Benzimidazole resistance in equine cyathostomins in India

Veterinary Parasitology 218 (2016) 93–97

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Benzimidazole resistance in equine cyathostomins in India Sunil Kumar, Rajat Garg ∗ , Saroj Kumar, P.S. Banerjee, Hira Ram, A. Prasad Division of Parasitology, ICAR-Indian Veterinary Research Institute, Izatnagar 243 122, Uttar Pradesh, India

a r t i c l e

i n f o

Article history: Received 25 June 2015 Received in revised form 13 January 2016 Accepted 16 January 2016 Keywords: Benzimidazole resistance Cyathostomins Horses India

a b s t r a c t Benzimidazole resistance is a major hindrance to the control of equine cyathostominosis throughout the world. There is a paucity of knowledge on the level of benzimidazole resistance in small strongyles of horses in India. In the present study, allele-specific PCR (AS-PCR) that detects F200Y mutation of the isotype 1 ␤-tubulin gene and faecal egg count reduction test (FECRT) were used for detecting benzimidazole resistance in equine cyathostomin populations in different agro-climatic zones of Uttar Pradesh, India. Results of the FECRT revealed prevalence of benzimidazole resistance in cyathostomins in an intensively managed equine farm in the mid-western plain (FECR = 27.5%, LCI = 0) and in working horses (extensively managed) at three locations in central plains of Uttar Pradesh (FECR = 75.7–83.6%, LCI = 29–57%). Post-treatment larval cultures revealed the presence of exclusively cyathostomin larvae. Genotyping of cyathostomin larvae by AS-PCR revealed that the frequency of homozygous resistant (rr) individuals and the resistant allele frequency was significantly higher (p < 0.001) in the intensively managed farm in the mid-western plain and in working horses at two locations in central plains of the state. The resistant allele (r) frequency in cyathostomins was significantly higher (p < 0.05) in Vindhyan and Tarai and Bhabar zones of Uttar Pradesh. The prevalence of benzimidazole resistant allele (r) was significantly higher (p < 0.05) in cyathostomins of intensively managed horses (allelic frequency—0.35) as compared to extensively managed horses (allelic frequency—0.22). The widespread prevalence of benzimidazole resistant alleles in equine cyathostomins in Uttar Pradesh, India, necessitates immediate replacement of the drugs of benzimidazole group with other unrelated effective anthelmintics for management and control of equine cyathostomins. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Equine strongylosis, caused by large strongyles (sub-family Strongylinae) and small strongyles (sub-family Cyathostominae), is ubiquitous in grazing horses throughout the world. Virtually every horse can be expected to be infected with these parasites, which often account for a parasitic load up to 100% in grazing horses (Kaplan et al., 2004). Cyathostomins are usually considered as less pathogenic as compared to large strongyles, especially Strongylus vulgaris, but they are the major cause of health problems in equines (Herd, 1990) as mass emergence of encysted larvae of small strongyles is known to cause larval cyathostominosis, which has a case fatality rate of around 50% (Love et al., 1999). In India, equine strongylosis is currently controlled by chemotherapy with three groups of broad spectrum anthelmintics viz., benzimidazoles, tetrahydropyrimidines and macrocyclic lactones. Of these, benzimidazoles are in use for more than the last four decades (Yadav

∗ Corresponding author. E-mail address: rajatgarg [email protected] (R. Garg). http://dx.doi.org/10.1016/j.vetpar.2016.01.016 0304-4017/© 2016 Elsevier B.V. All rights reserved.

et al., 1984; Bagherwal et al., 1989; Banerjee et al., 2002; Singh et al., 2002a,b; Khajuria et al., 2006; Sharma et al., 2011a; Singh et al., 2012). However, frequent treatment, under-dosing, high stocking rates, high pasture contamination with infective larvae, shorter prepatent period of these parasites and shrinkage in grazing lands due to massive industrialization have contributed to rapid emergence of benzimidazole resistant strains of gastrointestinal nematodes in India (Yadav and Garg, 2005). Benzimidazole resistance in cyathostomes was first reported by Drudge and Lyons (1965). Since then, benzimidazole resistant cyathostomes have been recorded around the world (Peregrine et al., 2014). Apart from two reports of benzimidazole resistance in cyathostomes from India (Pal, 2002; Kumar and Vatsya, 2014), there are no reports from Asia. The commonly used methods for detection of benzimidazole resistance in equine strongyles include, faecal egg count reduction test (FECRT, in vivo), egg hatch assay (EHA, in vitro) and micro agar larval development test (MALDT, in vitro). A common limitation of these tests is their relatively low sensitivity, as they detect resistance only when more than 25% of the worm population is resistant to benzimidazoles (Martin et al., 1989). Recently,

94

S. Kumar et al. / Veterinary Parasitology 218 (2016) 93–97

the molecular mechanism that confers benzimidazole resistance in ruminant trichostrongylids as well as in equine cyathostomins involving a phenylalanine (TTC) to tyrosine (TAC) mutation at codon 200 of the isotype 1 ␤-tubulin gene (F200Y) has been identified (Kwa et al., 1994; Elard et al., 1996; Pape et al., 1999, 2003; von Samson-Himmelstjerna et al., 2001, 2002b). A similar mutation at codon 167 (F167Y) is also involved in BZ resistance in nematodes including cyathostomes (Prichard, 2001; Pape et al., 2003). This F167Y mutation may be found in the absence of F200Y mutation, but has been observed to occur rarely in the field (Silvestre and Carbaret, 2002; Hodjkinson et al., 2008). However, F167Y mutation has never been reported from either ruminant trichostrongylids or equine cyathostomins from India. This knowledge of the molecular basis of benzimidazole resistance has allowed development of molecular tools for early and rapid detection of benzimidazole resistance in equine cyathostomins viz. allele-specific PCR (ASPCR) and real time PCR for detecting F200Y polymorphisms (von Samson-Himmelstjerna et al., 2002a, 2003), and pyrosequencing assays for detecting F167Y polymorphism (Lake et al., 2009). The greatest advantage of these tools is that the emergence of a first mutant individual can be detected in a worm population (Elard et al., 1998). Keeping in mind the potential threat posed by widespread emergence of benzimidazole resistance in small strongyles of equines throughout the world, and paucity of information on the level of benzimidazole resistance in equine strongyles in India, the present investigation was planned to investigate the status of benzimidazole resistance in cyathostomins of horses reared under different management systems in different agro climatic zones of Uttar Pradesh, India using FECRT and AS-PCR that detects F200Y mutation. 2. Materials and method 2.1. Study area The study area, Uttar Pradesh, is a north Indian state located between 23◦ 52 N and 31◦ 28 N latitudes and 77◦ 3 E and 84◦ 39 E longitudes. According to the 19th Livestock Census of India, Uttar Pradesh has the largest population of equids (DAHDF, 2014). The state has a humid subtropical climate with average temperatures varying from 8.5–21.9 ◦ C in winter (December and January) to 25.5–45.0 ◦ C in summer (May and June). Rainfall in the area ranges from 600 to 2000 mm from July to September with an average of 1072 mm. The humidity reaches more than 90% during the rainy season (July and August). The study on the prevalence of benzimidazole resistance was carried out on horses reared under intensive management system at government/private farms where the horses are raised in a confined area with a defined pasture and regularly dewormed with anthelmintics (3–4 times/year) as well as on working horses reared under extensive management system (nomadic herding) where anthelmintics are administered to the horses occasionally as detailed in Table 1 using FECRT and/or AS-PCR. 2.2. Faecal egg count reduction test FECR tests were carried out on horses during April–October, 2014 at 9 different locations as described in Table 1. Faecal samples were collected directly from the rectum of individual adult horses (4–8 years of age), in properly labelled polythene bags and transported on ice to the laboratory for estimation of eggs per gram of faeces (epg) by a modified McMaster technique with a sensitivity of 15 epg (MAFF, 1986). While collecting the faecal samples from horses, the history and frequency of anthelmintic use on the farm

was also recorded. The horses having an epg of more than 150 were selected for FECRT. The weight of a horse was estimated according to the method described by Carroll and Huntington (1988). On day zero, horses were treated with fenbendazole (Panacur, Intervet, India Pvt., Ltd., Pune) at the dose rate of 10 mg/kg body weight orally. Rectal faecal samples were again collected 14 days post-treatment (14 DPT) from treated horses and again epg was estimated. The arithmetic mean, percent reduction and lower 95% confidence interval (LCI) were calculated as described by Coles et al. (1992, 2006). Benzimidazole resistance was considered present if (a) the percent FECR was less than 90% and (b) the LCI was less than 80%. If only one of the two criteria was met, the resistance was suspected (Lester et al., 2013). Pooled faecal samples of horses from different locations were cultured on day 0 and 14 DPT for collection of third stage strongyle larvae and subsequent species-specific identification (MAFF, 1986). 2.3. Allele specific PCR AS-PCR was carried out on genomic DNA isolated from equine cyathostomin larvae harvested from faecal samples of horses at 9 different locations (Table 1) as per the method described by von Samson-Himmelstjerna et al. (2002a) and Coles et al. (2006). Genomic DNA was isolated from one hundred individual exsheathed larvae of small strongyles from each location. Briefly, 4 ml of pooled larval suspension from each location (600 larvae/ml of water) was incubated with 180 ␮l sodium hypochlorite (aqueous solution, about 3.5% active chlorine) for 10 min at room temperature. Individual larva in 2 ␮l water was pipetted under the microscope into a PCR tube and incubated at 41 ◦ C overnight with 6 ␮l of extraction buffer (1 mM Tris–HCl, 0.1 mM EDTA, 5 mg/ml proteinase-K). Following incubation, inactivation of proteinase-K was done at 95 ◦ C for 20 min. The tubes containing the digested larval suspension were then stored at −20 ◦ C till used as templates for PCR amplification. A total of 100 infective cyathostomin larvae, harvested from pooled faecal samples of horses from each location, were individually genotyped as homozygous susceptible (SS), homozygous resistant (rr) and heterozygous (rS) by allele specific PCR that detects F200Y mutation in isotype 1 ␤-tubulin gene. For each larvae, AS-PCR was performed in 2 separate PCR tubes, each containing either of the 2 forward primers i.e. susceptible allele primer (CN24FS- ggttgaaaatacagacgagacttt) or resistant allele primer (CN25FR- ggttgaaaatacagacgagactta) and a common reverse primer (CN30R- agcagagaggggagcaaagccagg). Preparation of the reaction mixture and the reaction conditions of PCR were similar to those described by Coles et al. (2006). The amplicons were vistualized by 2.0% agarose gel electrophoresis. 2.4. Statistical analysis The results of genotyping of cyathostomin larvae by AS-PCR from each location were analysed by Chi-square test using SPSS software version 16. Spearman rank correlation coefficient (rs ) and p value between FECR% and pre-treatment susceptible allele percentage at 7 locations where both FECRT and AS-PCR were performed (Table 1) were determined using Microsoft Excel 2007 software. 3. Result Results of FECRT and AS-PCR indicated widespread prevalence of benzimidazole resistant equine cyathostomins in Uttar Pradesh, India (Table 1). Out of the 9 locations where FECRT was performed, benzimidazole resistance in cyathostomins was detected at 4 locations (44.4%) i.e., at an intensively managed equine farm in

SS—Homozygous Susceptible; rr—Homozygous Resistant; rS—Heterozygous; S—Susceptible allele; r—Resistant allele; ND—Not determined. a Faecal egg count reduction test performed using fenbendazole @ 10 mg/kg body weight, orally. b FBZ—Fenbendazole @10 mg/kg b.wt., oral. c ABZ—Albendazole @10 mg/kg b.wt., oral. d IVM—Ivermectin @ 0.2 mg/kg b.wt., oral paste.

Susceptible

Susceptible 0.26

ND ND

0.74 27

ND ND

13 60

ND

ND

ND

97.3

22 FBZ (2) Extensive Vindhyan

Extensive Barabanki

Allahabad

Eastern plains

Extensive Extensive Intensive Extensive Extensive Extensive Hardoi Shahjahanpur Lucknow Kanpur Unnao Raibareilly

FBZ (0–1)

12

93

Resistant Resistant Susceptible Susceptible Resistant Susceptible 0.39 0.27 0.17 0.16 ND 0.09 0.61 0.73 0.83 0.84 ND 0.91 23 05 18 20 ND 10 27 24 08 06 ND 04 50 71 74 74 ND 86 78.1 83.5 99.1 98.8 75.9 100

ABZc (4) FBZ (1–2)

FBZ (2) FBZ (2) FBZ and IVMd alternatively (2) ABZ (1) FBZ (2) ABZ (0–1)

08 07 20 14 08 08

29 57 97 90 43 100

Susceptible

Resistant Susceptible 0.53 0.15

0.25 0.75

0.47 0.85 28 18

28 11

39 06 33 76

61

27.5 98.3

ND ND 16

13 11

FBZ (1–2) Extensive

Intensive Extensive

Pilibhit

rr

Tarai and bhabar

Bareilly

95% LCI

rS

r S

Genotype%

SS

FECR%

Midwestern plains Central plains

b

Allele frequency AS-PCR FECRTa No. of horses screened History of anthemintic use (no. of times/year) Management system Location Agro-climatic zone

Table 1 Status of benzimidazole resistance in cyathostomins of horses in Uttar Pradesh, India.

0 92

Resistance status

S. Kumar et al. / Veterinary Parasitology 218 (2016) 93–97

95

Bareilly (FECR = 27.5%, LCI = 0) which is located in the mid-western plains and in working horses (extensively managed) at Shahjahanpur (FECR = 83.6%, LCI = 57%), Unnao (FECR = 75.7%, LCI = 43%) and Hardoi (FECR = 78.2%, LCI = 29%), which are located in central plains of Uttar Pradesh. At all other locations, fenbendazole was found effective against cyathostomins in equines. Pre-treatment larval cultures revealed predominance of cyathostomin larvae (65–92%), followed by the larvae of S. vulgaris (5–15%), Strongylus edentatus (2–11%), Triodontophorus spp. (1–6%), Oesophagodontus spp. (0–3%), Poteriostomum spp. (0–3%) and Trichostrongylus spp. (0–2%). However, post-treatment larval cultures revealed the presence of exclusively cyathostomin larvae at the locations where benzimidazole resistance was detected by FECRT. Results of genotyping of cyathostomin larvae by AS-PCR for detection of benzimidazole resistance in ␤-tubulin gene are presented in Table 1 and Fig. 1. Frequency of homozygous resistant (rr) individuals was significantly higher (p < 0.001) at the intensively managed farm at Bareilly (mid-western plains) and in working horses at Shahjahanpur and Hardoi (central plains) as compared to other places. The resistant allele (r) frequency in cyathostomins was significantly higher at intensively managed farm at Bareilly and also in working horses at Hardoi (p < 0.001) and Shahjahanpur (p < 0.05) located in the central plains, at Allahabad (p < 0.05) in the Vindhyan zone and at Pilibhit (p < 0.05), which is located in the Tarai and Bhabar zone of Uttar Pradesh. When the two management systems were compared, the prevalence of benzimidazole resistant allele was significantly higher (p < 0.05) in cyathostomins of the intensively managed horses (allelic frequency = 0.35) as compared to the extensively managed horses (allelic frequency = 0.22). The Spearman rank correlation of FECRT results and pretreatment susceptible allele percentage was found to be significant (rs = 0.785, p = 0.018).

4. Discussion Being cheaper and readily available to the farmers and veterinarians, benzimidazoles are the most commonly used anthelmintics in horses in India. There is a paucity of information on the epidemiology of gastrointestinal strongylosis in equines of Uttar Pradesh (Pal, 2002; Singh et al., 2002a,b) and the animals are often underdosed. So, the chances of emergence of anthelmintic resistance in cyathostomins in Uttar Pradesh are high, which is reflected in the results of the present study. In the present study, FECRT was performed on horses in group sizes ranging from 7 to 20 horses/group. Coles et al. (2006) have specifically stated that in horses ‘group sizes will be small and control groups may not be practical but a group size of six should be used where possible’. They have also suggested using horses with a minimum individual count of 150 epg while performing the FECRT. Accordingly, the procedure for conducting FECRT in the present study is in accordance to the WAAVP guidelines for evaluating anthelmintic resistance in horses. The same has also been discussed by Traversa et al. (2012) while evaluating the efficacies of anthelmintics against horse cyathostomins in France. In the present study, AS-PCR was also performed on cyathostomin larvae harvested from pre-treatment faecal cultures of the same horses on which FECRT was performed at 7 out of 9 locations. A significant Spearman rank correlation between FECRT and AS-PCR results at these locations further implies that the places with low FECR% generally had lower frequency of susceptible allele and vice-versa, thereby supporting the accuracy of FECRT performed in this study. The higher prevalence of benzimidazole resistant cyathostomin larvae in intensively managed equine farm at Bareilly (mid-western plain) may be attributed to a higher frequency of treatment (4 times/year) with benzimidazoles. This may have resulted in

96

S. Kumar et al. / Veterinary Parasitology 218 (2016) 93–97

Fig. 1. Genotyping of cyathostomin larvae by AS-PCR for detection of benzimidazole resistance. SC: Susceptible control. rC: Resistant control. M: 100 bp plus DNA ladder. L2, L4, L7, L10: Homozygous susceptible larvae. L6, L8, L11: Homozygous resistant larvae. L1, L3, L5, L9: Heterozygous larvae (For each sample there are two lanes. Presence of a 305 bp band in the first lane only indicates homozygous susceptible larvae, while a band of 305 bp in the second lane only indicates homozygous resistant larvae. Presence of 305 bp in both the lanes for each sample indicate heterozygous larvae).

selection of larvae harbouring benzimidazole resistant alleles over a period of time. These findings were confirmed when FECRT was performed at the same farm, which revealed FECR of only 27.5%. However, in the intensively managed equine farm at Lucknow, the frequency of benzimidazole susceptible allele (S = 0.83) in cyathostomins was significantly higher (p < 0.001) as compared to the intensively managed equine farm at Bareilly. In this farm, the horses were dewormed twice a year with fenbendazole and ivermectin, alternatively. Since, ivermectin is highly effective against equine strongyles in India (Pal, 2002; Kumar and Vatsya, 2014), the worms which survived benzimidazole treatment were subsequently eliminated by ivermectin. Thus, the chance of establishment and propagation of benzimidazole resistant strongyles at this farm at Lucknow was minimal, which was duly reflected in the genotyping results. Although, working horses (extensively managed) are less frequently treated with benzimidazoles (1–2 times in a year) in Uttar Pradesh, still benzimidazole resistance was detected at Hardoi and Shahjahanpur (both located in central plains) by FECRT and the frequency of homozygous resistant (rr) individuals as well as the resistant allele (r) frequency was significantly high (p < 0.001). The resistant allele frequency at two other locations namely, Pilibhit (Tarai and Bhabar zone) and Allahabad (Vindhyan zone) was also significantly high (p < 0.05) as higher proportions of heterozygous individuals were detected at these two places. These working horses are mostly owned by the poor and they generally use cheaper generic anthelmintics available in the market without consultation with the local veterinarians. During this study, it was also observed that horse owners generally administer anthelmintics after mixing it with feed. Thus the intake of anthelmintic was directly related to feed intake. Besides this, incorrect estimation of the body weight of the animals is a common problem in working horses, which frequently leads to underdosing. This indiscriminate use might have led to the selection of resistant worms in the population. The presence of higher proportions of heterozygous genotypes in these populations would further result in rapid development of benzimidazole resistance, if the factors allowing the selection of resistant worms are present. Emergence of benzimidazole resistance in working horses is a serious concern as it has never been previously reported from India. The widespread prevalence of benzimidazole resistant alleles in equine cyathostomes in Uttar Pradesh, suggests that it would be prudent to restrict the therapeutic use of this family of anthelmintic or it may be used cautiously only after evaluating its efficacy in horses in different parts of India. The epidemiology of strongyle infections in horses in different parts of the country (Pal, 2002; Katoch et al., 2006; Sharma et al., 2011b; Pilania et al., 2013; Matto et al., 2013; Adeppa et al., 2014) must also be kept in mind while

formulating any control strategy. As an alternative, annual rotation of unrelated class of anthelmintics viz. tetrahydropyrimidines and macrocyclic lactones may be adopted to minimize the rate of emergence of benzimidazole resistance in the farms (Prichard et al., 1980; Barnes et al., 1995). Further, introduction of benzimidazole susceptible cyathostomin populations in the places where resistance has become widespread may be attempted as has been tried in South Africa for combating anthelmintic resistance in strongyle infections of sheep (Van Wyk and Van Schalkwyk, 1990; Van Wyk et al., 2001). In conclusion, proper pasture management and strategic treatment programs may offer a solution for anthelmintic resistance in horses in India. Acknowledgements Authors are thankful to the Indian Council of Agricultural Research for providing necessary funds in the form of All India Network Programme on Gastrointestinal Parasitism. Thanks are also due to Project Coordinator, AINP-GIP and Director, ICAR-Indian Veterinary Research Institute, Izatnagar for providing necessary facilities for smooth conduct of this research work. Authors also thankfully acknowledge the help received from Brooke’s India Ltd., during the course of this study. References Adeppa, J., Ananda, K.J., Krishnamurthy, C.M., Satheesha, G.M., 2014. Incidence of gastrointestinal parasites in horses of Shimoga region, Karnataka state. J. Parasit. Dis., http://dx.doi.org/10.1007/s12639-014-0605-5. Bagherwal, R.K., Sisodia, R.S., Kale, K., 1989. Studies on the efficacy of fenbendazole against Oxyuris equi infection in horses. Indian Vet. J. 66, 978–980. Banerjee, P.S., Ram, H., Singh, B., Yadav, C.L., Garg, R., 2002. Efficacy of ivermectin (oral and injectable) and fenbendazole against GI nematodes of equines. Centaur-Madras 19, 35–38. Barnes, E.H., Dobson, R.J., Barger, I.A., 1995. Worm control and anthelmintic resistance: advantures with a model. Parasitol. Today 11, 56–63. Carroll, C.L., Huntington, P.J., 1988. Body condition scoring and weight estimation of horses. Equine Vet. J. 20, 41–45. Coles, G.C., Bauer, C., Borgsteede, F.H., Geerts, S., Klei, T.R., Taylor, M.A., Waller, P.J., 1992. World Association for the Advancement of Veterinary Parasitology (W.A.A.V.P.) methods for the detection of anthelmintic resistance in nematodes of veterinary importance. Vet. Parasitol. 44, 35–44. Coles, G.C., Jackson, F., Pomroy, W.E., Prichard, R.K., von Samson-Himmelstjerna, G., Silvestre, A., Taylor, M.A., Vercruysse, J., 2006. The detection of anthelmintic resistance in nematodes of veterinary importance. Vet. Parasitol. 136, 167–185. DAHDF, 2014. 19th Livestock Census- All India Report. Department of Animal Husbandry, Dairying and Fisheries, Ministry of Agriculture and Farmers Welfare, Government of India80–82 http://www.dahd.nic.in/dahd/ WriteReadData/Livestock.pdf. Drudge, J.H., Lyons, E.T., 1965. Newer development in helminth control and Strongylus vulgaris research. Proceedings of 11th Annual Meeting of American Association of Equine Practitioners, Miami Beach, Florida, 381–389. Elard, L., Sauve, C., Humbert, J.F., 1996. Sequence of ␤-tubulin cDNA from benzimidazole susceptible and resistant strains of Teladorsagia circumcincta: a nematode parasite of small ruminants. Mol. Biochem. Parasitol. 80, 231–237.

S. Kumar et al. / Veterinary Parasitology 218 (2016) 93–97 Elard, L., Sauve, C., Humbert, J.F., 1998. Fitness of benzimidazole-resistant and -susceptible worms of Teladorsagia circumcincta: a nematode parasite of small ruminants. Parasitology 117, 571–578. Herd, R.P., 1990. The changing world of worms: the rise of the cyathostomes and the decline of Strongylus vulgaris. Comp. Cont. Educ. Pract. Vet. 12, 732–736. Hodjkinson, J.E., Clark, H.J., Kaplan, R.M., Lake, S.L., Matthews, J.B., 2008. The role of polymorphisms at ␤ tubulin isotype 1 codons 167 and 200 in benzimidazole resistance in cyathostomins. Int. J. Parasitol. 38, 1149–1160. Kaplan, R.M., Klei, T.R., Lyons, E.T., Lester, G., Courtney, C.H., French, D.D., Tolliver, S.C., Vidyashankar, A.N., Zhao, Y., 2004. Prevalence of anthelmintic resistant cyathostomes on horse farms. J. Am. Vet. Med. Assoc. 225, 903––910. Katoch, R., Katoch, S., Agnihotri, R.K., Sharma, K.B., Katoch, A., 2006. Prevalence of gastrointestinal helminths in Spiti horses of Himachal Pradesh. Intas Polivet 7, 64–66. Khajuria, J.K., Yadav, A., Katoch, R., Vohra, S., Soodan, J.S., Srivastava, A., Ahmed, N., 2006. Anthelmintic efficacy of fenbendazole against natural strongyle infection of equines, Centaur-Madras, 22., pp. 59. Kumar, R.R., Vatsya, S., 2014. Comparative efficacy of fenbendazole and ivermectin against equine strongylosis. In: Compendium and Abstracts of National Conference on Emerging Problems and Recent Advances in Applied Sciences: Basic to Molecular Approaches, CCS University, Meerut, February 8–9, p. p371. Kwa, M.S., Veenstra, J.G., Roos, M.H., 1994. Benzimidazole resistance in Haemonchus contortus is correlated with a conserved mutation at amino acid 200 in ␤-tubulin isotype-1. Mol. Biochem. Parasitol. 63, 299–303. Lake, S., Matthews, J., Kaplan, R., Hodgkinson, J., 2009. Determination of genomic DNA sequences for beta-tubulin isotype 1 from multiple species of cyathostomin and detection of resistance alleles in third stage larvae from horses with naturally acquired infections. Parasit. Vectors 2, S6. Lester, H.E., Spanton, J., Stratford, C.H., Bartley, D.J., Morgan, E.R., Hodgkin-son, J.E., Coumbe, K., Mair, T., Swan, B., Lemon, G., Cookson, R., Matthews, J.B., 2013. Anthelmintic efficacy against cyathostomins in horses in Southern England. Vet. Parasitol. 197, 189–196. Love, S., Murphy, D., Mellor, D., 1999. Pathogenicity of cyathostome infections. Vet. Parasitol. 85, 113–121. MAFF, 1986. Manual of Veterinary Parasitology Laboratory Techniques, 3rd ed. Ministry of Agriculture, Fisheries and Food, ADAS, HMSO, UK, pp. 160. Martin, P.J., Anderson, N., Jarrett, R.G., 1989. Detecting benzimidazole resistance with faecal egg count reduction tests and in vitro assays. Aust. Vet. J. 66, 236–240. Matto, T.N., Bharkad, G.P., Bhat, S.A., 2013. Prevalence of gastrointestinal helminth parasites of equids from organized farms of Mumbai and Pune. J. Parasit. Dis. 39, 179––185. Pal, D., 2002. Equine strongyle-epidemiology, anthelmintic efficacy and resistance. In: M.V.Sc. Thesis. G. B. Pant University of Agriculture and Technology, Pantnagar, Uttaranchal, India, pp. 66. Pape, M., von Samson-Himmelstjerna, G., Schnieder, T., 1999. Characterisation of the beta-tubulin gene of Cylicocyclus nassatus. Int. J. Parasitol. 29, 1941–1947. Pape, M., Posedi, J., Failing, K., Schnieder, T., von Samson-Himmelstjerna, G., 2003. Analysis of the beta-tubulin codon 200 genotype distribution in a benzimidazole-susceptible and -resistant cyathostome population. Parasitology 127, 53–59. Peregrine, A.S., Molento, M.B., Kaplan, R.M., Nielsen, M.K., 2014. Anthelmintic resistance in important parasites of horses: does it really matter? Vet. Parasitol. 201, 1–8. Pilania, P.K., Manohar, G.S., Bhan, A.K., 2013. Intensity of gastrointestinal parasitic infections in horses of animal fairs in Rajasthan. J. Vet. Parasitol. 27, 42–45.

97

Prichard, R.K., Hall, C.A., Kelly, J.D., Martin, I.C.A., Donald, A.D., 1980. The problem of anthelmintic resistance in nematodes. Aust. Vet. J. 56, 239––251. Prichard, R.K., 2001. Genetic variability following selection of Haemonchus contortus with anthelmintics. Trends Parasitol. 17, 445–453. Sharma, S., Shukla, P.C., Dixit, P., Dixit, A.K., 2011a. Comparative therapeutic efficacy of different anthelmintics against gastrointestinal helminths in horses. Vet. Practitioner 12, 236–237. Sharma, S., Shukla, P.C., Dixit, P., Dixit, A.K., 2011b. Prevalence of gastrointestinal helminths in horses in Malwa region of Madhya Pradesh. Vet. Practitioner 12, 68–69. Silvestre, A., Carbaret, J., 2002. Mutation in position 167 of isotype-1 beta-tubulin gene of trichostrongylid nematodes: role in benzimidazole resistance. Mol. Biochem. Parasitol. 120, 297–300. Singh, B., Ram, H., Banerjee, P.S., Garg, R., Yadav, C.L., 2002a. Epidemiological aspects of gastrointestinal parasites of equines in Uttaranchal and Uttar Pradesh. Indian J. Anim. Sci. 72, 861–862. Singh, R.J., Baht, A.S., Pandit, B.A., 2002b. Comparative efficacy of ivermectin: fenbendazole and thiabendazole against strongylosis in equines. Indian Vet. J. 79, 865–866. Singh, G., Soodan, J.S., Yadav, A., Khajuria, J.K., Agrawal, R., 2012. Evaluation of efficacy of ivermectin and fenbendazole against natural infection of gastrointestinal helminths of equines. J. Vet. Parasitol. 26, 66–68. Traversa, D., Castagna, G., von Samson-Himmelstjerna, G., Meloni, S., Bartolini, R., Geurden, T., Pearce, M.C., Woringer, E., Besognet, B., Milillo, P., D’Espois, M., 2012. Efficacy of major anthelmintics against horse cyathostomins in France. Vet. Parasitol. 188, 294–300. Van Wyk, J.A., Van Schalkwyk, P.C., 1990. A novel approach to the control of anthelmintic-resistant Haemonchus contortus in sheep. Vet. Parasitol. 35, 61–69. Van Wyk, J.A., Van Wijk, E.F., Stenson, M.O., Barnard, S.H., 2001. Anthelmintic resistance reverted by dilution with a susceptible strain of Haemonchus contortus in the field: preliminary report. In: Proceedings of the 5th International Sheep Veterinary Congress, Stellenbosch, pp. 194–195. von Samson-Himmelstjerna, G., Harder, A., Pape, M., Schnieder, T., 2001. Novel small strongyle (cyathostominae) beta-tubulin sequences. Parasitol. Res. 87, 122–125. von Samson-Himmelstjerna, G., Pape, M., von Witzendorff, C., Schnieder, T., 2002a. Allele-specific PCR for the beta-tubulin codon 200 TTC/TAC polymorphism using single adult and larval small strongyle (cyathostominae) stages. J. Parasitol. 88, 254–257. von Samson-Himmelstjerna, G., von Witzendorff, C., Sievers, G., Schnieder, T., 2002b. Comparative use of faecal egg count reduction test: egg hatch assay and beta-tubulin codon 200 genotyping in small strongyles (cyathostominae) before and after benzimidazole treatment. Vet. Parasitol. 108, 227–235. von Samson-Himmelstjerna, G., Buschbaum, S., Wirtherle, N., Pape, M., Schnieder, T., 2003. TaqMan minor groove binder real-time PCR analysis of b-tubulin codon 200 polymorphism in small strongyles (cyathostominae) indicates that TAC allele is only moderately selected in benzimidazole-resistant populations. Parasitology 127, 489–496. Yadav, C.L., Garg, R., 2005. Status of anthelmintic resistance in gastrointestinal nematodes in India. In: Sanyal, P.K., Sarkar, A.K., Patel, N.K., Mandal, S.C., Pal, S. (Eds.), Integrated Animal Parasite Management: From Academic Interest to Reality. Durg, Chattisgarh, India, pp. 9–22. Yadav, C.L., Gupta, R.P., Ruprah, N.S., 1984. Efficacy of fenbendazole against strongyles in equines. J. Remount Vet. Crops 23, 64–67.