Beta2-adrenergic receptor agonists reduce proliferation but not protein synthesis of periodontal fibroblasts stimulated with platelet-derived growth factor-BB

archives of oral biology 58 (2013) 1812–1817

Available online at www.sciencedirect.com

ScienceDirect journal homepage: http://www.elsevier.com/locate/aob

Short communication

Beta2-adrenergic receptor agonists reduce proliferation but not protein synthesis of periodontal fibroblasts stimulated with platelet-derived growth factor-BB R. Gruber a,b,d, M. Leimer a,b, M.B. Fischer c, H. Agis b,e,* a

Department of Oral Surgery, Medical University of Vienna, Vienna, Austria Austrian Cluster for Tissue Regeneration, Austria c Department of Blood Group Serology and Transfusion Medicine, Medical University of Vienna, Vienna, Austria d Laboratory of Oral Cell Biology, School of Dental Medicine, University of Bern, Bern, Switzerland e Department of Conservative Dentistry and Periodontology, Medical University of Vienna, Vienna, Austria b

article info

abstract

Article history:

Objective: Catecholamines released from b-adrenergic neurons upon stress can interfere

Accepted 24 September 2013

with periodontal regeneration. The cellular mechanisms, however, are unclear. Here, we

Keywords:

Methods: Fibroblasts from the gingiva and the periodontal ligament were exposed to ago-

assessed the effect of catecholamines on proliferation of periodontal fibroblasts. Periodontal therapy

nists of the b-adrenergic receptors; isoproterenol (ISO, non-selective b-adrenergic agonist),

Stress

salbutamol (SAL, selective b2-adrenergic receptor agonist) and BRL 37344 (BRL selective b3-

Beta2-adrenergic receptor

receptor agonist). Proliferation was stimulated with platelet-derived growth factor-BB

PDGF-BB

(PDGF-BB). Pharmacological inhibitors and gene expression analysis further revealed b-

Proliferation

adrenergic signalling. Results: Gingiva and periodontal ligament fibroblast express the b2-adrenergic receptor. ISO and SAL but not BRL decreased proliferation of fibroblasts in the presence of PDGFBB. The inhibitory effect of b-adrenergic signalling on proliferation but not protein synthesis in response to PDGF-BB was reduced by propranolol, a non-selective b-adrenergic antagonist. Conclusions: These results suggest that b2-receptor agonists can reduce the mitogenic response of periodontal fibroblasts. These data add to the compelling concept that blocking of b2-receptor signalling can support tissue maintenance and regeneration. # 2013 Elsevier Ltd. All rights reserved.

* Corresponding author at: Department of Conservative Dentistry and Periodontology, Medical University of Vienna, Sensengasse 2a, A-1090 Vienna, Austria. Tel.: +43 1 400 70 2101; fax: +43 1 400 70 2109. E-mail addresses: [email protected], [email protected] (H. Agis). 0003–9969/$ – see front matter # 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.archoralbio.2013.09.005

archives of oral biology 58 (2013) 1812–1817

1.

Introduction

Stress, including psychological, mechanical, and oxidative forms, can promote periodontal diseases, stimulate tissue destruction, and compromise wound healing.1–7 Stress related molecules in the sulcus and saliva are suggested to predict the onset and progression of periodontal diseases.8 The molecular mechanisms linking stress and periodontal diseases are, however, not fully understood. Among the stress meditators are catecholamines such as epinephrine and norepinephrine. Catecholamines induce b-adrenergic signalling by binding to their respective transmembrane adrenergic receptors.9,10 Adrenergic signalling represents a possible target to interfere with the compromising effects of stress.11–15 Under stress, the periodontal tissue, being highly innervated with nerves of the sympatic system, is assumably exposed to increasing levels of catecholamines. A possible link between nerve activation and the progression of periodontal diseases is suggested by preclinical studies e.g. in rodents showing that chemical sympathectomy inhibits periodontal disease and enhances bone regeneration.16,17 The impact of badrenergic signalling on osteogenic cells that maintain the alveolar bone has been shown in rodents.18 Moreover, propranolol, a non-selective b-adrenergic receptor antagonist, in rats prevented bone loss under occlusal hypofunction19 and in an inflammation model.20 Catecholamines can also impair soft tissue healing.21 Respective models on periodontal regeneration have not been reported. Periodontal regeneration requires a process where fibroblastic cells proliferate and produce matrix. These steps are governed by growth factors including those released from platelets and macrophages such as PDGF-BB.22 The approval of recombinant PDGF-BB for periodontal regeneration support the importance of these growth factors in the clinic.23 The cellular response to PDGF-BB may, however, be compromised by adrenergic signalling as suggested by in vitro studies with fibroblasts and vascular smooth muscle.24,25 Yet, the impact of adrenergic signalling on the responses of fibroblasts to PDGFBB is unclear. Here, we assessed the impact of b-adrenergic receptor agonists on the cellular response to recombinant PDGF-BB by assessing the impact on proliferation and protein synthesis in vitro. Fibroblasts from the periodontal ligament and the gingiva were stimulated with the b-adrenergic receptor agonists isoproterenol, salbutamol, and BRL 37344. We also included the blockers metoprolol, propanolol, and atenolol in the study. Our study can provide insights into the effect of the b-adrenergic system on the mitogenic response of periodontal cells to growth factors during periodontal healing.

2.

Material and methods

2.1.

Cell culture

Fibroblasts from the gingiva (GF) and the periodontal ligament (PDLF) were prepared from extracted third molars after informed consent was obtained from the patients routinely treated at the BGZMK and the study was approved by the

1813

Ethics Committee of the Medical University Vienna, Ek-Nr.: 631/2007. The donors were selected based on the absence of previous history of periodontal inflammation. Gingiva fragments from the tooth neck and of the periodontal ligament fragments from the tooth root were scraped off the extracted teeth. Explant cultures from gingival and periodontal ligament tissue fragments were performed separately. GF and PDLF were cultivated in a humidified atmosphere of 5% CO2 at 37 8C in a-Minimum Essential Media (aMEM Invitrogen Corporation, Carlsbad, CA, USA) supplemented with 10% foetal calf serum (FCS, PAA Laboratories, Linz, Austria), penicillin and streptomycin (Invitrogen Corporation). Cells from passage 3–9 were used for the experiments and seeded at 50,000 cells/cm2. Cells were stimulated with or without PDGF-BB (R&D Systems, Minneapolis, MD, USA) at 30 ng/ml, and with or without the bAR agonists isoproterenol (ISO), salbutamol (SAL), BRL 37344 (BRL) (Sigma Aldrich) at concentrations of 100 nM. To reveal the involved b-AR, specific antagonists of b-adrenergic signalling were used: Metoprolol (MET), propanolol (PRO), and atenolol (ATE) all at 100 nM (Sigma–Aldrich).

2.2.

Proliferation, protein synthesis and MTT assay

GF and PDLF were pulse-labelled with 3[H]thymidine and 3 [H]leucine (both 0.5 mCi/well, Hartmann Analytic, Braunschweig, Germany), respectively, for the last 6 h of exposure to the b-AR agonists. The plates were subjected to liquid scintillation counting using Microscint 0 on a Top Count NXT system (Perkin Elmer, Minnesota, USA). Data were normalized to untreated controls. For MTT assay, GF and PDLF were treated with the b-AR agonists for one day and then incubated with 1 mg/ml MTT (Sigma, Saint Louis, MO, USA) for 2 h at 37 8C. MTT and the medium were removed and formazan crystals were solubilized with dimethyl sulfoxide. Optical density was measured with a photometer (Spectra max 384 PLUS, Molecular Devices, LLC, CA, USA).

2.3.

Reverse transcription-PCR analysis

Total RNA of fibroblasts from the gingiva and the periodontal ligament was isolated using RNeasy mini kit (Qiagen, Hilden Germany) and treated with DNAse according to the manufacture’s protocol. Reverse transcription was performed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Life Technologies Corporation, NY, USA). For the PCR, the Taq DNA Polymerase Kit (Invitrogen Corporation) was used according to the instructions of the manufacturer. In brief, PCR was performed with 2 u of Taq polymerase (Invitrogen Corporation), in 20 mM Tris–HCl (pH 8.4), 50 mM KCl, 0.2 mM dNTP mix, 1.5 mM MgCl. The following primers were used (50 –30 ) at 0.5 mM each26: b2-AR forward ACCCACCAGGAAGCCATCAACTGCT, b2-AR reverse GCCTATCCAATTTAGGAGGATGTAAACTTCC, beta-actin forward AAAGACCTGTACGCCAACACAGTGCTGTCTGG, beta-actin reverse CGTCATACTCCTGCTTGCT GATCCACATCTGC. The tubes were incubated in the thermal cycler at 94 8C for 3 min following 30 cycles of 94 8C for 45 s, 55 8C for 30 s, and 72 8C for 1 min 30 s. The products were evaluated by performing gel electrophoresis on a 2% agarose gel. Pictures were taken using a UV transilluminator (Bio-Rad, CA, USA)

1814

archives of oral biology 58 (2013) 1812–1817

Fig. 1 – Beta2-AR signalling reduces PDGF-BB induced proliferation in fibroblast from the gingiva and periodontal ligament. (A) To examine the effect of b-adrenergic signalling on the mitogenic effect of platelet-derived growth factor-BB (PDGFBB) on fibroblast from the gingiva and the periodontal ligament were treated with agonists of the b-adrenergic receptors; isoproterenol (ISO, non-selective b-adrenergic agonist), salbutamol (SAL, selective b2-adrenergic receptor agonist) and BRL 37344 (BRL selective b3-receptor agonist) in the presence of PDGF-BB. We evaluated proliferation which was measured based on incorporation of 3[H]thymidine. (B) To assess the involvement of the b2-adrenergic receptor experiments with antagonists were performed. Fibroblast from the gingiva and the periodontal ligament were treated with metoprolol (MET), propanolol (PRO), and atenolol (ATE) in the presence of PDGF-BB and salbutamol (SAL). We evaluated the proliferation based on incorporation of 3[H]thymidine. (C) The expression of the b2-adrenergic receptor (Beta2-AR) was assessed by revers transcription PCR. betaActin was used as control. Bars represent the mean W standard deviation relative to the untreated control. The dashed line represents the levels of the untreated control. *p < 0.05, **p < 0.01.

archives of oral biology 58 (2013) 1812–1817

2.4.

Statistical analysis

Data were compared by Kruskal Wallis and post hoc Mann– Whitney U tests. Significance was assigned at the p < 0.05 level.

3.

Results

3.1. Beta2-adrenergic receptor signalling reduces PDGF-BB induced proliferation in fibroblast from the gingiva and periodontal ligament To investigate whether b-adrenergic signalling can modulate the effects of PDGF-BB on proliferation, fibroblasts were treated with ISO, a non-selective b-adrenergic agonist, and SAL, a selective b2-adrenergic receptor agonist. ISO and SAL reduced PDGF-BB stimulated proliferation although not reaching the levels of unstimulated fibroblasts (Fig. 1A). To assess the role of b2-adrenergic receptor, experiments were performed in the presence of blockers of b-adrenergic signalling. The effect of SAL was inhibited by the b2-adrenergic receptor antagonist propranolol, but not by metoprolol and atenolol, antagonists of b1-adrenergic receptor (Fig. 1B). The agonists and antagonists did not modulate viability and proliferation in untreated fibroblasts indicating that the used concentrations are not toxic (Table 1). In addition, expression of b2-adrenergic receptor was assessed in GF and PDLF. Both gingival and periodontal ligament fibroblasts were found positive for b2-AR. (Fig. 1C). Together these data suggest that activation of the b2adrenergic receptor can reduce the mitogenic response of fibroblast from the gingiva and the periodontal ligament to PDGF-BB.

3.2. Beta2-adrenergic receptor signalling does not modulate PDGF-BB induced protein synthesis in fibroblast from the gingiva and periodontal ligament To assess the impact of b-adrenergic receptor signalling on matrix production, protein synthesis was assessed by 3[H]leucine incorporation assays. Protein synthesis was not changed by either of the two agonists, ISO and SAL, or the antagonists

Table 1 – No changes of viability, proliferation, and protein synthesis in the presence of agonists of the badrenergic receptors under serum free conditions. ISO Viability 0.91  0.12 GF 0.98  0.13 PDLF Proliferation GF 0.80  0.31 1.14  0.46 PDLF Protein synthesis 0.98  0.16 GF PDLF 0.95  0.24

SAL

BRL

0.99  0.16 1.00  0.03

1.02  0.18 0.93  0.05

0.71  0.26 1.00  0.32

0.81  0.13 1.09  0.36

0.95  0.20 0.97  0.20

1.25  0.80 0.96  0.08

Results are given as mean  relative to the untreated control.

1815

(Fig. 2A and B). Also, without the presence of PDGF-BB all three agonists failed to modulate protein synthesis in gingival and periodontal ligament fibroblasts (Table 1).

4.

Discussion

We assessed whether catecholamines that induce b-adrenergic signalling modulate the effect of PDGF-BB on fibroblasts from the gingiva and periodontal ligament. We found that activation of b2-adrenergic signalling can reduce the PDGF-BBinduced proliferation of fibroblasts from gingiva and periodontal ligament and that both cell types express the b2adrenergic receptor. No pronounced effects of b2-adrenergic signalling were found on protein synthesis. These data add to the existing literature that oral keratinocytes and oral squamous cell carcinoma express the b2-adrenergic receptor and that b2-adrenergic signalling reduces proliferation of smooth muscle cells and microglia cells, and that b2adrenergic signalling reduces migration of oral keratinocytes.27–30 The relevance of our findings is given by the role of badrenergic signalling in stress. Psychological, mechanical, and oxidative forms of stress, inducing the release of catecholamines, induce b-adrenergic signalling in the periodontium, promote periodontal diseases, stimulate tissue destruction, and compromise wound healing.1–7 Our in vitro findings offer a link between catecholamines that are released in the periodontium during stress, the activation of the b2-adrenergic receptors, and impaired cell proliferation. However, in vivo stress involves psychological, biomechanical, and physiological responses that cannot be assessed in this in vitro setting. In addition, the kinetics of badrenergic signalling in the periodontium is poorly understood. Our study focused on the early response to badrenergic signalling by investigating proliferation and protein synthesis at 24 h. Unclear is how different kinetics, such as long-term exposure or intermitted exposure, effect the cells of the periodontium. Our study on periodontal fibroblasts and the available literature on other oral and nonoral cells focuses on the response at day one.29,31 In addition upregulation of the b2-adrenergic receptors in periodontal fibroblast due to mechanical stress might make the cells more responsive to b-adrenergic signaling.12 To definitely prove the clinical relevance of our in vitro findings, preclinical and clinical studies are required that reveal the kinetics of the response. Our results can serve as a primer for these studies. Beta-blockers, which interfere with b-adrenergic signalling, are used clinically for the management of cardiac arrhythmias, secondary prevention to prevent from myocardial infarction and hypertension. Whether beta-blockers might be a feasible tool to enhance regeneration remains to be determined. Our studies suggest that blockers of b2adrenergic receptor could be a supplement for recombinant growth factors such as PDGF-BB. Whether a local application of a combination of recombinant PDGF-BB and b-blockers can be a feasible strategy to stimulate periodontal regeneration requires further data from studies with animals and patients.

1816

archives of oral biology 58 (2013) 1812–1817

Fig. 2 – Beta2-adrenergic receptor signalling does not modulate PDGF-BB induced protein synthesis in fibroblast from the gingiva and periodontal ligament. (A) To examine the effect of b-adrenergic signalling on the matrix production induced by platelet-derived growth factor-BB (PDGF-BB) in fibroblast from the gingiva and the periodontal ligament were treated with agonists of the b-adrenergic receptors; isoproterenol (ISO, non-selective b-adrenergic agonist), salbutamol (SAL, selective b2-adrenergic receptor agonist) and BRL 37344 (BRL selective b3-receptor agonist) in the presence of PDGF-BB. Protein synthesis was measured based on incorporation of 3[H]leucine. (B) Fibroblast from the gingiva and the periodontal ligament were treated with metoprolol (MET), propanolol (PRO), and atenolol (ATE), antagonists of the b-adrenergic receptors, in the presence of PDGFBB and salbutamol (SAL). Protein synthesis was measured based on incorporation of 3[H]leucine. Bars represent the mean W standard deviation relative to the untreated control. The dashed line represents the levels of the untreated control. *p < 0.05, **p < 0.01.

What we have contributed in this study is to identify a link between the signalling involved in the mediation of stress and reduced responsiveness of periodontal cells to growth factors. Our study thereby provides the basis for new therapeutic approaches.

Ethics Committee of the Medical University Vienna, Ek-Nr.: 631/2007.

Funding

Acknowledgements

Funded by Department of Oral Surgery, Medical University of Vienna, Vienna, Austria.

The authors thank M. Pensch (Bernhard Gottlieb University Clinic of Dentistry, Medical University of Vienna, Austria and Austrian Cluster for Tissue Regeneration, Austria) for skilful technical assistance and Amy Collins (Department of Periodontics & Oral Medicine, School of Dentistry, University of Michigan) for proof-reading. The authors thank W. Giannobile and co-workers (Department of Periodontics & Oral

Competing interests The authors do not have any conflict of interest to declare.

Ethical approval

archives of oral biology 58 (2013) 1812–1817

Medicine, School of Dentistry, University of Michigan) for their support.

references

1. Marucha PT, Kiecolt-Glaser JK, Favagehi M. Mucosal wound healing is impaired by examination stress. Psychosom Med 1998;60(3):362–5. 2. Broadbent E, Koschwanez HE. The psychology of wound healing. Curr Opin Psychiatr 2012;25(2):135–40. 3. Walburn J, Vedhara K, Hankins M, Rixon L, Weinman J. Psychological stress and wound healing in humans: a systematic review and meta-analysis. J Psychosom Res 2009;67(3):253–71. 4. Mannem S, Chava VK. The effect of stress on periodontitis: a clinicobiochemical study. J Indian Soc Periodontol 2012;16(3):365–9. 5. Marchetti E, Monaco A, Procaccini L, Mummolo S, Gatto R, Tete S, et al. Periodontal disease: the influence of metabolic syndrome. Nutr Metab (Lond) 2012;9(1):88. 6. Yamamoto T, Kita M, Yamamoto K, Akamatsu Y, Oseko F, Kanamura N. Mechanical stress enhances production of cytokines in human periodontal ligament cells induced by Porphyromonas gingivalis. Arch Oral Biol 2011;56(3):251–7. 7. Nokhbehsaim M, Deschner B, Winter J, Reimann S, Bourauel C, Jepsen S, et al. Contribution of orthodontic load to inflammation-mediated periodontal destruction. J Orofac Orthop 2010;71(6):390–402. 8. Rai B, Kaur J, Anand SC, Jacobs R. Salivary stress markers, stress, and periodontitis: a pilot study. J Periodontol 2010;82(2):287–92. 9. Triposkiadis F, Karayannis G, Giamouzis G, Skoularigis J, Louridas G, Butler J. The sympathetic nervous system in heart failure physiology, pathophysiology, and clinical implications. J Am Coll Cardiol 2009;54(19):1747–62. 10. Pullar CE, Le Provost GS, O’Leary AP, Evans SE, Baier BS, Isseroff RR. beta2AR antagonists and beta2AR gene deletion both promote skin wound repair processes. J Invest Dermatol 2012;132(8):2076–84. 11. Pierroz DD, Bonnet N, Bianchi EN, Bouxsein ML, Baldock PA, Rizzoli R, et al. Deletion of beta-adrenergic receptor 1, 2, or both leads to different bone phenotypes and response to mechanical stimulation. J Bone Miner Res 2012;27(6):1252–62. 12. Yamashiro K, Myokai F, Hiratsuka K, Yamamoto T, Senoo K, Arai H, et al. Oligonucleotide array analysis of cyclic tension-responsive genes in human periodontal ligament fibroblasts. Int J Biochem Cell Biol 2007;39(5):910–21. 13. Lamkin DM, Sloan EK, Patel AJ, Chiang BS, Pimentel MA, Ma JC, et al. Chronic stress enhances progression of acute lymphoblastic leukemia via beta-adrenergic signaling. Brain Behav Immun 2012;26(4):635–41. 14. Curtin NM, Mills KH, Connor TJ. Psychological stress increases expression of IL-10 and its homolog IL-19 via betaadrenoceptor activation: reversal by the anxiolytic chlordiazepoxide. Brain Behav Immun 2009;23(3):371–9.

1817

15. Moniri NH, Daaka Y. Agonist-stimulated reactive oxygen species formation regulates beta2-adrenergic receptor signal transduction. Biochem Pharmacol 2007;74(1):64–73. 16. Breivik T, Gundersen Y, Opstad PK, Fonnum F. Chemical sympathectomy inhibits periodontal disease in Fischer 344 rats. J Periodontal Res 2005;40(4):325–30. 17. Wang T, Cao J, Du ZJ, Zhang YB, Liu YP, Wang L, et al. Effects of sympathetic innervation loss on mandibular distraction osteogenesis. J Craniofac Surg 2012;23(5):1524–8. 18. Takeda S, Karsenty G. Molecular bases of the sympathetic regulation of bone mass. Bone 2008;42(5):837–40. 19. Shimizu Y, Hosomichi J, Kaneko S, Shibutani N, Ono T. Effect of sympathetic nervous activity on alveolar bone loss induced by occlusal hypofunction in rats. Arch Oral Biol 2011;56(11):1404–11. 20. Okada Y, Hamada N, Kim Y, Takahashi Y, Sasaguri K, Ozono S, et al. Blockade of sympathetic b-receptors inhibits Porphyromonas gingivalis-induced alveolar bone loss in an experimental rat periodontitis model. Arch Oral Biol 2010;55(7):502–8. 21. Pullar CE, Manabat-Hidalgo CG, Bolaji RS, Isseroff RR. betaAdrenergic receptor modulation of wound repair. Pharmacol Res 2008;58(2):158–64. 22. Singer AJ, Clark RA. Cutaneous wound healing. N Engl J Med 1999;341(10):738–46. 23. Kaigler D, Avila G, Wisner-Lynch L, Nevins ML, Nevins M, Rasperini G, et al. Platelet-derived growth factor applications in periodontal and peri-implant bone regeneration. Expert Opin Biol Ther 2011;11(3):375–85. 24. Lin HY, Ballou LM, Lin RZ. Stimulation of the alpha1A adrenergic receptor inhibits PDGF-induced PDGF beta receptor Tyr751 phosphorylation and PI 3-kinase activation. FEBS Lett 2003;540(1–3):106–10. 25. Dubey RK, Gillespie DG, Shue H, Jackson EK. A(2B) receptors mediate antimitogenesis in vascular smooth muscle cells. Hypertension 2000;35:267–72. 1 Pt 2. 26. Perrone MG, Notarnicola M, Caruso MG, Tutino V, Scilimati A. Upregulation of beta3-adrenergic receptor mRNA in human colon cancer: a preliminary study. Oncology 2008;75(3–4):224–9. 27. Kassel KM, Wyatt TA, Panettieri Jr RA, Toews ML. Inhibition of human airway smooth muscle cell proliferation by beta 2-adrenergic receptors and cAMP is PKA independent: evidence for EPAC involvement. Am J Physiol Lung Cell Mol Physiol 2008;294(1):L131–8. 28. Fujita H, Tanaka J, Maeda N, Sakanaka M. Adrenergic agonists suppress the proliferation of microglia through beta 2-adrenergic receptor. Neurosci Lett 1998;242(1):37–40. 29. Steenhuis P, Huntley RE, Gurenko Z, Yin L, Dale BA, Fazel N, et al. Adrenergic signaling in human oral keratinocytes and wound repair. J Dent Res 2011;90(2):186–92. 30. Shang ZJ, Liu K, Liang de F. Expression of beta2-adrenergic receptor in oral squamous cell carcinoma. J Oral Pathol Med 2009;38(4):371–6. 31. Goncharova EA, Khavin IS, Goncharov DA, Krymskaya VP. Differential effects of formoterol on thrombin- and PDGFinduced proliferation of human pulmonary arterial vascular smooth muscle cells. Respir Res 2012;13:109.