Biochemical properties of an intracellular serpin from Echinococcus multilocularis

Molecular & Biochemical Parasitology 156 (2007) 84–88

Short communication

Biochemical properties of an intracellular serpin from Echinococcus multilocularis Armin Merckelbach ∗ , Andreas Ruppel Department of Tropical Hygiene and Public Health, University Clinic Heidelberg, Im Neuenheimer Feld 324, 69 120 Heidelberg, Germany Received 14 May 2007; received in revised form 17 July 2007; accepted 18 July 2007 Available online 24 July 2007

Abstract A serpin of the intracellular type from the tapeworm Echinococcus multilocularis was expressed in Escherichia coli, purified by ion exchange chromatography and tested for inhibitory activity against several proteinases. The recombinant protein, which after transcriptional induction, represents about 20 % of total cellular protein, is biochemically active and inhibits trypsin and the trypsin-like plasmin as well as pig pancreatic and human neutrophil elastase. Implications regarding its biochemistry and biolological function are discussed. © 2007 Elsevier B.V. All rights reserved. Keywords: Echinococcus; Multilocularis; Serpin; Intracellular; Recombinant; Reactive center loop; RCL

Serpins (serine proteinase inhibitors) constitute a huge family of proteins. More than 1500 members have been identified on the basis of sequence similarity [1]. Phylogenetic analysis revealed several major clades of serpins among vertebrates. The two largest clades comprise extracellular and intracellular molecules, respectively. Extracellular serpins, which contain some of the best characterized mammalian serpins, are found in the circulation where they participate in the regulation of proteinases from immune effector cells, the blood coagulation and the complement system. Intracellular or ovalbumin-type serpins are less comprehensively characterized and seem to be active in a wider range of processes [2–4]; one prominent function may be the prevention of proteolytic damage in proteinase-synthesizing cells [5–8]. Invertebrate serpins usually group according to species or phylum, or they appear as orphans [2,3]. Echinococcus multilocularis, the causative agent of alveolar echinococcosis in humans [9], belongs to the Cestoda, and the serpin characterized here (serpinEmu ) is the first member described from this class of the Platyhelminthes [10]. Cole and coworkers analyzed a serpin from the jellyfish Cyanea capilAbbreviations: serpinEmu , serpin of Echinococcus multilocularis; RCL, reactive center loop; N-Cl-Suc, N-chloro-succinimide; PE, pancreatic elastase; NE, neutrophil elastase. ∗ Corresponding author. Tel.: +49 6202 54176; fax: +49 6221 565948. E-mail address: [email protected] (A. Merckelbach). 0166-6851/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.molbiopara.2007.07.013

lata and showed that this serpin is related to the echinococcal gene. Both were placed as orphans on neighbouring branches at the base of a phylogenetic tree, otherwise composed of plant, arthropod and mammalian antithrombin-like serpins [11]. Based on sequence similarity, the echinococcal protein can be identified as an intracellular serpin: the cDNA does not contain a signal sequence, nor N- or C-terminal extensions. The amino acid-sequence shows no N-glycosylation sites and easily aligns with mammalian members of intracellular serpins [10]. We expressed the gene in Escherichia coli, and tested the inhibitory potential of the recombinant serpin with a number of mammalian proteinases from the cellular immune defense, the blood clotting and the digestive systems. The plasmid clone pUC2209 contains the original cDNA of serpinEmu [10]. After removing a 3 -fragment containing the polyA-tail, the coding region was amplified with the proof-reading DNA-polymerase from Pyrococcus woesei, using the 54mer CAATTTCACACAGGAAACAGCTATGGGATCCTTTGCCAAAACTAGCTTCATTCC as the forward and the 22mer CCAGGGTTTTCCCAGTCACGAC as the reverse primer. The 54mer spans the 5 -end of the serpincoding sequence and introduces an in-frame-BamHI restriction site 3 to the start codon. The 22mer spans the HindIII site, located in the lac-␣-fragment of pUC18. The PCR product was ligated into the vector pQE16 via the respective BamHI and HindIII sites. Transformants of E. coli SG13009 (pREP4) were

A. Merckelbach, A. Ruppel / Molecular & Biochemical Parasitology 156 (2007) 84–88

tested for expression, and the clone pQE220903 was chosen for further analysis. Re-sequencing of the serpin gene showed consistency with the original serpin cDNA except for the 5 -end, where, due to the subcloning procedure, three additional codons (RGS) had become inserted 3 to the start codon. Positions of amino acids discussed in the text are numbered according to the original sequence of serpinEmu [Accession number Q8WT41]. Culturing of E. coli strain SG13009 (pQE220903, pREP4) for the expression of serpinEmu was done in TBY containing 2.5 mM KCl, 10 mM MgSO4 , 10 mM MgCl2 , 80 ␮g ampicillin and 25 ␮g kanamycin/ml at 37 ◦ C on a rotary shaker up to an OD600 of about 0.8. Then the culture was centrifuged and the bacterial pellet resuspended in the original volume of fresh medium without kanamycin but with 1.6–2 mM IPTG. After 2.5–3 h of culturing under inducing conditions, pQE220903 showed strong expression of a protein with the expected size of 42 kDa, which approximated to 20% of total cellular protein. For purification, the bacterial pellet of an induced culture was washed and taken up in a maximum of 0.1 vol of the original culture in extraction buffer: 20 mM Tris–HCl (pH 8.0), 0.1 M NaCl, 1 mM EDTA, 5 mM ␤-mercatoethanol, 5 ␮M E64, 0.8 mM AEBSF, 3 ␮M pepstatin. The resuspended bacteria were frozen at −80 ◦ C and, upon thawing, sonified. After centrifugation for 20 min at 4 ◦ C, the 20,000 × g supernatant was applied to a DEAE-Sephacel-column. The flow-through was collected and the column eluted with 1 vol of 20 mM Tris–HCl (pH 8.0), 0.12 M NaCl. Fractions were checked for serpinEmu by SDSPAGE, and those containing significant amounts of serpinEmu were pooled, diluted to a NaCl concentration of 35 mM and reloaded onto a DEAE-column, equilibrated with the same NaCl concentration. SerpinEmu was again eluted as above. Serpincontaining fractions were pooled and ␤-mercaptoethanol was added up to a concentration of 1 mM. Aliquots were stored at −20 ◦ C. The preparation of recombinant protein used in the presented experiments contained minor contaminating bands, revealed by SDS-PAGE, which were estimated visually to represent 10–15% of the total protein (data not shown). To determine the biochemical specificity of serpinEmu and the stoichiometries of inhibition, proteinase-activity assays with p-nitroanilide-coupled peptides were done in 96-well tissueculture plates: a fixed amount of proteinase was preincubated for 15 min with varying amounts of inhibitor in 50 ␮l of the appropriate buffer at room temperature (23–25 ◦ C). The proteolytic reaction was started by adding further buffer including the substrate up to the final volume of 0.2 ml; for neutrophil elastase (NE) and cathepsin G, the NaCl concentration for the hydrolytic reaction was increased concomitantly. The plate was incubated at 37 ◦ C and the reaction was followed by determining the absorption values at 405 nm in an ELISA reader at fixed time intervals. Total reaction times varied between 30 and 120 min, depending on the activity of the proteinase and the absorbance reached. Reaction velocities were determined in the linear range. All assays were done in triplicate. Amounts of proteinases used, buffer compositions and substrate concentrations are given in the table. The enzymes were used as specified by the suppliers. The residual activities were expressed as percentages of the uninhibited activity and plotted against the quotient of the molar

85

concentrations of serpinEmu to proteinase. The stoichiometry of inhibition was approximated by linear regression. Fig. 1 shows the results of the inhibition tests. The stoichiometry of inhibition lies near two for trypsin and pancreatic elastase (PE), between five and six for NE and between eight and nine for plasmin. Thrombin was only slightly inhibited by

Fig. 1. Inhibitory effect of the serpinEmu on different proteinases; (A) residual activities are plotted as percent values of the uninhibited proteinase activity (100%) against the quotient of the concentrations of serpinEmu to proteinase. Points tested three times or more are given as the mean ± 1 S.D. (closed circles); single or double measurements are given as open circles; (B) Inhibitory capacity of serpinEmu after treatment with N-Cl-Suc. Residual activities are given as percent values of the uninhibited proteinase activity (100%): after preincubation with untreated serpin (S-), serpin, treated with a 50–400-fold molar excess of N-Cl-Suc (S-xNCS) and buffer, treated with an amount of N-Cl-Suc equal to a 400-fold molar excess (400xNCs). SerpinEmu was used in 2.0 and 4.9 molar excess over trypsin and neutrophil elastase, respectively. Shown are the averages of two or three experiments, the latter ones together with one standard deviation.

86

A. Merckelbach, A. Ruppel / Molecular & Biochemical Parasitology 156 (2007) 84–88

Table 1 Data of the different proteinases tested and the conditions of reaction Enzyme

[nM]

Binding- // reaction buffer

Serpin [nM]

Substrate [mM]

Cathepsin G Human, 60 U/mg Chymotrypsin Bovine, 67 U/mg Neutrophil elastase Human, 36 U/mg Pancreatic elastase Porcine, 251 U/mg Plasmin Human, 3.4 U/mg Thrombin Bovine, 2740 U/mg Trypsin Porcine, 17000 U/mg

[18] (Si) [6.0] (Se) [8.5] (Se) [6.0] (Se) [9.0] (Si) [2.7] (Si) [2.1] (Si)

50 mM Tris–HCl (pH 7.6) 0.15 M NaCl // 0.5 M NaCl 50 mM Tris–HCl (pH 8.0) 0.1 M NaCl, 5 mM CaCl2 50 mM Tris–HCl (pH 7.9) 0.15 M NaCl // 0.5 M NaCl 0.15 M Tris–HCl (pH 7.9)

[18–71]

3-Carboxy-propionyl-AAPF-pNA, [2]

[7–22]

3-Carboxy-propionyl-AAPF-pNA, [1]

[8.5–42]

3-Methoxysuccinyl- AAPV-pNA, [1]

[3.6–18]

20 mM Tris–HCl (pH 8.2) 0.15 M NaCl 20 mM Tris–HCl (pH 8.2) 0.15 M NaCl, 0.1% PEG 6000 50 mM Tris–HCl (pH 8.0) 0.1 M NaCl, 5 mM CaCl2

[12–71]

T-butyloxycarbonyl-AAPA-pNA, [1] Sarcosyl-PR-pNA, [1]

[4.8–15] Sarcosyl-PR-pNA, [0.5] [1.2–4.8] T-butyloxycarbonyl-LGR-pNA, [0.5]

Origin, specific activity and source of the tested enzymes (Se, Serva; Si, Sigma) appear in the first column. Concentrations of enzymes, serpin and substrates are given in square brackets and refer to the final test volume of 0.2 ml. Different NaCl concentrations, used in the binding (preincubation) and reaction (hydrolysis) buffer, are separated by a double slash. Amino acids of the peptide substrates (Bachem) are given in bold characters, pNA: p-nitroanilide.

serpinEmu while no inhibition was detected with cathepsin G and chymotrypsin (Fig. 1A). Under the conditions of buffer and substrates used for the activity assays, 20 nM serpin alone (representing a medium concentration, see Table 1) did not cause detectable hydrolysis of the pNA-peptides. To determine whether serpinEmu inhibited the proteinases in the classical manner, the formation of SDS-resistant complexes between serpinEmu and the proteinases trypsin, PE, NE and chymotrypsin were analysed by SDS-PAGE. Proteinase (1.7–2.1 ␮M) and serpinEmu (2.4–3.6 ␮M) were incubated in a vol of 20 ␮l of the appropriate buffer at room temperature. Controls contained either the proteinase or the serpin alone. Molar relations of serpinEmu to proteinase varied between 1.1 and 2.1. Reactions were stopped by the addition of sample buffer, giving final concentrations of SDS and ␤-mercaptoethanol of 1.5 and 5%, respectively. Samples were immediately denatured at 96 ◦ C and separated on 10% gels. Bands in the expected molecular weight range of 62–68 kDa were present in the Coomassie-stained gels. However, in addition to the bands corresponding to proteinase, serpin and serpin-proteinase complex, a band corresponding in size to a serpin released by a proteinase after cleavage of the C-terminal peptide (4 kDa for serpinEmu ), as well as weaker bands around 50 kDa, indicating partially degraded complexes were detected in these gels. In accordance with the inhibition tests, incubation of serpinEmu with chymotrypsin did not result in the formation of a complex, but led to complete conversion of the inhibitor to the lower molecular weight form (Fig. 2). Two classes of serine proteinases were inhibited by serpinEmu in our experiments, which indicates that different amino acids in the reactive center loop (RCL) may function as targets for the attacking enzymes, a feature, seen in several intracellular serpins [4]. With reference to the amino acid sequence of ␣-1proteinase inhibitor (␣-1-antitrypsin), R344 can be identified as the P1 residue of serpinEmu ; valine is found at P2 and cysteine at P1 . They are surrounded by three methionines (MMV R344 CM). Arginine at P1 could explain readily the inhibition of trypsin and

plasmin since these proteinases cleave their substrates with high specificity after basic amino acids; similarly, the intracellular serpin B6 (human) inhibits trypsin via a P1–R [5]. By contrast, NE and PE cleave preferentially after the aliphatic residues.

Fig. 2. Formation of SDS-resistant complexes between various proteinases and serpinEmu . The molecular weights of the marker proteins are given in kDa; the position of serpinEmu is marked by the arrow. (A) lanes 1–5: (1) 1 ␮g trypsin; (2) trypsin, 2 mM 4-(2-aminoethyl)-benzenesulfonyl-flouride (AEBSF) and 2 ␮g serpinEmu (added after 3 min of reaction between trypsin and AEBSF); (3) trypsin with 2 ␮g serpinEmu ; (4) trypsin with 3 ␮g serpinEmu ; (5) 1 ␮g serpinEmu ; 15 min preincubation at room temperature. (B) lanes 6–11 show 1 ␮g of proteinase, preincubated, respectively without and with 3 ␮g serpinEmu : pancreatic elastase, neutrophil elastase, chymotrypsin; (12) 1 ␮g serpinEmu ; 5 min preincubation at room temperature.

A. Merckelbach, A. Ruppel / Molecular & Biochemical Parasitology 156 (2007) 84–88

Since human NE is inhibited by ␣-1-proteinase inhibitor through P1–M and by the intracellular serpin B1 via P1–C, R344 would be an unusual target for this proteinase and the related PE. Instead, they could attack serpinEmu at C345 or, even more probably at one of the aliphatic residues found at P2 or P3 [4–6,14]. Given these possibilities, we evaluated the effects of two chemical modifications on the activity of serpinEmu : carboxymethylation of cysteine and oxidation of methionine residues. Beside C345 at the P1 position, serpinEmu contains one additional cysteine at position 175. For carboxymethylation of the cysteine residues, 7.5 ␮M serpinEmu (in 20 mM Tris–HCl (pH 8.0), 0.1 M NaCl) was treated with a 400-fold molar excess of iodoacetamide (3 mM), for 10 min at room temperature. The reaction was stopped by adding ␤-mercaptoethanol up to 4 mM and incubating for another 5 min. The incubation with the proteinases was done subsequently; a treatment of serpinEmu with 2 mM ␤-mercaptoethanol only was used as a control [12]. Carboxymethylation did not cause any decrease in binding of serpinEmu to proteinases, as judged by SDS-PAGE. This was observed for three enzymes tested: trypsin, NE and PE. Carboxymethylation of serpinEmu , followed by an activity test with trypsin and NE did not have any effect either (data not shown). Oxidation of serpinEmu using N-chloro-succinimide (N-ClSuc) was performed in order to investigate whether one of the methionines around R344 is the reactive amino acid for the elastolytic enzymes [13]. The echinococcal protein contains 16 methionines in total, four of them in the RCL. The protein was incubated at a concentration of 4.7 ␮M with increasing amounts of N-Cl-Suc (in 0.11 M Tris–HCl (pH 8.5), 40 mM NaCl) for 10–15 min at room temperature; controls of serpinEmu , incubated without N-Cl-Suc, and N-Cl-Suc-treated buffer were run in parallel. Preincubation (5–10 min) and hydrolytic reaction were done as before with molar relations of 2.0 and 4.9 for serpinEmu over trypsin and NE, respectively. An influence by NCl-Suc on the inhibitory activity was not observed until a molar excess of 50–100 was reached. Oxidation at a 400-fold molar excess of N-Cl-Suc to protein, equivalent to a 25-fold excess per mol methionine, led to the inactivation of serpinEmu in its interaction with NE, but also with trypsin. The inhibitory potential of serpinEmu was reduced from 90–95% (untreated) to about 25%, corresponding to a recovery of 75% of uninhibited enzyme activity. N-Cl-Suc-treated buffer did not influence the hydrolytic activity of the proteinases (Fig. 1B). While the abolition of inhibitory activity towards NE would indeed indicate that these proteinases attack serpinEmu at one of the three methionines, seeing the same effect with trypsin renders this result ambiguous. Thus, either R344 is not the reactive amino acid for trypsin or the complete oxidation of three closely spaced methionines blocks the access of proteinases to the RCL in an unspecific way. The high concentration of N-Cl-Suc necessary to neutralize serpinEmu , could also be interpreted in the sense that V343 at P2 is the principal reactive amino acid for the elastases; the proposed unspecific blockade would then hold true of the elastases as well, since valine is not oxidised by N-Cl-Suc [14]. These results as well as the bands of the cleaved serpinEmu and partially degraded complexes, seen in the electrophoretic anal-

87

ysis may be a sign of suboptimal interaction between serpinEmu and the tested proteinases which most probably are not the primary targets of the echinococcal serpin. The extension of the RCL of serpinEmu by one amino acid, compared to the intracellular serpins B1 and B6, and by three amino acids compared to ␣-1-proteinase inhibitor, could contribute to a higher variability of residues becoming attacked by proteinases [15]. In cestodes, including E. multilocularis, the oncosphere hatching from the egg, infects its host by penetration of the intestinal wall. The involvement of proteinases in this process has not been demonstrated, but the presence of serpinEmu in this developmental stage may be a hint to their existence. Oncospheres have an extended excretion apparatus [16] and proteinases could make up a considerable portion of excreted proteins during the penetration process. The proteinase content of metacestodes, the second larval stage following the oncosphere, was investigated by White and coworkers in Taenia solium, a related cestode species [17]. They demonstrated activities of metallo, aspartic and cysteine proteinases, but not of serine proteinases. This could be due to a real absence of serine proteinases from the proteolytic repertoire of metacestodes or, as the authors suggested, be the result from effective blocking of such enzymes by specific inhibitors. In oncospheres, the function of serpinEmu could be similar to that of the human intracellular serpin B9 in cytotoxic lymphocytes. Serpin B9 is present in the cytoplasm of these immune effector cells, apparently protecting them against proteinases, which can leak from their own secretory vesicles [7,8]. If serpinEmu would be a similar means of protection, the serine proteinases shown to be inhibited in this work, could hint to the enzymes synthesized by oncosperes of cestodes. The specificity of serpin–proteinase interaction would allow the use of serpinEmu as a tool to determine proteinases of E. multilocularis that could be the authentic targets of serpinEmu . It seems remarkable that two digestive enzymes of the intestine of mammals, trypsin and PE, were most readily inhibited (PE has no counterpart in humans but a homologue is present in rodents, the natural intermediate hosts of E. multilocularis). Therefore, an extracellular role of serpinEmu should also be envisaged: plasminogen-activator inhibitor 2 represents an intracellular serpin that can be secreted by monocytes through a pathway independent of the endoplasmatic reticulum and the Golgi apparatus [18]. The serpin from the tick Ixodes ricinus, a protein without signal sequence as well and most similar to serpinEmu , is excreted into the saliva of this ectoparasite [19]. If the serpin of E. multilocularis were excreted during the infection phase of the oncosphere, it might be able to block the proteolytic attack of host digestive enzymes. If so, it could even be a target of the intestinal immune system and a vaccine candidate. References [1] Law RH, Zhang Q, McGowan S, et al. An overview of the serpin superfamily. Genome Biol 2006;7:216.1–11. [2] Irving JA, Pike RN, Lesk AM, Whisstock JC. Phylogeny of the serpin superfamily: implications of patterns of amino acid conservation for structure and function. Genome Res 2000;10:1845–64.

88

A. Merckelbach, A. Ruppel / Molecular & Biochemical Parasitology 156 (2007) 84–88

[3] Krem MM, Di Cera E. Conserved Ser residues, the shutter region, and speciation in serpin evolution. J Biol Chem 2003;278:37810–4. [4] Silverman GA, Whisstock JC, Askew DJ, et al. Human clade B serpins (ov-serpins) belong to a cohort of evolutionarily dispersed intracellular proteinase inhibitor clades that protect cells from promiscuous proteolysis. Cell Mol Life Sci 2004;61:301–25. [5] Riewald M, Schleef RR. Human cytoplasmic antiproteinase neutralizes rapidly and efficiently chymotrypsin and trypsin-like proteases utilizing distinct reactive site residues. J Biol Chem 1996;271:14526–32. [6] Cooley J, Takayama TK, Shapiro SD, Schechter NM, Remold-O’Donnell E. The serpin MNEI inhibits elastase-like and chymotrypsin-like serine proteases through efficient reactions at two active sites. Biochemistry 2001;40:15762–70. [7] Hirst CE, Buzza MS, Bird CH, et al. The intracellular granzyme B inhibitor, proteinase inhibitor 9, is up-regulated during accessory cell maturation and effector cell degranulation, and its overexpression enhances CTL potency. J Immunol 2003;170:805–15. [8] Zhang M, Park SM, Wang Y, et al. Serine protease inhibitor 6 protects cytotoxic T cells from self-inflicted injury by ensuring the integrity of cytotoxic granules. Immunity 2006;24:451–61. [9] Vuitton DA, Zhang SL, Yang Y, et al. Survival strategy of Echinococcus multilocularis in the human host. Parasitol Int 2006;(55 Suppl): S51–5. [10] Merckelbach A, Wager M, Lucius R. Analysis of cDNAs coding for immunologically dominant antigens from an oncosphere-specific cDNA library of Echinococcus multilocularis. Parasitol Res 2003;90:493–501.

[11] Cole EB, Miller D, Rometo D, et al. Identification and activity of a lower eukaryotic serine proteinase inhibitor (serpin) from Cyanea capillata: analysis of a jellyfish serpin, jellypin. Biochemistry 2004;43:11750–9. [12] Remold-O’Donnell E, Nixon JC, Rose RM. Elastase inhibitor. Characterization of the human elastase inhibitor molecule associated with monocytes, macrophages, and neutrophils. J Exp Med 1989;169:1071–86. [13] Johnson D, Travis J. The oxidative inactivation of human alpha-1proteinase inhibitor. Further evidence for methionine at the reactive center. J Biol Chem 1979;254:4022–6. [14] Travis J, Owen M, George P, et al. Isolation and properties of recombinant DNA produced variants of human alpha 1-proteinase inhibitor. J Biol Chem 1985;260:4384–9. [15] Zhou A, Carrell RW, Huntington JA. The serpin inhibitory mechanism is critically dependent on the length of the reactive center loop. J Biol Chem 2001;276:27541–7. [16] Lethbridge RC. The biology of the oncosphere of Cyclophyllidean Cestodes. Helminthol Abstr 1980;49:59–72. [17] White Jr AC, Molinari JL, Pillai AV, Rege AA. Detection and preliminary characterization of Taenia solium metacestode proteases. J Parasitol 1992;78:281–7. [18] Ritchie H, Booth NA. Secretion of plasminogen activator inhibitor 2 by human peripheral blood monocytes occurs via an endoplasmic reticulumgolgi-independent pathway. Exp Cell Res 1998;242:439–50. [19] Prevot PP, Adam B, Zouaoui Boudjeltia K, et al. Anti-haemostatic effects of a serpin from the saliva of the tick Ixodes ricinus. J Biol Chem 2006;281:26361–9.