluated. IMI (4–16 mg/kg) dose-dependently reduced the immobility time [F(3,12) = 12.225, p < 0.01; Table 1]. Eight and 16 mg/kg of IMI revealed significant effects (Table 1). These IMI results are consistent with a previous report [1], suggesting that the difference in duration between our study (7 days) and the previous study (1 day) does not alter the effect of antidepressants. Taken together, these findings imply that the apparatus used in this study is suitable to evaluate the antidepressant-like effect of AS. Thirdly, we evaluated the effect of AS and ScrAS in FST. The continuous infusion of AS (0.075 and 0.25 g/0.25 l/h) for 7 days reduced immobility time [F(2,14) = 90.791, p < 0.01; Fig. 2A]. AS (0.25 g/0.25 l/h) showed a significant effect when compared to vehicle and ScrAS (p < 0.01). Table 1 Effect of IMI on immobility time in FST Treatment
Immobility time
Saline IMI 4 mg/kg IMI 8 mg/kg IMI 16 mg/kg
226.8 ± 6.9 218.8 ± 12.0 176.8 ± 21.0 131.0 ± 6.5 (s)*
Mice were administered IMI (4–16 mg/kg, i.p.) 30 min before FST, and FST was performed for 5 min. Data represents the mean ± S.E.M. of four animals. ∗ p < 0.01 vs. saline-treated group (Scheffe’s post hoc test).
197
ScrAS (0.25 g/l/h) did not alter immobility time, compared to vehicle (Fig. 2A). The additive/synergistic effect of AS to IMI was also evaluated. Neither IMI (4 mg/kg) nor AS (0.075 g/0.25 l/h) reduced immobility time, whereas IMI (4 mg/kg) significantly decreased immobility time in mice treated with AS (0.075 g/0.25 l/h) (Fig. 2B). Finally, psychostimulant-induced locomotor activity was evaluated. ANOVA for repeated measures revealed no significant difference in spontaneous locomotor activity between vehicle and AS [Fig. 3A, F(1,34) = 0.351, p > 0.05]. However, METH-induced locomotor activity was significantly increased, as indicated by ANOVA for repeated measures between groups [Fig. 3B, F(1,52) = 8.917, p < 0.05]. Scheffe’s post hoc test indicated significant difference between groups at 60–90 min and 90–120 min after METH injection (Fig. 3A) as well as the sum of METH-induced locomotor activity up to 3 h after METH administration (Fig. 3B). Several researchers, including our group, have hypothesized CNS effects of OCT3 [11,19]. Most recently, Schildkraut and Mooney [16] proposed that, if OCT3 adjacent to monoaminergic neuronal terminals is blocked, the effects of antidepressants would be more rapidly apparent, owing to a rapid increase in extracellular levels of monoamines. However, this issue is difficult to address due to the lack of selective ligands for OCT3. Thus, in the present studies, we used an antisense approach coupled with a behavioral paradigm. AS decreased OCT3 protein in brain and reduced immobility time in FST, whereas ScrAS did not. Our results revealed that OCT3 is likely to have a crucial role in regulating the immobility time in FST. This finding provides some of the first evidence highlighting the impact of decreased OCT3 expression in antidepressant-sensitive FST. Moreover, AS significantly increased METH-induced locomotor activity. These behavioral changes are unlikely to be due to a AS-induced increase in activity, since AS did not affect spontaneous locomotion. This is also the first evidence to indicate the potential involvement of OCT3 in the effect of psychostimulants. It has been reported the lack of apparent neural or physiological defect or imbalance of the monoamines in OCT3deficient mice [23]. Taken together, these results suggest that the neurobehavioral alteration by OCT3-knockdown is much effective in matured wild mice, not in OCT3-deficient mice, and that the lack of OCT3 in OCT3-deficient mice might be overcome by other transporters as it seen in the elevated expression of serotonin transporter (SERT) in OCT3-deficient mice [17]. Many of antidepressant drugs show their action by blocking monoamine transporters, located at neuronal terminals, including the noradrenaline transporter (NAT) and SERT [5]. The blockade of NAT and SERT by antidepressant drugs subsequently improves the clinical symptoms of depression by increasing the levels of NA and serotonin (5-HT) [5]. Similar to antidepressants that block neuronal monoamine transporters, such as NAT and SERT, OCT3 was shown to transport NA as well as 5-HT [12]. Thus, it is likely that decreased expression of OCT3 following treatment with AS
198
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
Fig. 2. (A) Effect of AS and ScrAS on FST immobility time. Seven days after the start of continuous infusion of vehicle, AS (0.075–0.25 g/0.25 l/h) or ScrAS (0.25 g/0.25 l/h) into the third ventricle, FST was performed. Data represent the mean ± S.E.M. of immobility time (n = 3–6). Number in parenthesis shows the number of animals used. a p < 0.01 vs. vehicle-treated group; b p < 0.01 vs. ScrAS-treated group (Scheffe’s post hoc test). (B) Effect of AS (0.075 g/0.25 l/h) with or without IMI (4 mg/kg, i.p.) on immobility time in FST. Seven days after the continuous infusion of vehicle or AS (0.075 g/0.25 l/h) into the third ventricle, FST was performed. IMI (4 mg/kg) was administered 30 min prior to FTS. Data represent the mean ± S.E.M. of immobility time (n = 6). Number in parenthesis shows the number of animals used. c p < 0.01 vs. vehicle-treated group (i.e. AS = 0 and IMI = 0), d p < 0.01 vs. IMI-treated group, e p < 0.01 vs. AS-treated group (Scheffe’s post hoc test).
might increase extracellular levels of NA and/or 5-HT in the vicinity of nerve terminals, subsequently affecting the immobility time in FST, as is observed after treatment with antidepressants. As mentioned above, Schildkraut and Mooney [16] hypothesized that if OCT3 adjacent to monoaminergic neuronal terminals is blocked, the effects of antidepressants would be rapidly apparent through increased extracellular levels of monoamines. Their hypothesis is partially consistent with our present finding that the effect of IMI was potentiated by an otherwise ineffective dose of AS in FST. However, present results also revealed that AS itself showed potent antidepressant-like effects, suggesting the blockade of only OCT3 might be effective for the treatment of depression.
It is well-known that a psychostimulant, METH, increases locomotor activity in rodents by stimulating monoaminergic neurotransmission [18]. In the present study, METH-induced locomotor activity was significantly increased in mice treated with AS. These results suggest that decreased expression of OCT3 might contribute to the enhancement of monoaminergic neuronal transmission, subsequently increasing locomotor activity. Moreover, the enhancement of METH-induced locomotor activity in AS-treated rats was partially consistent with our previous findings that decreased expression of OCT3 was found in rats behaviorally sensitized to METH (i.e. relatively higher METH-induced locomotor activity, compared to control) [11]. Nonetheless, further studies such as evaluating the levels of monoamines in mice treated with AS before
Fig. 3. (A) Time-course effect of AS on spontaneous and METH-induced locomotor activity in mice. Seven days after the start of continuous infusion of vehicle or AS (0.25 g/0.25 l/h) into the third ventricle, locomotor activity was assessed. Spontaneous locomotor activity was measured for 90 min prior to METH injection. METH (1 mg/kg, s.c.)-induced locomotor activity was measured for another 180 min. The arrow at 0 min indicates the administration of METH. (), vehicle-treated group (N = 5); (䊉), AS-treated group (N = 4). Data represent the mean ± S.E.M. of locomotor activity with a 30-min interval. b p < 0.05 vs. corresponding vehicle-treated group (Scheffe’s post hoc test). (B) Sum of spontaneous and METH-induced locomoter activity. Data in (A) were summed as spontaneous locomoter activity (from −120 to 0 min) and METH-induced activity (from 0 to 180 min). Data represent the mean ± S.E.M. of 4 to 5 animals. Number in parenthesis shows the number of animals used. a p < 0.01 vs. vehicle-treated group (Scheffe’s post hoc test).
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
and after METH administration are needed to understand the precise mechanisms. Previous studies have demonstrated that the infusion of AS into brain ventricles decreases the expression of target proteins in adjacent areas [8,9,20]. Consistent with this, we found decreased expression of OCT3 using Western blot analysis. However, AS did not fully eliminate OCT3 expression (approximately 30 % reduction), despite its significant behavioral effects. This raises two major questions: (1) whether a 30% knock-down of OCT3 is sufficient for behavioral consequences and/or (2) whether the data was quantitative. At this point, it is difficult to precisely answer these questions. Several reports demonstrate that antisenses can have potent effects on behaviors and/or functions related to targeted proteins, even though the inhibition of expression was relatively low [20]. Furthermore, there are some technical difficulties related to the expression of the targeted protein. For instance, i.c.v. infusion of antisense might mainly inhibit the expression of targeted protein in areas immediately adjacent to the cerebral ventricle although many studies verify expression levels in brain areas including the areas removed from the ventricles [20]. It should be noted that a recent study by King et al. [8] demonstrated that i.c.v. injection of antisense against P-glycoprotein1 (Pgp1) significantly enhanced the analgesic effect of morphine (ED50 value was five times higher than control) and decreased the transport of its substrate, morphine, from cerebral ventricle to peripheral blood circulation at more than 50%. These results expected us the significant reduction of Pgp1 at the areas adjacent to cerebral ventricle such including Pgp1-riched choroid plexus. However, Pgp1 protein and mRNA was not altered in the areas adjacent to whole cerebral ventricle except lateral ventricle, probably due to the contaminating tissues little far away from cerebral ventricle [8]. Another potential difficulty is the specificity of the antibody used. Thus far, no antibodies have been generated that specifically recognize OCT3. Indeed, our initial Western blotting experiments revealed several non-specific bands in purified brain membrane preparations using a commercially available and purportedly highly selective antibody for OCT3. However, this caveat was addressed and the OCT3 protein was confirmed with blocking peptide recognized by the antibody (data not shown). An alternate choice could be to analyze the expression of OCT3 using immunohistochemical analysis. However, previous studies using different antibodies and/or techniques have made different conclusions with respect to brain region and subcellular localization of OCT3 [3,4,15,19]. For example, Wu et al. demonstrated using in situ hybridization a strong signal for OCT3 in dendate gyrus and purkinje cells, and scarcely in sagittal brain sections throughout the cerebral cortex and the pontine nucleus [19]. However, another study using in situ hybridization by Haag et al. demonstrated OCT3 in the area postrema, but not in other brain areas [3]. Moreover, immunohistochemical studies by Vialou et al., using a specific antibody against OCT3, demonstrated strong
199
OCT3 immunoreactivity in the postrema and subfornical organ, as well as in several circumventricular organs, such as the choroid plexus, and moderately in some brain areas such as frontal cortex, substantia nigra, raphe nuclei, and locus coeruleus, as well as in pyramidal cells hippocampus and Purkinje cells of the cerebellum [19]. Studies have suggested that OCT3 might be located in circumventricular areas in order to regulate the exchange of fluid as well as OCT3 substrates including monoamines. Previous findings addressing the subcellular localization of OCT3 have also been also controversial. For example, Vialou et al. demonstrated the expression of OCT3 on neurons. In contrast, in vitro studies have shown the expression of OCT3 on astrocytes [4] and glioma cells [15], but not on neuronal cells. Considering our preliminary experiments and previous reports, we decided to to use an OCT3 antibody for Western blotting analysis, as opposed to immnohistochemical analysis. It will be important to understand the precise inhibitory effect of AS on OCT3 and further studies will be necessary to address this issue. In summary, the present results suggest that antisense knockdown of OCT3 appears to be involved in the regulation of immobility time in FST, as well as in METH-induced locomotor activity, probably by increasing monoamine levels. OCT3 may prove interesting as a novel molecular target for drug development that could be significant for the treatment of mood disorders, including depression, as well as for other diseases related to monoaminergic neuronal transmission, such as drug abuse. Acknowledgement This work was partially supported by grants from the Grant-in-aid from Nagoya University. References [1] D.J. David, C.E. Renard, P. Jolliet, M. Hascoet, M. Bourin, Antidepressant-like effects in various mice strains in the forced swimming test, Psychopharmacology 166 (2003) 373–382. [2] H. Enomoto, A. Kimura, Y. Chairoungdua, P. Shigeta, S.H. Jutabha, M. Cha, M. Hosoyamada, T. Takeda, T. Sekine, H. Igarashi, Y. Matsuo, T. Kikuchi, K. Oda, T. Ichida, K. Hosoya, T. Shimokata, Y. Niwa, H. Kanai, Endou, Molecular identification of a renal urate anion exchanger that regulates blood urate levels, Nature 417 (2002) 447–452. [3] R. Haag, D. Berkels, A. Grundemann, D. Lazar, E. Taubert, Schomig, The localisation of the extraneuronal monoamine transporter (EMT) in rat brain, J. Neurochem. 88 (2004) 291–297. [4] M. Inazu, N. Kubota, H. Takeda, J. Zhang, Y. Kiuchi, K. Oguchi, T. Matsumiya, Pharmacological characterization of dopamine transport in cultured rat astrocytes, Life Sci. 8 (1996) 2239–2245. [5] L. Iversen, Neurotransmitter transporters: fruitful targets for CNS drug discovery, Mol. Psychiatry 5 (2000) 357–362. [6] J.W. Jonker, A.H. Schinkel, Pharmacological and physiological functions of the polyspecific organic cation transporters: OCT1, 2, and 3 (SLC22A1-3), J. Pharmacol. Exp. Ther. 308 (2004) 2–9.
200
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
[7] R. Kekuda, P.D. Prasad, X. Wu, H. Wang, Y.J. Fei, F.H. Leibach, V. Ganapathy, Cloning and functional characterization of a potentialsensitive, polyspecific organic cation transporter (OCT3) most abundantly expressed in placenta, J. Biol. Chem. 273 (1998) 15971–15979. [8] M. King, W. Su, A. Chang, A. Zuckerman, G.W. Pasternak, Transport of opioids from the brain to the periphery by P-glycoprotein: peripheral actions of central drugs, Nat. Neurosci. 4 (2001) 268–274. [9] K. Kitaichi, J.G. Chabot, F.F. Moebius, A. Flandorfer, H. Glossmann, R. Quirion, Expression of the purported sigma(1) (sigma(1)) receptor in the mammalian brain and its possible relevance in deficits induced by antagonism of the NMDA receptor complex as revealed using an antisense strategy, J. Chem. Neuroanat. 20 (2000) 375–387. [10] K. Kitaichi, Y. Ito, M. Fukuda, N. Aoyama, H. Nakayama, K. Takagi, T. Hasegawa, The altered disposition of methamphetamine in the model of methamphetamine-induced neurotoxicity, Ann. N.Y. Acad. Sci. 1025 (2004) 248–256. [11] K. Kitaichi, Y. Morishita, Y. Doi, J. Ueyama, M. Matsushima, Y.L. Zhao, K. Takagi, T. Hasegawa, Increased plasma concentration and brain penetration of methamphetamine in behaviorally sensitised rats, Eur. J. Pharmacol. 20 (2000) 39–48. [12] H. Koepsell, B.M. Schmitt, V. Gorboulev, Organic cation transporters, Rev. Physiol. Biochem. Pharmacol. 150 (2003) 36–90. [13] G. Paxinos, C. Watson, The Rat Brain in Stereotaxic Coordinates, Academic press, San Diego, 1997. [14] R.D. Porsolt, M. Le Pichon, M. Jalfre, Depression: a new animal model sensitive to antidepressant treatments, Nature 266 (1977) 730–732. [15] H. Russ, K. Staust, F. Martel, M. Gliese, E. Schomig, The extraneuronal transporter for monoamine transmitters exists in cells derived from human central nervous system glia, Eur. J. Neurosci. 8 (1996) 1256–1264.
[16] J.J. Schildkraut, J.J. Mooney, Toward a rapidly acting antidepressant: the normetanephrine and extraneuronal monoamine transporter (uptake 2) hypothesis, Am. J. Psychiatry 161 (2004) 909– 911. [17] A. Schmitt, R. Mossner, A. Gossmann, I.G. Fischer, V. Gorboulev, D.L. Murphy, H. Koepsell, K.P. Lesch, Organic cation transporter capable of transporting serotonin is up-regulated in serotonin transporter-deficient mice, J. Neurosci. Res. 21 (2001) 701– 709. [18] L.J. Vanderschuren, E.D. Schmidt, T.J. De Vries, C.A. Van Moorsel, F.J. Tilders, A.N. Schoffelmeer, A single exposure to amphetamine is sufficient to induce long-term behavioral, neuroendocrine, and neurochemical sensitization in rats, J. Neurosci. 19 (1999) 9579– 9586. [19] V. Vialou, A. Amphoux, R. Zwart, B. Giros, S. Gautron, Organic cation transporter 3 (Slc22a3) is implicated in salt-intake regulation, J. Neurosci. 24 (2004) 2846–2851. [20] B. Weiss, G. Davidkova, S.P. Zhang, Antisense strategies in neurobiology, Neurochem. Int. 31 (1997) 321–348. [21] X. Wu, R. Kekuda, W. Huang, Y.J. Fei, F.H. Leibach, J. Chen, S.J. Conway, V. Ganapathy, Identity of the organic cation transporter OCT3 as the extraneuronal monoamine transporter (uptake2) and evidence for the expression of the transporter in the brain, J. Biol. Chem. 273 (1998) 32776–32786. [22] X. Wu, P.D. Prasad, F.H. Leibach, V. Ganapathy, cDNA sequence, transport function, and genomic organization of human OCTN2, a new member of the organic cation transporter family, Biochem. Biophys. Res. Commun. 246 (1998) 589–595. [23] R. Zwart, S. Verhaagh, M. Buitelaar, C. Popp-Snijders, D.P. Barlow, Impaired activity of the extraneuronal monoamine transporter system known as uptake-2 in Orct3/Slc22a3-deficient mice, Mol. Cell. Biol. 21 (2001) 4188–4196.
Behavioral changes following antisense oligonucleotide-induced reduction of organic cation transporter-3 in mice Kiyoyuki Kitaichi ∗ , Masaya Fukuda, Hironao Nakayama, Nagisa Aoyama, Yukiko Ito, Yohei Fujimoto, Kenji Takagi, Kenzo Takagi, Takaaki Hasegawa a Department
of Medical Technology, Nagoya University School of Health Sciences, 1-1-20, Daikominami, Higashi-ku, Nagoya 461-8673, Japan Received 7 December 2004; received in revised form 4 March 2005; accepted 7 March 2005
Abstract The organic cation transporter-3 (OCT3) can transport monoamines, similar to neuronal monoamine transporters. Due to the lack of selective ligands, however, the functional role of OCT3 is still unknown. Thus, we investigated behavioral effects of antisense against OCT3 (AS) in mice. AS (0.075-0.25 g/0.25 l/h, for 7 days) dose-dependently decreased immobility time. Moreover, although neither AS (0.075 g/0.25 l/h, for 7 days) or imipramine (4 mg/kg, i.p.) were effective, imipramine (4 mg/kg, i.p.) significantly decreased immobility time in mice treated with AS (0.075 g/0.25 l/h, for 7 days). Additionally, AS (0.25 g/0.25 l/h, for 7 days) significantly increased locomotor activity induced by methamphetamine (1 mg/kg, s.c.), but did not affect spontaneous locomotor activity. These results suggest that OCT3 might become a novel molecular target to treat depression and other diseases related to monoaminergic neuronal systems. © 2005 Elsevier Ireland Ltd. All rights reserved. Keywords: Antidepressants; Organic cation transporter-3; Forced swimming test; Mice
There are currently 12 known members of the solute carrier 22 (SLC22) family in humans and rats. These encompass the organic cation transporters (OCTs), the carnitine transporter (OCTN2/SLC22A5) [22], the urate anion-exchanger (URAT1/SLC22A12) [2] as well as several organic anion transporters [6,12]. Among SLC22 family members, OCTs are unique in there ability to transport monoamines [12]. Recently, several groups have identified OCTs in the brain [12]. Thus, it is of interest to investigate the effect of OCTs in central nervous system (CNS). Due to the lack of selective ligands, however, there are only a few reports that have demonstrated CNS effects of OCTs to date [11,19]. Among OCTs, OCT3 is a likely candidate for CNS effects since OCT3 was expressed in brain [3,7,19] and showed to have a functional role in the CNS [11,19]. For example, the function of OCT3 in CNS was evaluated by Vialou et Abbreviations: OCT3, organic cation transporter-3; AS, antisense against OCT3; FST, forced swimming test; IMI, imipramine ∗ Corresponding author. Tel.: +81 52 719 1341; fax: +81 52 719 3009. E-mail address: [email protected] (K. Kitaichi). 0304-3940/$ – see front matter © 2005 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.neulet.2005.03.014
al. [19], who showed differential regulation of salt intake in OCT3-knockout mice. Moreover, we have demonstrated that repeated exposure to a psychostimulant, methamphetamine, alters the expression of OCT3 in brain [10,11]. Additionally, considering the crucial role of OCT3 on the clearance of noradrenaline (NA) at sympathetic nerve terminals [12], a role for OCT3 on CNS neurotransmission has also been proposed [11]. However, the neurobehavioral effects of OCT3 have not been fully evaluated. In the present studies, we used antisense against OCT3 to evaluate the role of OCT3 in CNS. Considering that OCT3 can transport monoamines [7,21], two typical monoaminergic behavioral tasks, the forced swimming test (FST) and psychostimulant-induced hyperlocomotion, were selected. Our data using antisense against OCT3 suggest that OCT3 is an important regulator of these behaviors. Male ddY mice weighing 28–33 g from Japan SLC Inc. (Hamamatsu, Japan) were used. The animals were maintained in a temperature- and humidity-regulated room (22–24 ◦ C and 55 ± 5%, respectively) with food and water ad libitum under controlled lighting (lights on:
196
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
08:00–20:00 h) for at least 3 days before the experiment. 21-mer phosphorothioate-modified antisense oligodeoxynucleotides against OCT3 (AS) were designed from the cDNA sequences of OCT3 (nucleotides −3 to +18, GenBank Database accession NM 019230) targeting the area spanning the initiation codon (5 TGGTCGAACGTGGGCATGGTG 3 ). Phosphorothioate-modified oligodeoxynucleotides having the same proportion of DNA bases as AS but in a scrambled order (5 TAGTCGGAGGTGAGCGGCGTT 3 , ScrAS) were also prepared as controls. The selected sequences have little or no homology to other known cDNA sequences registered in the GenBank Database (NIH, Bethesda, MD). AS and ScrAS were synthesized, purified and lyophilized by Sigma-Aldrich Japan K.K. Genosys Division (Ishikari, Hokkaido, Japan). Both oligodeoxynucleotides were dissolved in filtered sterile buffered-Ringer solution (140 mM NaCl, 3.0 mM KCl, 1.5 mM NaH2 PO4 , 1.2 mM MgCl2 , 1.2 mM CaCl2 , pH 7.4. Imipramine (IMI) was purchased from Sigma-Alldrich Co. (St. Louis, MO, USA) and was administered 30 min before the post-test. Control animals received only saline. Drugs were dissolved in saline and injected in a volume of 0.1 ml/10 g of body weight. All behavioral tasks were conducted between 11:00 and 19:00 in a temperature-controlled room (22–24 ◦ C) after habituation to the test room for over 2 h. The forced swimming test in mice (FST) [14], with some modification, was used to evaluate potential antidepressant effects of AS, ScrAS and/or IMI. Glass cylinders (height 17 cm, diameter 15.5 cm) containing water 12 cm deep at 25 ◦ C were used for FST. The water was changed between testing individual animals to avoid methodological artifacts like the existence of pheromones or other products excreted by mice. FST consist of two tests: the pre- and post-tests. In pre-test, mice without any drug treatment were placed individually in the cylinders and left there for 5 min. A mouse was judged to be immobile when it remained floating in the water and made only the movements necessary to keep its head above the surface. The total duration of immobility during the test was evaluated. After the pre-test, animals were divided into groups by adjusting the mean ± S.E. of immobility time in the pre-test to the same values between groups. Mice having longer or shorter immobility time than the average time (over 60-s difference from the average time) was removed since they show much different immobility time in post-test from others (data not shown). One day after the pre-test, osmotic minipumps (model 1002, Alza, Palo Alto, CA) containing AS or ScrAS were implanted for infusion into the third ventricle, as described elsewhere [9]. Briefly, under pentobarbital (50 mg/kg, i.p.) anesthesia, infusion cannulas (Alza) were implanted into the third ventricle according to coordinates obtained from the atlas of Paxinos and Watson [13]. The osmotic minipumps were continuously infused at a rate 0.25 l/h until the end of the behavioral experiments. The dose and infusion period of AS and ScrAS used in this study did not produce any abnormal behavior or weight loss. Mice that were continuously
infused with filtered sterile buffered-Ringer solution by osmotic minipumps were used as a vehicle-treated control group. Seven days after the start of the infusion, the post-test was performed. Typically in the FST, the post-test is performed one day after the pre-test. However, we modified the posttest timing to coincide with the maximal inhibitory effect of AS against the targeting protein expression, which would thus be expected to demonstrate maximal behavioral changes. Briefly, similar to the pre-test, the post-test was performed by a blind researcher. IMI (4–16 mg/kg, i.p.) was administered 30 min before post-test. Doses of IMI were selected based on previous reports [1]. Psychostimulant-induced hyperlocomotion was evaluated as reported elsewhere [11,18]. Briefly, mice were received continuously with vehicle, AS or ScrAS, as described above. Seven days after the infusion, mice were individually habituated to plastic cages (30 cm × 35 cm × 17 cm) for 2 h. Then, methamphetamine (METH, 1 mg/kg, s.c.) was administered and locomotor activity was monitored for 3 h at 30-min intervals. Locomotor activity was automatically measured using electrical digital counters with infrared cell sensors placed on the walls (SCANET SV-10, Melquest Inc., Toyama, Japan) before and after giving METH. The expression of OCT3 in mice treated with vehicle, AS or ScrAS was evaluated by Western blotting using antirat OCT3 antibody (Transgenic Inc., Kumamoto, Japan), a horseradish peroxidase-labeled anti-rabbit IgG antibody (Amersham Biosciences, UK, Ltd.) and ECL plus (Amersham Biosciences, UK, Ltd.) with the quantification by NIH image program (National Institutes of Health, Bethesda, MD, USA). Unfortunately, our antibody detected several nonspecific bands. Accordingly, bands for OCT3 protein were confirmed by applying a mixture of OCT3 antibody with the peptide recognized by that antibody during the incubation period. Results are expressed as the mean ± S.E.M. Data from FST and Western blotting were analyzed by one-way analysis of variance (ANOVA). Post hoc comparison of means was performed with Scheffe’s post hoc test. Regarding data from locomotor activity, all data are expressed as mean ± S.E.M. One-way ANOVA with repeated measures was used to test for a drug-effect over time-effect on spontaneous and METHinduced locomotor activity. When ANOVA’s F ratios were significant (P < 0.05), post hoc analysis for each time-point was carried out using Scheffe’s post hoc test. All statistics reported in these experiments were generated using StatView (version 4.5, Abacus Concepts, Berkeley, CA, USA) and p-values less than 0.05 were considered statistically significant. Initially, we evaluated the effect of AS on OCT3 expression in brain. The continuous infusion of AS (0.25 Hg/0.25 l/h) for 7 days showed significant reduction of OCT3 protein in brain, compared to vehicle-treated group (p < 0.01, Fig. 1). ScrAS did not show any reduction of OCT3 protein (Fig. 1). Thus, these results suggest that the dosing
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
Fig. 1. Effects of AS and ScrAS on the expression of OCT3 in the brain of mice. Seven days after the start of continuous infusion of vehicle, AS (0.25 g/0.25 l/h) or ScrAS (0.25 g/0.25 l/h) into the third ventricle, the expression of OCT3 in brain was evaluated. OCT3 expression was assessed by Western blotting and is expressed as a percent of vehicle-treated group. Typical bands of OCT3 in corresponding groups were also represented. Data represent the mean ± S.E.M. (n = 3). a p < 0.01 vs. vehicle-treated group, b p < 0.01 vs. ScrAS-treated group (Scheffe’s post hoc test).
regimen used here is useful to evaluate the effect of AS in FST and psychostimulant-induced hyperlocomotion. Secondly, the antidepressant effect of IMI in FST was evaluated. IMI (4–16 mg/kg) dose-dependently reduced the immobility time [F(3,12) = 12.225, p < 0.01; Table 1]. Eight and 16 mg/kg of IMI revealed significant effects (Table 1). These IMI results are consistent with a previous report [1], suggesting that the difference in duration between our study (7 days) and the previous study (1 day) does not alter the effect of antidepressants. Taken together, these findings imply that the apparatus used in this study is suitable to evaluate the antidepressant-like effect of AS. Thirdly, we evaluated the effect of AS and ScrAS in FST. The continuous infusion of AS (0.075 and 0.25 g/0.25 l/h) for 7 days reduced immobility time [F(2,14) = 90.791, p < 0.01; Fig. 2A]. AS (0.25 g/0.25 l/h) showed a significant effect when compared to vehicle and ScrAS (p < 0.01). Table 1 Effect of IMI on immobility time in FST Treatment
Immobility time
Saline IMI 4 mg/kg IMI 8 mg/kg IMI 16 mg/kg
226.8 ± 6.9 218.8 ± 12.0 176.8 ± 21.0 131.0 ± 6.5 (s)*
Mice were administered IMI (4–16 mg/kg, i.p.) 30 min before FST, and FST was performed for 5 min. Data represents the mean ± S.E.M. of four animals. ∗ p < 0.01 vs. saline-treated group (Scheffe’s post hoc test).
197
ScrAS (0.25 g/l/h) did not alter immobility time, compared to vehicle (Fig. 2A). The additive/synergistic effect of AS to IMI was also evaluated. Neither IMI (4 mg/kg) nor AS (0.075 g/0.25 l/h) reduced immobility time, whereas IMI (4 mg/kg) significantly decreased immobility time in mice treated with AS (0.075 g/0.25 l/h) (Fig. 2B). Finally, psychostimulant-induced locomotor activity was evaluated. ANOVA for repeated measures revealed no significant difference in spontaneous locomotor activity between vehicle and AS [Fig. 3A, F(1,34) = 0.351, p > 0.05]. However, METH-induced locomotor activity was significantly increased, as indicated by ANOVA for repeated measures between groups [Fig. 3B, F(1,52) = 8.917, p < 0.05]. Scheffe’s post hoc test indicated significant difference between groups at 60–90 min and 90–120 min after METH injection (Fig. 3A) as well as the sum of METH-induced locomotor activity up to 3 h after METH administration (Fig. 3B). Several researchers, including our group, have hypothesized CNS effects of OCT3 [11,19]. Most recently, Schildkraut and Mooney [16] proposed that, if OCT3 adjacent to monoaminergic neuronal terminals is blocked, the effects of antidepressants would be more rapidly apparent, owing to a rapid increase in extracellular levels of monoamines. However, this issue is difficult to address due to the lack of selective ligands for OCT3. Thus, in the present studies, we used an antisense approach coupled with a behavioral paradigm. AS decreased OCT3 protein in brain and reduced immobility time in FST, whereas ScrAS did not. Our results revealed that OCT3 is likely to have a crucial role in regulating the immobility time in FST. This finding provides some of the first evidence highlighting the impact of decreased OCT3 expression in antidepressant-sensitive FST. Moreover, AS significantly increased METH-induced locomotor activity. These behavioral changes are unlikely to be due to a AS-induced increase in activity, since AS did not affect spontaneous locomotion. This is also the first evidence to indicate the potential involvement of OCT3 in the effect of psychostimulants. It has been reported the lack of apparent neural or physiological defect or imbalance of the monoamines in OCT3deficient mice [23]. Taken together, these results suggest that the neurobehavioral alteration by OCT3-knockdown is much effective in matured wild mice, not in OCT3-deficient mice, and that the lack of OCT3 in OCT3-deficient mice might be overcome by other transporters as it seen in the elevated expression of serotonin transporter (SERT) in OCT3-deficient mice [17]. Many of antidepressant drugs show their action by blocking monoamine transporters, located at neuronal terminals, including the noradrenaline transporter (NAT) and SERT [5]. The blockade of NAT and SERT by antidepressant drugs subsequently improves the clinical symptoms of depression by increasing the levels of NA and serotonin (5-HT) [5]. Similar to antidepressants that block neuronal monoamine transporters, such as NAT and SERT, OCT3 was shown to transport NA as well as 5-HT [12]. Thus, it is likely that decreased expression of OCT3 following treatment with AS
198
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
Fig. 2. (A) Effect of AS and ScrAS on FST immobility time. Seven days after the start of continuous infusion of vehicle, AS (0.075–0.25 g/0.25 l/h) or ScrAS (0.25 g/0.25 l/h) into the third ventricle, FST was performed. Data represent the mean ± S.E.M. of immobility time (n = 3–6). Number in parenthesis shows the number of animals used. a p < 0.01 vs. vehicle-treated group; b p < 0.01 vs. ScrAS-treated group (Scheffe’s post hoc test). (B) Effect of AS (0.075 g/0.25 l/h) with or without IMI (4 mg/kg, i.p.) on immobility time in FST. Seven days after the continuous infusion of vehicle or AS (0.075 g/0.25 l/h) into the third ventricle, FST was performed. IMI (4 mg/kg) was administered 30 min prior to FTS. Data represent the mean ± S.E.M. of immobility time (n = 6). Number in parenthesis shows the number of animals used. c p < 0.01 vs. vehicle-treated group (i.e. AS = 0 and IMI = 0), d p < 0.01 vs. IMI-treated group, e p < 0.01 vs. AS-treated group (Scheffe’s post hoc test).
might increase extracellular levels of NA and/or 5-HT in the vicinity of nerve terminals, subsequently affecting the immobility time in FST, as is observed after treatment with antidepressants. As mentioned above, Schildkraut and Mooney [16] hypothesized that if OCT3 adjacent to monoaminergic neuronal terminals is blocked, the effects of antidepressants would be rapidly apparent through increased extracellular levels of monoamines. Their hypothesis is partially consistent with our present finding that the effect of IMI was potentiated by an otherwise ineffective dose of AS in FST. However, present results also revealed that AS itself showed potent antidepressant-like effects, suggesting the blockade of only OCT3 might be effective for the treatment of depression.
It is well-known that a psychostimulant, METH, increases locomotor activity in rodents by stimulating monoaminergic neurotransmission [18]. In the present study, METH-induced locomotor activity was significantly increased in mice treated with AS. These results suggest that decreased expression of OCT3 might contribute to the enhancement of monoaminergic neuronal transmission, subsequently increasing locomotor activity. Moreover, the enhancement of METH-induced locomotor activity in AS-treated rats was partially consistent with our previous findings that decreased expression of OCT3 was found in rats behaviorally sensitized to METH (i.e. relatively higher METH-induced locomotor activity, compared to control) [11]. Nonetheless, further studies such as evaluating the levels of monoamines in mice treated with AS before
Fig. 3. (A) Time-course effect of AS on spontaneous and METH-induced locomotor activity in mice. Seven days after the start of continuous infusion of vehicle or AS (0.25 g/0.25 l/h) into the third ventricle, locomotor activity was assessed. Spontaneous locomotor activity was measured for 90 min prior to METH injection. METH (1 mg/kg, s.c.)-induced locomotor activity was measured for another 180 min. The arrow at 0 min indicates the administration of METH. (), vehicle-treated group (N = 5); (䊉), AS-treated group (N = 4). Data represent the mean ± S.E.M. of locomotor activity with a 30-min interval. b p < 0.05 vs. corresponding vehicle-treated group (Scheffe’s post hoc test). (B) Sum of spontaneous and METH-induced locomoter activity. Data in (A) were summed as spontaneous locomoter activity (from −120 to 0 min) and METH-induced activity (from 0 to 180 min). Data represent the mean ± S.E.M. of 4 to 5 animals. Number in parenthesis shows the number of animals used. a p < 0.01 vs. vehicle-treated group (Scheffe’s post hoc test).
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
and after METH administration are needed to understand the precise mechanisms. Previous studies have demonstrated that the infusion of AS into brain ventricles decreases the expression of target proteins in adjacent areas [8,9,20]. Consistent with this, we found decreased expression of OCT3 using Western blot analysis. However, AS did not fully eliminate OCT3 expression (approximately 30 % reduction), despite its significant behavioral effects. This raises two major questions: (1) whether a 30% knock-down of OCT3 is sufficient for behavioral consequences and/or (2) whether the data was quantitative. At this point, it is difficult to precisely answer these questions. Several reports demonstrate that antisenses can have potent effects on behaviors and/or functions related to targeted proteins, even though the inhibition of expression was relatively low [20]. Furthermore, there are some technical difficulties related to the expression of the targeted protein. For instance, i.c.v. infusion of antisense might mainly inhibit the expression of targeted protein in areas immediately adjacent to the cerebral ventricle although many studies verify expression levels in brain areas including the areas removed from the ventricles [20]. It should be noted that a recent study by King et al. [8] demonstrated that i.c.v. injection of antisense against P-glycoprotein1 (Pgp1) significantly enhanced the analgesic effect of morphine (ED50 value was five times higher than control) and decreased the transport of its substrate, morphine, from cerebral ventricle to peripheral blood circulation at more than 50%. These results expected us the significant reduction of Pgp1 at the areas adjacent to cerebral ventricle such including Pgp1-riched choroid plexus. However, Pgp1 protein and mRNA was not altered in the areas adjacent to whole cerebral ventricle except lateral ventricle, probably due to the contaminating tissues little far away from cerebral ventricle [8]. Another potential difficulty is the specificity of the antibody used. Thus far, no antibodies have been generated that specifically recognize OCT3. Indeed, our initial Western blotting experiments revealed several non-specific bands in purified brain membrane preparations using a commercially available and purportedly highly selective antibody for OCT3. However, this caveat was addressed and the OCT3 protein was confirmed with blocking peptide recognized by the antibody (data not shown). An alternate choice could be to analyze the expression of OCT3 using immunohistochemical analysis. However, previous studies using different antibodies and/or techniques have made different conclusions with respect to brain region and subcellular localization of OCT3 [3,4,15,19]. For example, Wu et al. demonstrated using in situ hybridization a strong signal for OCT3 in dendate gyrus and purkinje cells, and scarcely in sagittal brain sections throughout the cerebral cortex and the pontine nucleus [19]. However, another study using in situ hybridization by Haag et al. demonstrated OCT3 in the area postrema, but not in other brain areas [3]. Moreover, immunohistochemical studies by Vialou et al., using a specific antibody against OCT3, demonstrated strong
199
OCT3 immunoreactivity in the postrema and subfornical organ, as well as in several circumventricular organs, such as the choroid plexus, and moderately in some brain areas such as frontal cortex, substantia nigra, raphe nuclei, and locus coeruleus, as well as in pyramidal cells hippocampus and Purkinje cells of the cerebellum [19]. Studies have suggested that OCT3 might be located in circumventricular areas in order to regulate the exchange of fluid as well as OCT3 substrates including monoamines. Previous findings addressing the subcellular localization of OCT3 have also been also controversial. For example, Vialou et al. demonstrated the expression of OCT3 on neurons. In contrast, in vitro studies have shown the expression of OCT3 on astrocytes [4] and glioma cells [15], but not on neuronal cells. Considering our preliminary experiments and previous reports, we decided to to use an OCT3 antibody for Western blotting analysis, as opposed to immnohistochemical analysis. It will be important to understand the precise inhibitory effect of AS on OCT3 and further studies will be necessary to address this issue. In summary, the present results suggest that antisense knockdown of OCT3 appears to be involved in the regulation of immobility time in FST, as well as in METH-induced locomotor activity, probably by increasing monoamine levels. OCT3 may prove interesting as a novel molecular target for drug development that could be significant for the treatment of mood disorders, including depression, as well as for other diseases related to monoaminergic neuronal transmission, such as drug abuse. Acknowledgement This work was partially supported by grants from the Grant-in-aid from Nagoya University. References [1] D.J. David, C.E. Renard, P. Jolliet, M. Hascoet, M. Bourin, Antidepressant-like effects in various mice strains in the forced swimming test, Psychopharmacology 166 (2003) 373–382. [2] H. Enomoto, A. Kimura, Y. Chairoungdua, P. Shigeta, S.H. Jutabha, M. Cha, M. Hosoyamada, T. Takeda, T. Sekine, H. Igarashi, Y. Matsuo, T. Kikuchi, K. Oda, T. Ichida, K. Hosoya, T. Shimokata, Y. Niwa, H. Kanai, Endou, Molecular identification of a renal urate anion exchanger that regulates blood urate levels, Nature 417 (2002) 447–452. [3] R. Haag, D. Berkels, A. Grundemann, D. Lazar, E. Taubert, Schomig, The localisation of the extraneuronal monoamine transporter (EMT) in rat brain, J. Neurochem. 88 (2004) 291–297. [4] M. Inazu, N. Kubota, H. Takeda, J. Zhang, Y. Kiuchi, K. Oguchi, T. Matsumiya, Pharmacological characterization of dopamine transport in cultured rat astrocytes, Life Sci. 8 (1996) 2239–2245. [5] L. Iversen, Neurotransmitter transporters: fruitful targets for CNS drug discovery, Mol. Psychiatry 5 (2000) 357–362. [6] J.W. Jonker, A.H. Schinkel, Pharmacological and physiological functions of the polyspecific organic cation transporters: OCT1, 2, and 3 (SLC22A1-3), J. Pharmacol. Exp. Ther. 308 (2004) 2–9.
200
K. Kitaichi et al. / Neuroscience Letters 382 (2005) 195–200
[7] R. Kekuda, P.D. Prasad, X. Wu, H. Wang, Y.J. Fei, F.H. Leibach, V. Ganapathy, Cloning and functional characterization of a potentialsensitive, polyspecific organic cation transporter (OCT3) most abundantly expressed in placenta, J. Biol. Chem. 273 (1998) 15971–15979. [8] M. King, W. Su, A. Chang, A. Zuckerman, G.W. Pasternak, Transport of opioids from the brain to the periphery by P-glycoprotein: peripheral actions of central drugs, Nat. Neurosci. 4 (2001) 268–274. [9] K. Kitaichi, J.G. Chabot, F.F. Moebius, A. Flandorfer, H. Glossmann, R. Quirion, Expression of the purported sigma(1) (sigma(1)) receptor in the mammalian brain and its possible relevance in deficits induced by antagonism of the NMDA receptor complex as revealed using an antisense strategy, J. Chem. Neuroanat. 20 (2000) 375–387. [10] K. Kitaichi, Y. Ito, M. Fukuda, N. Aoyama, H. Nakayama, K. Takagi, T. Hasegawa, The altered disposition of methamphetamine in the model of methamphetamine-induced neurotoxicity, Ann. N.Y. Acad. Sci. 1025 (2004) 248–256. [11] K. Kitaichi, Y. Morishita, Y. Doi, J. Ueyama, M. Matsushima, Y.L. Zhao, K. Takagi, T. Hasegawa, Increased plasma concentration and brain penetration of methamphetamine in behaviorally sensitised rats, Eur. J. Pharmacol. 20 (2000) 39–48. [12] H. Koepsell, B.M. Schmitt, V. Gorboulev, Organic cation transporters, Rev. Physiol. Biochem. Pharmacol. 150 (2003) 36–90. [13] G. Paxinos, C. Watson, The Rat Brain in Stereotaxic Coordinates, Academic press, San Diego, 1997. [14] R.D. Porsolt, M. Le Pichon, M. Jalfre, Depression: a new animal model sensitive to antidepressant treatments, Nature 266 (1977) 730–732. [15] H. Russ, K. Staust, F. Martel, M. Gliese, E. Schomig, The extraneuronal transporter for monoamine transmitters exists in cells derived from human central nervous system glia, Eur. J. Neurosci. 8 (1996) 1256–1264.
[16] J.J. Schildkraut, J.J. Mooney, Toward a rapidly acting antidepressant: the normetanephrine and extraneuronal monoamine transporter (uptake 2) hypothesis, Am. J. Psychiatry 161 (2004) 909– 911. [17] A. Schmitt, R. Mossner, A. Gossmann, I.G. Fischer, V. Gorboulev, D.L. Murphy, H. Koepsell, K.P. Lesch, Organic cation transporter capable of transporting serotonin is up-regulated in serotonin transporter-deficient mice, J. Neurosci. Res. 21 (2001) 701– 709. [18] L.J. Vanderschuren, E.D. Schmidt, T.J. De Vries, C.A. Van Moorsel, F.J. Tilders, A.N. Schoffelmeer, A single exposure to amphetamine is sufficient to induce long-term behavioral, neuroendocrine, and neurochemical sensitization in rats, J. Neurosci. 19 (1999) 9579– 9586. [19] V. Vialou, A. Amphoux, R. Zwart, B. Giros, S. Gautron, Organic cation transporter 3 (Slc22a3) is implicated in salt-intake regulation, J. Neurosci. 24 (2004) 2846–2851. [20] B. Weiss, G. Davidkova, S.P. Zhang, Antisense strategies in neurobiology, Neurochem. Int. 31 (1997) 321–348. [21] X. Wu, R. Kekuda, W. Huang, Y.J. Fei, F.H. Leibach, J. Chen, S.J. Conway, V. Ganapathy, Identity of the organic cation transporter OCT3 as the extraneuronal monoamine transporter (uptake2) and evidence for the expression of the transporter in the brain, J. Biol. Chem. 273 (1998) 32776–32786. [22] X. Wu, P.D. Prasad, F.H. Leibach, V. Ganapathy, cDNA sequence, transport function, and genomic organization of human OCTN2, a new member of the organic cation transporter family, Biochem. Biophys. Res. Commun. 246 (1998) 589–595. [23] R. Zwart, S. Verhaagh, M. Buitelaar, C. Popp-Snijders, D.P. Barlow, Impaired activity of the extraneuronal monoamine transporter system known as uptake-2 in Orct3/Slc22a3-deficient mice, Mol. Cell. Biol. 21 (2001) 4188–4196.