- Email: [email protected]
Bone formation in trabecular bone cell seeded scaffolds used for reconstruction of the rat mandible
Int. J. Oral Maxillofac. Surg. 2009; 38: 166–172 doi:10.1016/j.ijom.2008.11.018, available online at http://www.sciencedirect.com
Leading Research Paper Tissue Engineering
Bone formation in trabecular bone cell seeded scaffolds used for reconstruction of the rat mandible
H. V. J. N.
Schliephake1, N. Zghoul2, Ja¨ger2, M. van Griensven3, Zeichen3, M. Gelinsky4, Szubtarsky1
1 Department of Oral and Maxillofacial Surgery, George-Augusta-University, Go¨ttingen, Germany; 2Helmholtz Centre for Infection Research, Braunschweig, Germany; 3 Department of Experimental Trauma Surgery, Hannover Medical School, Hannover, Germany; 4Max Bergmann Center of Biomaterials, Technical University Dresden, Institute of Material Science, Dresden, Germany
H. Schliephake, N. Zghoul, V. Ja¨ger, M. van Griensven, J. Zeichen, M. Gelinsky, N. Szubtarsky: Bone formation in trabecular bone cell seeded scaffolds used for reconstruction of the rat mandible. Int. J. Oral Maxillofac. Surg. 2009; 38: 166–172. # 2008 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved. Abstract. This study tested whether different in vitro cultivation techniques for tissueengineered scaffolds seeded with human trabecular bone cells affect in vivo bone formation when implanted into critical-size defects in rat mandibles. Human trabecular cells were isolated and seeded into three types of scaffolds (porous CaCO3, mineralized collagen, porous tricalcium phosphate). Four in vitro groups were produced: empty control scaffolds incubated with cell culture medium for 24 h; scaffolds seeded with trabecular bone cells, cultivated under static conditions for 24 h; scaffolds seeded with trabecular bone cells, cultivated for 14 days under static conditions; scaffolds seeded with trabecular bone cells, cultivated for 14 days in a continuous flow perfusion bioreactor. The scaffolds were implanted press fit into non-healing defects, 5 mm diameter, in rat mandibles. After 6 weeks the presence of human cells was assessed; none were detected. Histomorphometric evaluation showed that neither seeding human trabecular bone cells nor the culturing technique increased the amount of early bone formation compared with the level provided by osteoconductive bone ingrowth from the defect edges. It is concluded that human bone marrow stroma cells in tissue-engineered scaffolds and associated in vitro technology are difficult to test in the mandible in animal models.
Many cell-based approaches have been used in tissue engineering for skeletal reconstruction in the craniofacial area in preclinical animal models1,4,5,11,14,23,26,27,30,37,38,39,42. Numerous types of carriers, with variable architec0901-5027/020166 + 07 $30.00/0
ture and composition, such as resorbable polymers20, demineralized allogeneic bone39, inorganic bovine bone28, platelet rich plasma40, collagen matrices7 and calcium alginate30 have been employed as cell carriers. All experimental approaches
Keywords: bone marrow stroma cells scaffolds; osteogenesis; dynamic culturing. Accepted for publication 10 November 2008 Available online 3 January 2009
have used autogenous bone marrow stroma cells (BMSCs) seeded into scaffolds and implanted into a skeletal site in the craniofacial area. Most of them have been successful in enhancing bone formation in the seeded scaffolds when
# 2008 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Bone formation in trabecular bone cell seeded scaffolds compared with unseeded controls. Larger models with clinically relevant defects have been tested successfully using autogenous BMSC. Osteogenesis in these large scaffolds occurred mainly in the outer areas of the carriers indicating non-homogenous distribution of cells and a predominantly osteoconductive pattern of bone formation28. Loading the scaffolds with cells has been accomplished by droplet seeding with subsequent culturing under static conditions for variable periods of time. This type of seeding is associated with inferior penetration of the scaffolds by the seeded cells22. As spatial distribution of the seeded cells is considered to be of great importance for the in vivo formation of bone9, it has become necessary to improve the efficacy of the in vitro procedures during the process of scaffold development. Advanced in vitro seeding and culturing of BMSCs have shown that low pressure or vacuum seeding32,34 and dynamic culturing in bioreactors have resulted in deeper scaffold penetration as well as enhanced production and improved composition of bone matrix9,10. The effect of dynamic culturing on bone formation by BMSCs in craniofacial reconstruction has not been elucidated. Human trabecular bone cells have not been evaluated for their potential to contribute to craniofacial bone regeneration. This study aimed to test two hypotheses: human trabecular bone cells are effective in a tissue-engineered approach to mandibular bone repair in athymic rats; and dynamic culturing in bioreactors can improve bone formation inside the implanted scaffolds. Materials and methods Cells
Human trabecular bone cells were obtained from cancellous femur bone after ablative surgery for total knee arthroplasty. The cancellous bone was harvested from areas away from the joint pathology from the resected portions of the proximal femur bone. Ethical approval to use these specimens was obtained from the local regulatory board. The cancellous bone portions were minced and placed onto Petri dishes with ZKT-I medium15 (DIF 1000 w/o protein supplements, Biochrom, Berlin, Germany) supplemented with 15% fetal bovine serum (FBS; Gibco, Paisley, UK). Cells were passaged at a subconfluent stage using 0.25% trypsin–0.1% EDTA solution and continued during the subsequent passages on ZKT-I medium,
15% FBS until there were 5 106 cells. At the end of the culturing period, positive markers of osteoblastic differentiation (alkaline phosphatase and von Kossa staining) proved the cells to be committed to the osteoblastic lineage.
167
from Groups II through IV each were immediately probed for human DNA analysis by removing a portion about 8 mm3 from the scaffolds. The scaffolds were fixated immediately in 4% buffered formalin solution for further histological processing.
Scaffolds, seeding and culturing
Three types of cylindrical scaffolds, 5 mm in diameter and 3 mm thick, were used: porous calcium carbonate scaffolds derived from corals (Biocoral1, Inoteb, St Connery, France); custom-made porous scaffolds of mineralized collagen8; porous tricalcium phosphate (TCP) scaffolds (Cerasorb1, Curasan, Kleinostheim, Germany). Droplet seeding was performed at a density of 5 106 cells/cm3 scaffold. Four groups of scaffolds were produced. Group I: empty control scaffolds kept under static culture conditions for 24 h (24-well plates, standard conditions (37 8C, 12% CO2). Group II: scaffolds seeded with human trabecular bone cells and cultivated under static conditions for 24 h. Group III: scaffolds seeded with human trabecular bone cells cultivated for 14 days under static conditions. Group IV: scaffolds seeded with human trabecular bone cells cultivated for 14 days in a bioreactor. The bioreactor was composed of a perfusion chamber in a 30 ml conditioning vessel, connected to peristaltic pumps for fresh medium supply and circulation through the scaffold materials. The perfusion chambers were equipped with a custom-made insert to accommodate 9 scaffolds each. The system was equipped with on-line oxygen measurement and controlled areation in the conditioning vessel3. Surgical procedure
The scaffolds were implanted press fit into non-healing defects, 5 mm in diameter, in the mandibles of 30 athymic nude rats (Crl:RNU-Foxn1 rnu, 5–7 weeks old, Charles River Laboratories, Sulzfeld, Germany, weight range 216–334 g). 5 rats received one scaffold material each from Group I on one side and from Group II on the other side. Another 5 rats each received scaffolds of the three materials from Groups III and IV in the same locations. After 6 weeks of implantation the scaffolds were retrieved and 2 scaffolds
Human DNA analysis
The presence of human cells was proved by the presence of human-specific DNA in the rat tissue using polymerase chain reaction (PCR). PCR amplification of the asatellite fragment of human chromosome 17 (876 bp), which does not exist in rats, was performed21,35. Total genomic DNA was isolated from the samples containing scaffolds and rat tissue, using QIAamp DNA Micro Kit following the protocol for purification of genomic DNA from bones (QIAGEN; user developed protocol). For each PCR, 500 ng genomic DNA was used as an amplification template. All PCR reactions were carried out in a volume of 25 ml containing GoTaq1 Green Master Mix and 10 pmol of each, forward and reverse, primer. PCR amplification of a centrosome-specific fragment of 17a and glyceraldehyde-3-phosphate dehydrogenase pseudogene (GAPDH) as house keeping gene was achieved using GGGATAATTTCAGCTGACTAAACAG and ACC ACA GTC CAT GCC ATC AC as the forward primers, respectively, and TTCCGTTTAGTTAGGTGCAGTTATC and TCC ACC ACC CTG TTG GTC TA as the reverse primers, respectively. PCR amplification was performed according to the following protocol: denaturation at 94 8C for 10 min, 35 cycles of 60 s cycles of denaturation at 94 8C and annealing/extension at 60 8C21, GAPDH: single denaturation step of 95 8C for 4 min followed by 35 cycles of 95 8C 45 s, 53 8C 45 s, 72 8C 45 s. Both PCR programs ended with additional elongation steps at 72 8C for 10 min and chill down to 4 8C. PCR products were analyzed using agarose gel electrophoresis (1% agarose gels) and visualized by ethidium bromide staining under UV light. Genomic DNA samples from human placenta (SIGMA) and DNA isolated from human bone using QIAamp DNA Micro Kit (QIAGEN; user developed protocol) were used as a positive control, and genomic DNA isolated from rat tail was the negative control. In the positive control, PCR amplification down to 0.005 ng of human DNA was measurable. To prove the sensitivity of the method, a standard curve was generated from human genomic DNA (pla-
168
Schliephake et al.
centa) from concentrations of 100 to 0.01 ng/ml. Histologic work-up
The scaffolds were dehydrated in ascending alcohol and embedded in methylmethacrylate (Technovit 91001, Kulzer, Germany). Undecalcified sections were fabricated6 and surface stained with alizarin-methylene blue. The micrographic images were digitized using a video camera (Axiocam, Zeiss, Oberkochen, Germany) at magnifications of 100X and bone formation was quantified using a grid with a square size of 100 mm projected into the viewing field. Planimetry was not used for quantification because the staining of the newly formed bone was difficult to distinguish from the mineralized scaffold in many locations. Two sections through the centre of each scaffold were evaluated. The section plane was oriented parallel to the inferior border of the mandibles. The error of the histometric procedure was calculated according to the stereological equation28,36: If a bone tissue portion between 5 and 25% is assumed, and the number of counts per scaffold was 3000 (1500 squares in 2 sections) the relative error should vary between 2.3 and 5.4%, which was considered acceptable. Statistics
Intra-individual differences between the mean values of bone formation after static and dynamic culturing and differences between these groups and the controls were evaluated using Student’s t-test and a one-way ANOVA. Differences were considered to be significant if p < 0.05. Results Human DNA analysis
RT-PCR revealed that only one of the probed scaffolds was positive for human DNA (Group VI: CaCO3 scaffold; dynamic culturing for 14 days) indicating that most of the grafted cells could no longer be detected at the end of the observation period (Fig. 1). Histologic results
The calcium carbonate scaffolds seeded with trabecular bone cells and cultured for 24 h under static conditions (Group II) exhibited thin layers of immature bone tissue lined by high numbers of osteoblasts. The remaining pores were filled
Fig. 1. Gel electrophoresis of RT-PCR products for human DNA (arrow: expected band size 876 bp). Top row: only specimen No. 18 showed a positive reaction that indicated the presence of human DNA. (negative control: specimen No. 19, empty control: specimen C). Bottom row: standard curve generated from human genomic DNA (placenta) from concentrations of 100 ng/ ml (A) to 0.01 ng/ml (J).
with highly vascular and cellular tissue (Fig. 2a and b). Unseeded control scaffolds (Group I) exhibited small areas of bone formation that penetrated the scaffolds from the local bone adjacent to the scaffold. Calcium carbonate scaffolds implanted after 14 days of static culture (Group III) showed comparable formation of bone and cartilage tissue. Bone tissue appeared to be very immature and highly cellular (Fig. 2c and d). Dynamically cultured scaffolds (Group IV) exhibited comparable features, with small islands of bone formation scattered across the scaffolds independent of the adjacent host bone (Fig. 2e and f). Mineralized collagen scaffolds with static culturing for 24 h prior to implantation exhibited thin layers of mineralized matrix along the walls of the scaffold and small islands of bone formation in a few locations. Multinuclear giant cells attached to the mineralized collagen scaffold were seen in all specimens (Fig. 3a). In non-seeded scaffolds, comparable features were seen with no bone formation in 2 animals and scattered islands of bone formation. The pattern of bone ingrowth was predominantly osteoconductive from the adjacent bone surfaces (Fig. 3b). The same held true for the scaffolds submitted to static or dynamic culturing for 14 days. Small spots of bone formation were spread across the scaffold in three specimens from Group IV (dynamic culturing). Bone formation started from the
centre of the scaffold in the remaining two scaffolds (Fig. 3c). Scaffolds of TCP exhibited osteoconductive bone ingrowth in non-seeded scaffolds and in scaffolds cultured with trabecular bone cells for 24 h. In one case, bone formation had bridged the gap from the margins, but did not fill the complete scaffold volume (Fig. 4a and b). Scaffolds, after 14 days of static and dynamic culturing, showed comparable features with an osteoconductive pattern of bone formation and small isolated islands of osteoneogenesis of young immature bone (Fig. 4c). Histomorphometry
Bone formation in the scaffolds seeded with human trabecular bone cells and cultured for 24 h reached a bone volume density of 19.7% (SD 6.7), non-seeded scaffolds produced 15.1% (SD 8.3) (Fig. 5). Statistically, this difference was not significant (p = 0.196). Static culturing of CaCO3 scaffolds resulted in 7.2% (SD 5.8) bone density, whereas the scaffolds with 14 days of dynamic culture exhibited 8.7% (SD 5.1); this difference was not significant (p = 0.123). Mineralized collagen scaffolds, after 24 h of culturing, showed 21.3% of bone volume (SD 15.1), un-seeded controls produced 16.2% (SD 4.7) of bone volume. Static versus dynamic culturing of the mineralized collagen scaffolds for 14 days produced 10.3% (SD 6.0) and 12.5% (SD 8.5), respectively. Differences were not
Bone formation in trabecular bone cell seeded scaffolds
Fig. 2. (a) Micrograph exhibiting bone formation in an area that covers approximately 25% of the cross-sectional area of a CaCO3 scaffold implanted after 24 h of cell attachment. Local bone at the defect margin can be seen at the upper left corner. New bone formation commences from the scaffold surface and extends into the center of the scaffold (alizarine methylene blue, magnification 50X). (b) Micrograph showing a close-up view of the newly formed bone, exhibiting immature bone tissue and widespread commencement of mineralization (alizarine methylene blue, magnification 200). (c) Micrograph exhibiting bone formation in CaCO3 scaffolds after 14 days of static culturing. Note highly cellular soft tissue surrounding the scaffold (alizarine methylene blue, magnification 50). (d) Micrograph showing a high power view of bone formation with a mixture of angiogenic bone formation and centripetal bone growth from the scaffold walls (alizarine methylene blue, magnification 200). (e) Micrograph exhibiting bone formation in CaCO3 scaffolds after 14 days of dynamic culturing with a typical combination of osteoconductive bone in growth and appositional formation in a concentric manner (alizarine methylene blue, magnific ation 50). (f) Micrograph showing a close-up view of the osteogenesis in the scaffold pores. Both thin seams of osteoid and osteoblasts are present and a highly cellular tissue with diffuse intercellular calcification forming immature bone tissue (alizarine methylene blue, magnification 200).
statistically significant (p = 0.629: control versus 24 h culture; p = 0.123: static versus dynamic). TCP scaffolds showed the highest values of bone formation. They achieved almost identical results in Groups I and II: 20.9% (SD 11.0) in scaffolds cultured for 24 h versus 21.6% (SD 7.8) in empty scaffolds, with no significant difference (p = 0.872). Scaffolds submitted to static culture produced 14.6% (SD 12.6) and those with dynamic culture exhibited 22.8% (SD 14.3), with no significant difference (p = 0.223).
There was no significant difference between the three materials under the different in vitro conditions (empty scaffolds, p = 0.205; cultured for 24 h, p = 0.813; static culture for 14 days, p = 0.363; dynamic culture for 14 days, p = 0.079). Discussion
Despite a decade of research in tissue engineering, there are few reports about the in vivo formation of bone by human
169
BMSCs or mesenchymal stem cells grafted to skeletal sites24,31. Positive results have been reported for ectopic bone formation after subcutaneous or intramuscular implantation into immunocompromised rodents2,17–19,40,41. The fact that the seeded cells have not been able to enhance bone formation in orthotopic sites in mandibular defects has to be considered carefully. The number of cells seeded onto the scaffolds has been in a range used in many other studies that reported successful bone formation2,17. The final differentiation of the cells at the end of the 2 week culturing period may be considered uncertain and raises the question of whether cells used for bone tissue engineering should be seeded and transplanted in the early stages of osteogenic commitment or as fully differentiated osteoblasts. As fully differentiated cells are likely to undergo apoptosis, a lack of effect of the cells used in the present study could be attributed to the fact that cells in the advanced stages of osteoblastic differentiation have been transplanted. A previous study with two of the three scaffold materials, using human trabecular bone cells derived and treated in the same way and seeded under identical seeding density and culturing conditions, showed bone formation after transplantation to ectopic sites. Bone formation in that study was strongly dependent on the scaffold material, because the cells produced considerable amounts of bone in CaCO3 scaffolds but no bone formation was found in the mineralized collagen scaffolds29. The present study appears to contradict these results, in that none of the seeded scaffold materials had a positive effect on bone formation when implanted into non-healing defects in rat mandibles. Although there was a trend for higher mean values in Group II for the seeded CaCO3 scaffolds and mineralized collagen scaffolds when compared with unseeded controls, the differences lacked statistical significance owing to the high degree of variation in individual results. The difference was almost equalled in the porous TCP scaffolds of these groups. The results indicate that seeding with human trabecular bone cells may have an effect when tested in ectopic sites that are devoid of any osteoregenerative capacity, but that the potential of this type of cell is not strong enough to enhance bone formation above the level provided by osteoconductive bone ingrowth from adjacent defect edges in orthotopic sites. The lack of enhancement of bone formation through seeded human marrow stroma cells or stem cells has been reported previously in experimental
170
Schliephake et al.
Fig. 3. (a) Micrograph showing bone formation in the mineralized collagen scaffolds submitted to 24 h of cell attachment. Small islands of bone formation were scattered across the crosssection. Osteoblasts forming bone were present as well as osteoclasts and multi-nuclear giant cells attached to the scaffold (alizarine methylene blue, magnification 200). (b) Micrograph showing bone formation in a mineralized collagen scaffold after 14 days of static culturing. The osteoconductive bone ingrowth is appreciable from the pattern of bone formation (alizarine methylene blue, magnification 50). (c) Micrograph showing bone formation in a mineralized collagen scaffold after 14 days of dynamic culturing. Multiple small spots of bone formation are visible (alizarine methylene blue, magnification 50).
Fig. 4. (a) Micrograph showing bone formation in a TCP scaffold submitted to 24 h of cell attachment. Bone had formed across the entire scaffold length but did not fill the cross-section completely (alizarine methylene blue, magnification 50). (b) Close-up view showing bone formation in the TCP scaffold. Bone formation has integrated the scaffold particles and contained chondroid cells (alizarine methylene blue, magnification 50). (c) Micrograph showing isolated islands of bone formation in TCP scaffolds after 14 days of dynamic culturing with adjacent multinuclear giant cells during scaffold degradation (alizarine methylene blue, magnification 200).
reports that have used genetically modified human marrow-derived stroma cells24 and mesenchymal stem cells33 overexpressing bone morphogenetic proteins (BMPs). In these studies, native or reporter gene-transfected cells were used as controls and failed to produce significantly increased amounts of bone in ectopic33 or orthotopic sites24 or their contribution to ectopic bone formation was negligible13. The comparison of static and dynamic culturing for 14 days did not show a positive effect for dynamic culturing on in vivo bone formation because all scaffold materials yielded almost identical results when comparing Groups III and VI. Failure of dynamic culturing to yield better in vivo results may be explained by the fact that the volume of the scaffolds was small. Homogenous distribution of oxygen and nutrients during the in vitro procedures of scaffold fabrication through dynamic culturing is considered to be beneficial for osteogenic differentiation in vitro9 and for subsequent bone formation in vivo12,16, but it may only become effective in scaffolds of larger size. The size of the scaffolds was limited by the immuno-compromised animal model, which did not allow for larger non-loaded defects and is not available for larger animals. This limits the possibilities for testing BMSCs of human origin, in particular with respect to models of clinically relevant size. Human genomic DNA could only be detected in one of the tested scaffold specimens. This requires careful consideration of the methods used. The results were derived from RT-PCR, which has been able to identify the respective satellite fragment of human chromosome 17 after appropriate amplification. PCR is very sensitive but it is associated with the loss of the analyzed sample volume which makes topographic or structural identification impossible. The use of in situ hybridization of histologic specimens would have been more appropriate, but the current methods of specimen preparation do not allow the use of undecalcified thick section specimens. The negative results could be attributed to a sampling error. The small samples obtained from the scaffolds and analysed for human DNA did not represent the complete scaffold volume in each of the animals. It is unlikely that sampling failed in all but one scaffold, however, indicating that few human cells were present in the scaffolds at the time of evaluation. The seeded cells could have contributed to bone formation during the first weeks of transplantation, but the present result
Bone formation in trabecular bone cell seeded scaffolds
8.
9.
10. Fig. 5. Quantitative assessment of bone formation.
raises the question of survival of seeded human cells in implanted scaffolds. As the animals were immuno-incompetent and supposed to tolerate human cells, problems with oxygen and nutritional supply are the most likely reasons to account for the disappearance of the seeded cells. Results derived from animal marrow stroma cells are difficult to compare with human cells. Human marrow stroma cells are reported to be more delicate with regard to reaction to scaffold material than rodent cells18. Human mesenchymal stem cells are sensitive to serum and oxygen deprivation, which resulted in cell death in vitro when applied in combination for 48 h25. The trabecular bone cells used in the present study cannot be compared directly with human BMSCs or mesenchymal stem cells with respect to their behaviour after transplantation in tissueengineered scaffolds. These cells would be expected to be at least as critical with regard to oxygen and serum supply as fully differentiated cells are more likely to undergo spontaneous apoptosis than cells in the early stages of differentiation. To the knowledge of the authors, the present study reports the first use of human trabecular bone cells in mandibular reconstruction in immuno-compromised rats. Within the limitations of the study it has to be concluded that despite their ability to induce ectopic bone formation, trabecular bone cells have not enhanced bone formation in orthotopic sites in mandibular defects. In vitro fabrication procedures are difficult to evaluate in these models owing to small scaffold volume and questionable cell survival. In order to accomplish final preclinical validation of the successful application of trabecular bone cells in clinically relevant craniofacial defects, novel transplantation methods and appropriate animal models will have to be developed.
Acknowledgements. The authors wish to thank Dr. Johanna Napp for performing the PCR analyses. This study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Schl 368/10-1 & 102 as well as MA 852/7-2 & 7/3).
References 1. Abukawa H, Shin M, Williams WB, Vacanti JP, Kaban LB, Troulis MJ. Reconstruction of mandibular defects with autologous tissue-engineered bone. J Oral Maxillofac Surg 2004: 62: 601– 605. 2. Arinzeh TL, Tran T, Mcalary J, Daculsi G. A comparative study of biphasic calcium phosphate ceramics for human mesenchymal stem cellinduced bone formation. Biomaterials 2005: 26: 3631–3638. 3. Barthold M, Majore I, Fargali S, Stahl F, Schulz R, Lose S, Mayer H, Ja¨ger V. 3-D cultivation and characterization of osteogenic cells for the production of highly viable bone tissue implants. Godia F, Fussenegger M (eds) Animal cell technology meets genomics, Springer, Dordrecht, Netherlands 2005, 199–205. 4. Bruder SP, Kraus KH, Goldberg VM, Kadiyala S. The effect of implants oaded with autologous mesenchymal stem cells on the healing of canine segmental bone defects. J Bone Joint Surg A 1998: 80: 985–996. 5. De Kok IJ, Drapeau SJ, Young R, Cooper LF. Evaluation of mesenchymal stem cells following implantation in alveolar sockets: A canine safety study. Int J Oral Maxillofacial Impl 2005: 20: 511–518. 6. Donath K, Breuner G. A method for the study of Undecalcified bones and teeth with attached sot tissues. The Sa¨ge-Schliff (sawing and grinding) technique. J Oral Pathol 1982: 11: 318–326. 7. Edwards PC, Ruggiero S, Fantasia J, Burakoff R, Moorji SM, Paric E, Razzano P, Grande DA, Mason JM. Sonic hedehog gene-enhanced tissue engineer-
11.
12.
13.
14.
15.
16.
17.
171
ing for bone regeneration. Gene Ther 2005: 12: 75–86. Gelinsky M, Ko¨nig U, Sewing A, Pompe W. Porous scaffolds made of mineralized collagen – a biomimetic bone graft material. Mater Sci Eng Technol 2004: 35: 229–236. Gomes ME, Sikavitsas VI, Behravesh E, Reis RL, Mikos A. Efect of flow perfusion on the osteogenic differentiation of bone marrow stromal cells cultured on starch-based three-dimensional scaffolds. J Biomed Mater Res 2003: 67A: 87–95. Gomes ME, Bossano CM, Johnston CM, Reis RL, Mikos AG. In vitro localization of bone growth factors in constructs of biodegradable scaffolds seeded with marrow stromal cells and cultured in a flow perfusion bioreactor. Tissue Eng 2006: 12: 177–188. Groger A, Klaring S, Merten HA, Holste J, Kaps C, Sittinger M. Tissue engineering of bone for mandibular augmentation in immunocompetent minipigs: preliminary study. Scand J Plast Reconstr Surg Hand Surg 2003: 37: 129–133. Hofmann S, Hagenmu¨ller H, Koch AM, Mu¨ller R, Vunjak-Novakovic G, Kaplan DL, Merkle HP, Meinel L. Control of in vitro tissue-engineered bone-like structures using human mesenchymal stem cells and porous silk scaffolds. Biomaterials 2007: 28: 1152– 1162. Huang YC, Kaigler D, Rice DG, Krebsbach PH, Mooney DJ. Combined angiogenic and osteogenic factor delivery enhances bone marrow stroma cell driven bone regeneration. J Bone Miner Res 2005: 20: 848–857. Ito K, Yamada Y, Nagasaka T, Baba S, Ueda M. Osteogenic potential of injectable tissue-engineered bone: a comparison among autogenous bone, bone substitute (Bio-oss), platelet-rich plasma, and tissueengineered bone with respect to their mechanical and histologic findings. J Biomed Mater Res 2005: 73: 63–72. Ja¨ger V, Lehmann J, Friedl P. Serumfree growth medium for the cultivation of a wide spectrum of mammalian cells in stirred bioreactors. Cytotechnology 1988: 1: 319–329. Janssen FW, Oostra J, Orschot A, van Blitterswijk CA. A perfusion bioreactor system capable of producing clinically relevant volumes of tissue-engineered bone: in vivo bone formation showing proof of concept. Biomaterials 2006: 27: 315–323. Kasten P, Vogel J, Luginbbuhl R, Niemeyer P, Tonak M, Lorenz H, Helbig L, Weiss S, Fellenberg J, Leo A, Simank HG, Richter W. Ectopic bone formation associated with mesenchymal stem cells in a resorbable calcium deficient hydroxylapatite carrier. Biomaterials 2005: 26: 5879–5889.
172
Schliephake et al.
18. Krebsbach P, Kusnetsov SA, Satomura K, Emmons RVB, Rowe DWM, Robey PG. Bone formation in vivo: Comparison of osteogenesis by transplantated mouse and human marrow stromal fibroblasts. Transplantation 1997: 63: 1059– 1069. 19. Kusnetzov SA, Krebsbach PH, Satomura K, Kerr J, Riminucci M, Benayahu D, Robey PG. Single-colony derived strains of human marrow stroma fibroblasts form bone after transplantation in vivo. J Bone Miner Res 1997: 12: 1335–1347. 20. Marei MK, Nouh SR, Saad MM, Ismail NS. Preservation and regeneration of alveolar bone by tissue-engineered implants. Tissue Eng 2005: 11: 751–767. 21. Mo¨best D, Goan SR, Junghahn I, Winkler J, Fichtner I, Becker M, de Lima-Hahn E, Mertelsmann R, Henschler R. Differential Kinetics of Primitive Hematopoietic Cells Assayed In Vitro and In Vivo During Serum-Free Suspension Culture of CD34+ Blood Progenitor Cells. Stem Cells 1999: 17: 152– 161. 22. Niemeyer P, Krause U, Fellenberg J, Kasten P, Seckinger A, Ho AD, Simank HG. Evaluation of mineralized collagen and alpha-tricalcium phosphate as scaffolds for tissue engineering of bone using human mesenchymal stem cells. Cells Tissues Organs 2004: 177: 68–78. 23. Ohya M, Yamada Y, Ozawa R, Ito K, Takahashi M, Ueda M. Sinus floor elevation applied tissue-engineered bone. Comparative study between mesenchymal stem cells/platelet-rich plasma PRP) and autogenous bone with PRP complexes in rabbits. Clin Oral Impl Res 2005: 16: 622–629. 24. Peterson B, Iglesias R, Zhang J, Wang JC, Lieberman JR. Genetically modified human derived bone marrow cells for posterolateral limbar spine fusion in athymic rats. Beyond conventional autologous bone grafting. Spine 2005: 30: 283–290. 25. Potier E, Ferreira E, Meunier A, Sedel L, Logaert-Avramoglou D, Petite H. Prolonged hypoxia concomi-
26.
27.
28.
29.
30.
31.
32.
33.
34.
tant with serum depravation induces massive human mesenchymal cell death. Tissue Eng 2007: 13: 1325–1331. Ren T, Ren J, Jia X, Pan K. The bone formation in vitro and mandibular defect repair using PLGA porous scaffolds. J Biomed Mater Res A 2005: 74: 562–569. Schantz JT, Hutmacher DW, Lam CX, Brinkmann M, Wong KM, Lim TC, Chou N, Guldberg RE, Teoh SE. Repair of calcarial defects with customised tissueengineered grafts II. Evaluation of cellular efficiency and efficacy in vivo. Tissue Eng 2003: 9(Suppl S1):S127–139. Schliephake H, Knebel J, Aufderheide M, Tauscher M. Use of cultivated osteoprogenitor cells to increase bone formation in segmental mandibular defects - an experimental pilot study in mini pigs. Int J Oral Maxillofac Surg 2001: 30: 531–537. Schliephake H, Zghoul N, Ja¨ger V, van Griensven M, Zeichen J, Gelinsky M, Szubtarsky N. Effect of seeding technique and scaffold material on bone formation in tissue engineered constructs. J Biomed Mater Res 2008, June 3 [Epub ahead of print]. Shang Q, Wang Z, Liu W, Shi Y, Cui L, Cao Y. Tissue-engineered bone repair of sheep cranial defects with autologous bone marrow stromal cells. J Craniofac Surg 2001: 12: 586–593. Shimizu K, Ito A, Yoshida T, Yamada Y, Ueda M, Honda H. Bone tissue engineering with human mesenchymal stem cell sheets constructed using magnetite nanoparticles and magnetic force. J Biomed Mater Res 2007: 82: 471–480. Sochaga LA, Tognana E, Penick K, Baskaran H, Goldberg VM, Caplann AI, Welter JF. A rapid seeding technique for the assembly of large cell/scaffold composite constructs. Tissue Eng 2006: 12: 1851–1862. Tsuda H, Wada T, Yamashita T, Hamada H. Enhanced osteoinduction by mesenchymal stem cells transfected with a fiber-mutant adenoviral BMP2 gene. J Gene Med 2005: 7: 1322–1334. Wang J, Asou Y, Sekiya I, Sotome S, Orii H, Shinomiya K. Enhancement of
35.
36. 37.
38.
39.
40.
41. 42.
tissue engineered bone formation by a low pressure system improving cell seeding and medium perfusion into a porous scaffold. Biomaterials 2006: 27: 2738– 2746. Warburton PE, Greig GM, Haaf T et al. PCR amplification of chromosome-specific alpha-satellite DNA: definition of centromeric STS markers and polymorphic analysis. Genomics 1991: 11: 324–333. Weibel ER. Morphometry of the human lung. Berlin: Springer 1963: p. 21. Wu W, Chen X, Mao T, Chen F, Feng X. Bone marrow-derived osteoblasts seeded into porous beta-tricalcium phosphate to repair segmental defect in canine’s mandibula. Ulus Travma Acil Cerrahi Derg 2006: 12: 268–275. Xi Q, Bu RF, Liu HC, Mao TQ. Reconstruction of caprine Mandibular segmental deect by tissue egnieered bone reinforced by titanium reticulum. Chin J Traumatol 2006: 9: 67–71. Xiao Y, Qian H, Young WG, Bartold PM. Tissue engineering for bone regeneration using differentiated alveolar bone cells in collagen scaffolds. Tissue Eng 2003: 9: 1167–1177. Yamada Y, Ueda M, Hibi H, Nagasaki T. Translatioanl research for injectable tissue-engineered bone regeneration using mesenchymal stem cells and platelet-rich plasma: from basic research to clinical case study. Cell Transplant 2004: 13: 343–355. Yamada Y, Hata K, Ueda M. Injectable bone. Clin Calcium 2002: 12: 228–232. Yuan J, Cui L, Zhang WJ, Liu W, Cao Y. Repair of canine Mandibular bone defects with bone marrow stromal cells and porous beta-tricalcium phosphate. Biomaterials 2007: 28: 1005–1013.
Address: Henning Schliephake Department of Oral and Maxillofacial Surgery George-Augusta-University Robert-Koch-Str. 40 37075 Go¨ttingen Germany
Leading Research Paper Tissue Engineering
Bone formation in trabecular bone cell seeded scaffolds used for reconstruction of the rat mandible
H. V. J. N.
Schliephake1, N. Zghoul2, Ja¨ger2, M. van Griensven3, Zeichen3, M. Gelinsky4, Szubtarsky1
1 Department of Oral and Maxillofacial Surgery, George-Augusta-University, Go¨ttingen, Germany; 2Helmholtz Centre for Infection Research, Braunschweig, Germany; 3 Department of Experimental Trauma Surgery, Hannover Medical School, Hannover, Germany; 4Max Bergmann Center of Biomaterials, Technical University Dresden, Institute of Material Science, Dresden, Germany
H. Schliephake, N. Zghoul, V. Ja¨ger, M. van Griensven, J. Zeichen, M. Gelinsky, N. Szubtarsky: Bone formation in trabecular bone cell seeded scaffolds used for reconstruction of the rat mandible. Int. J. Oral Maxillofac. Surg. 2009; 38: 166–172. # 2008 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved. Abstract. This study tested whether different in vitro cultivation techniques for tissueengineered scaffolds seeded with human trabecular bone cells affect in vivo bone formation when implanted into critical-size defects in rat mandibles. Human trabecular cells were isolated and seeded into three types of scaffolds (porous CaCO3, mineralized collagen, porous tricalcium phosphate). Four in vitro groups were produced: empty control scaffolds incubated with cell culture medium for 24 h; scaffolds seeded with trabecular bone cells, cultivated under static conditions for 24 h; scaffolds seeded with trabecular bone cells, cultivated for 14 days under static conditions; scaffolds seeded with trabecular bone cells, cultivated for 14 days in a continuous flow perfusion bioreactor. The scaffolds were implanted press fit into non-healing defects, 5 mm diameter, in rat mandibles. After 6 weeks the presence of human cells was assessed; none were detected. Histomorphometric evaluation showed that neither seeding human trabecular bone cells nor the culturing technique increased the amount of early bone formation compared with the level provided by osteoconductive bone ingrowth from the defect edges. It is concluded that human bone marrow stroma cells in tissue-engineered scaffolds and associated in vitro technology are difficult to test in the mandible in animal models.
Many cell-based approaches have been used in tissue engineering for skeletal reconstruction in the craniofacial area in preclinical animal models1,4,5,11,14,23,26,27,30,37,38,39,42. Numerous types of carriers, with variable architec0901-5027/020166 + 07 $30.00/0
ture and composition, such as resorbable polymers20, demineralized allogeneic bone39, inorganic bovine bone28, platelet rich plasma40, collagen matrices7 and calcium alginate30 have been employed as cell carriers. All experimental approaches
Keywords: bone marrow stroma cells scaffolds; osteogenesis; dynamic culturing. Accepted for publication 10 November 2008 Available online 3 January 2009
have used autogenous bone marrow stroma cells (BMSCs) seeded into scaffolds and implanted into a skeletal site in the craniofacial area. Most of them have been successful in enhancing bone formation in the seeded scaffolds when
# 2008 International Association of Oral and Maxillofacial Surgeons. Published by Elsevier Ltd. All rights reserved.
Bone formation in trabecular bone cell seeded scaffolds compared with unseeded controls. Larger models with clinically relevant defects have been tested successfully using autogenous BMSC. Osteogenesis in these large scaffolds occurred mainly in the outer areas of the carriers indicating non-homogenous distribution of cells and a predominantly osteoconductive pattern of bone formation28. Loading the scaffolds with cells has been accomplished by droplet seeding with subsequent culturing under static conditions for variable periods of time. This type of seeding is associated with inferior penetration of the scaffolds by the seeded cells22. As spatial distribution of the seeded cells is considered to be of great importance for the in vivo formation of bone9, it has become necessary to improve the efficacy of the in vitro procedures during the process of scaffold development. Advanced in vitro seeding and culturing of BMSCs have shown that low pressure or vacuum seeding32,34 and dynamic culturing in bioreactors have resulted in deeper scaffold penetration as well as enhanced production and improved composition of bone matrix9,10. The effect of dynamic culturing on bone formation by BMSCs in craniofacial reconstruction has not been elucidated. Human trabecular bone cells have not been evaluated for their potential to contribute to craniofacial bone regeneration. This study aimed to test two hypotheses: human trabecular bone cells are effective in a tissue-engineered approach to mandibular bone repair in athymic rats; and dynamic culturing in bioreactors can improve bone formation inside the implanted scaffolds. Materials and methods Cells
Human trabecular bone cells were obtained from cancellous femur bone after ablative surgery for total knee arthroplasty. The cancellous bone was harvested from areas away from the joint pathology from the resected portions of the proximal femur bone. Ethical approval to use these specimens was obtained from the local regulatory board. The cancellous bone portions were minced and placed onto Petri dishes with ZKT-I medium15 (DIF 1000 w/o protein supplements, Biochrom, Berlin, Germany) supplemented with 15% fetal bovine serum (FBS; Gibco, Paisley, UK). Cells were passaged at a subconfluent stage using 0.25% trypsin–0.1% EDTA solution and continued during the subsequent passages on ZKT-I medium,
15% FBS until there were 5 106 cells. At the end of the culturing period, positive markers of osteoblastic differentiation (alkaline phosphatase and von Kossa staining) proved the cells to be committed to the osteoblastic lineage.
167
from Groups II through IV each were immediately probed for human DNA analysis by removing a portion about 8 mm3 from the scaffolds. The scaffolds were fixated immediately in 4% buffered formalin solution for further histological processing.
Scaffolds, seeding and culturing
Three types of cylindrical scaffolds, 5 mm in diameter and 3 mm thick, were used: porous calcium carbonate scaffolds derived from corals (Biocoral1, Inoteb, St Connery, France); custom-made porous scaffolds of mineralized collagen8; porous tricalcium phosphate (TCP) scaffolds (Cerasorb1, Curasan, Kleinostheim, Germany). Droplet seeding was performed at a density of 5 106 cells/cm3 scaffold. Four groups of scaffolds were produced. Group I: empty control scaffolds kept under static culture conditions for 24 h (24-well plates, standard conditions (37 8C, 12% CO2). Group II: scaffolds seeded with human trabecular bone cells and cultivated under static conditions for 24 h. Group III: scaffolds seeded with human trabecular bone cells cultivated for 14 days under static conditions. Group IV: scaffolds seeded with human trabecular bone cells cultivated for 14 days in a bioreactor. The bioreactor was composed of a perfusion chamber in a 30 ml conditioning vessel, connected to peristaltic pumps for fresh medium supply and circulation through the scaffold materials. The perfusion chambers were equipped with a custom-made insert to accommodate 9 scaffolds each. The system was equipped with on-line oxygen measurement and controlled areation in the conditioning vessel3. Surgical procedure
The scaffolds were implanted press fit into non-healing defects, 5 mm in diameter, in the mandibles of 30 athymic nude rats (Crl:RNU-Foxn1 rnu, 5–7 weeks old, Charles River Laboratories, Sulzfeld, Germany, weight range 216–334 g). 5 rats received one scaffold material each from Group I on one side and from Group II on the other side. Another 5 rats each received scaffolds of the three materials from Groups III and IV in the same locations. After 6 weeks of implantation the scaffolds were retrieved and 2 scaffolds
Human DNA analysis
The presence of human cells was proved by the presence of human-specific DNA in the rat tissue using polymerase chain reaction (PCR). PCR amplification of the asatellite fragment of human chromosome 17 (876 bp), which does not exist in rats, was performed21,35. Total genomic DNA was isolated from the samples containing scaffolds and rat tissue, using QIAamp DNA Micro Kit following the protocol for purification of genomic DNA from bones (QIAGEN; user developed protocol). For each PCR, 500 ng genomic DNA was used as an amplification template. All PCR reactions were carried out in a volume of 25 ml containing GoTaq1 Green Master Mix and 10 pmol of each, forward and reverse, primer. PCR amplification of a centrosome-specific fragment of 17a and glyceraldehyde-3-phosphate dehydrogenase pseudogene (GAPDH) as house keeping gene was achieved using GGGATAATTTCAGCTGACTAAACAG and ACC ACA GTC CAT GCC ATC AC as the forward primers, respectively, and TTCCGTTTAGTTAGGTGCAGTTATC and TCC ACC ACC CTG TTG GTC TA as the reverse primers, respectively. PCR amplification was performed according to the following protocol: denaturation at 94 8C for 10 min, 35 cycles of 60 s cycles of denaturation at 94 8C and annealing/extension at 60 8C21, GAPDH: single denaturation step of 95 8C for 4 min followed by 35 cycles of 95 8C 45 s, 53 8C 45 s, 72 8C 45 s. Both PCR programs ended with additional elongation steps at 72 8C for 10 min and chill down to 4 8C. PCR products were analyzed using agarose gel electrophoresis (1% agarose gels) and visualized by ethidium bromide staining under UV light. Genomic DNA samples from human placenta (SIGMA) and DNA isolated from human bone using QIAamp DNA Micro Kit (QIAGEN; user developed protocol) were used as a positive control, and genomic DNA isolated from rat tail was the negative control. In the positive control, PCR amplification down to 0.005 ng of human DNA was measurable. To prove the sensitivity of the method, a standard curve was generated from human genomic DNA (pla-
168
Schliephake et al.
centa) from concentrations of 100 to 0.01 ng/ml. Histologic work-up
The scaffolds were dehydrated in ascending alcohol and embedded in methylmethacrylate (Technovit 91001, Kulzer, Germany). Undecalcified sections were fabricated6 and surface stained with alizarin-methylene blue. The micrographic images were digitized using a video camera (Axiocam, Zeiss, Oberkochen, Germany) at magnifications of 100X and bone formation was quantified using a grid with a square size of 100 mm projected into the viewing field. Planimetry was not used for quantification because the staining of the newly formed bone was difficult to distinguish from the mineralized scaffold in many locations. Two sections through the centre of each scaffold were evaluated. The section plane was oriented parallel to the inferior border of the mandibles. The error of the histometric procedure was calculated according to the stereological equation28,36: If a bone tissue portion between 5 and 25% is assumed, and the number of counts per scaffold was 3000 (1500 squares in 2 sections) the relative error should vary between 2.3 and 5.4%, which was considered acceptable. Statistics
Intra-individual differences between the mean values of bone formation after static and dynamic culturing and differences between these groups and the controls were evaluated using Student’s t-test and a one-way ANOVA. Differences were considered to be significant if p < 0.05. Results Human DNA analysis
RT-PCR revealed that only one of the probed scaffolds was positive for human DNA (Group VI: CaCO3 scaffold; dynamic culturing for 14 days) indicating that most of the grafted cells could no longer be detected at the end of the observation period (Fig. 1). Histologic results
The calcium carbonate scaffolds seeded with trabecular bone cells and cultured for 24 h under static conditions (Group II) exhibited thin layers of immature bone tissue lined by high numbers of osteoblasts. The remaining pores were filled
Fig. 1. Gel electrophoresis of RT-PCR products for human DNA (arrow: expected band size 876 bp). Top row: only specimen No. 18 showed a positive reaction that indicated the presence of human DNA. (negative control: specimen No. 19, empty control: specimen C). Bottom row: standard curve generated from human genomic DNA (placenta) from concentrations of 100 ng/ ml (A) to 0.01 ng/ml (J).
with highly vascular and cellular tissue (Fig. 2a and b). Unseeded control scaffolds (Group I) exhibited small areas of bone formation that penetrated the scaffolds from the local bone adjacent to the scaffold. Calcium carbonate scaffolds implanted after 14 days of static culture (Group III) showed comparable formation of bone and cartilage tissue. Bone tissue appeared to be very immature and highly cellular (Fig. 2c and d). Dynamically cultured scaffolds (Group IV) exhibited comparable features, with small islands of bone formation scattered across the scaffolds independent of the adjacent host bone (Fig. 2e and f). Mineralized collagen scaffolds with static culturing for 24 h prior to implantation exhibited thin layers of mineralized matrix along the walls of the scaffold and small islands of bone formation in a few locations. Multinuclear giant cells attached to the mineralized collagen scaffold were seen in all specimens (Fig. 3a). In non-seeded scaffolds, comparable features were seen with no bone formation in 2 animals and scattered islands of bone formation. The pattern of bone ingrowth was predominantly osteoconductive from the adjacent bone surfaces (Fig. 3b). The same held true for the scaffolds submitted to static or dynamic culturing for 14 days. Small spots of bone formation were spread across the scaffold in three specimens from Group IV (dynamic culturing). Bone formation started from the
centre of the scaffold in the remaining two scaffolds (Fig. 3c). Scaffolds of TCP exhibited osteoconductive bone ingrowth in non-seeded scaffolds and in scaffolds cultured with trabecular bone cells for 24 h. In one case, bone formation had bridged the gap from the margins, but did not fill the complete scaffold volume (Fig. 4a and b). Scaffolds, after 14 days of static and dynamic culturing, showed comparable features with an osteoconductive pattern of bone formation and small isolated islands of osteoneogenesis of young immature bone (Fig. 4c). Histomorphometry
Bone formation in the scaffolds seeded with human trabecular bone cells and cultured for 24 h reached a bone volume density of 19.7% (SD 6.7), non-seeded scaffolds produced 15.1% (SD 8.3) (Fig. 5). Statistically, this difference was not significant (p = 0.196). Static culturing of CaCO3 scaffolds resulted in 7.2% (SD 5.8) bone density, whereas the scaffolds with 14 days of dynamic culture exhibited 8.7% (SD 5.1); this difference was not significant (p = 0.123). Mineralized collagen scaffolds, after 24 h of culturing, showed 21.3% of bone volume (SD 15.1), un-seeded controls produced 16.2% (SD 4.7) of bone volume. Static versus dynamic culturing of the mineralized collagen scaffolds for 14 days produced 10.3% (SD 6.0) and 12.5% (SD 8.5), respectively. Differences were not
Bone formation in trabecular bone cell seeded scaffolds
Fig. 2. (a) Micrograph exhibiting bone formation in an area that covers approximately 25% of the cross-sectional area of a CaCO3 scaffold implanted after 24 h of cell attachment. Local bone at the defect margin can be seen at the upper left corner. New bone formation commences from the scaffold surface and extends into the center of the scaffold (alizarine methylene blue, magnification 50X). (b) Micrograph showing a close-up view of the newly formed bone, exhibiting immature bone tissue and widespread commencement of mineralization (alizarine methylene blue, magnification 200). (c) Micrograph exhibiting bone formation in CaCO3 scaffolds after 14 days of static culturing. Note highly cellular soft tissue surrounding the scaffold (alizarine methylene blue, magnification 50). (d) Micrograph showing a high power view of bone formation with a mixture of angiogenic bone formation and centripetal bone growth from the scaffold walls (alizarine methylene blue, magnification 200). (e) Micrograph exhibiting bone formation in CaCO3 scaffolds after 14 days of dynamic culturing with a typical combination of osteoconductive bone in growth and appositional formation in a concentric manner (alizarine methylene blue, magnific ation 50). (f) Micrograph showing a close-up view of the osteogenesis in the scaffold pores. Both thin seams of osteoid and osteoblasts are present and a highly cellular tissue with diffuse intercellular calcification forming immature bone tissue (alizarine methylene blue, magnification 200).
statistically significant (p = 0.629: control versus 24 h culture; p = 0.123: static versus dynamic). TCP scaffolds showed the highest values of bone formation. They achieved almost identical results in Groups I and II: 20.9% (SD 11.0) in scaffolds cultured for 24 h versus 21.6% (SD 7.8) in empty scaffolds, with no significant difference (p = 0.872). Scaffolds submitted to static culture produced 14.6% (SD 12.6) and those with dynamic culture exhibited 22.8% (SD 14.3), with no significant difference (p = 0.223).
There was no significant difference between the three materials under the different in vitro conditions (empty scaffolds, p = 0.205; cultured for 24 h, p = 0.813; static culture for 14 days, p = 0.363; dynamic culture for 14 days, p = 0.079). Discussion
Despite a decade of research in tissue engineering, there are few reports about the in vivo formation of bone by human
169
BMSCs or mesenchymal stem cells grafted to skeletal sites24,31. Positive results have been reported for ectopic bone formation after subcutaneous or intramuscular implantation into immunocompromised rodents2,17–19,40,41. The fact that the seeded cells have not been able to enhance bone formation in orthotopic sites in mandibular defects has to be considered carefully. The number of cells seeded onto the scaffolds has been in a range used in many other studies that reported successful bone formation2,17. The final differentiation of the cells at the end of the 2 week culturing period may be considered uncertain and raises the question of whether cells used for bone tissue engineering should be seeded and transplanted in the early stages of osteogenic commitment or as fully differentiated osteoblasts. As fully differentiated cells are likely to undergo apoptosis, a lack of effect of the cells used in the present study could be attributed to the fact that cells in the advanced stages of osteoblastic differentiation have been transplanted. A previous study with two of the three scaffold materials, using human trabecular bone cells derived and treated in the same way and seeded under identical seeding density and culturing conditions, showed bone formation after transplantation to ectopic sites. Bone formation in that study was strongly dependent on the scaffold material, because the cells produced considerable amounts of bone in CaCO3 scaffolds but no bone formation was found in the mineralized collagen scaffolds29. The present study appears to contradict these results, in that none of the seeded scaffold materials had a positive effect on bone formation when implanted into non-healing defects in rat mandibles. Although there was a trend for higher mean values in Group II for the seeded CaCO3 scaffolds and mineralized collagen scaffolds when compared with unseeded controls, the differences lacked statistical significance owing to the high degree of variation in individual results. The difference was almost equalled in the porous TCP scaffolds of these groups. The results indicate that seeding with human trabecular bone cells may have an effect when tested in ectopic sites that are devoid of any osteoregenerative capacity, but that the potential of this type of cell is not strong enough to enhance bone formation above the level provided by osteoconductive bone ingrowth from adjacent defect edges in orthotopic sites. The lack of enhancement of bone formation through seeded human marrow stroma cells or stem cells has been reported previously in experimental
170
Schliephake et al.
Fig. 3. (a) Micrograph showing bone formation in the mineralized collagen scaffolds submitted to 24 h of cell attachment. Small islands of bone formation were scattered across the crosssection. Osteoblasts forming bone were present as well as osteoclasts and multi-nuclear giant cells attached to the scaffold (alizarine methylene blue, magnification 200). (b) Micrograph showing bone formation in a mineralized collagen scaffold after 14 days of static culturing. The osteoconductive bone ingrowth is appreciable from the pattern of bone formation (alizarine methylene blue, magnification 50). (c) Micrograph showing bone formation in a mineralized collagen scaffold after 14 days of dynamic culturing. Multiple small spots of bone formation are visible (alizarine methylene blue, magnification 50).
Fig. 4. (a) Micrograph showing bone formation in a TCP scaffold submitted to 24 h of cell attachment. Bone had formed across the entire scaffold length but did not fill the cross-section completely (alizarine methylene blue, magnification 50). (b) Close-up view showing bone formation in the TCP scaffold. Bone formation has integrated the scaffold particles and contained chondroid cells (alizarine methylene blue, magnification 50). (c) Micrograph showing isolated islands of bone formation in TCP scaffolds after 14 days of dynamic culturing with adjacent multinuclear giant cells during scaffold degradation (alizarine methylene blue, magnification 200).
reports that have used genetically modified human marrow-derived stroma cells24 and mesenchymal stem cells33 overexpressing bone morphogenetic proteins (BMPs). In these studies, native or reporter gene-transfected cells were used as controls and failed to produce significantly increased amounts of bone in ectopic33 or orthotopic sites24 or their contribution to ectopic bone formation was negligible13. The comparison of static and dynamic culturing for 14 days did not show a positive effect for dynamic culturing on in vivo bone formation because all scaffold materials yielded almost identical results when comparing Groups III and VI. Failure of dynamic culturing to yield better in vivo results may be explained by the fact that the volume of the scaffolds was small. Homogenous distribution of oxygen and nutrients during the in vitro procedures of scaffold fabrication through dynamic culturing is considered to be beneficial for osteogenic differentiation in vitro9 and for subsequent bone formation in vivo12,16, but it may only become effective in scaffolds of larger size. The size of the scaffolds was limited by the immuno-compromised animal model, which did not allow for larger non-loaded defects and is not available for larger animals. This limits the possibilities for testing BMSCs of human origin, in particular with respect to models of clinically relevant size. Human genomic DNA could only be detected in one of the tested scaffold specimens. This requires careful consideration of the methods used. The results were derived from RT-PCR, which has been able to identify the respective satellite fragment of human chromosome 17 after appropriate amplification. PCR is very sensitive but it is associated with the loss of the analyzed sample volume which makes topographic or structural identification impossible. The use of in situ hybridization of histologic specimens would have been more appropriate, but the current methods of specimen preparation do not allow the use of undecalcified thick section specimens. The negative results could be attributed to a sampling error. The small samples obtained from the scaffolds and analysed for human DNA did not represent the complete scaffold volume in each of the animals. It is unlikely that sampling failed in all but one scaffold, however, indicating that few human cells were present in the scaffolds at the time of evaluation. The seeded cells could have contributed to bone formation during the first weeks of transplantation, but the present result
Bone formation in trabecular bone cell seeded scaffolds
8.
9.
10. Fig. 5. Quantitative assessment of bone formation.
raises the question of survival of seeded human cells in implanted scaffolds. As the animals were immuno-incompetent and supposed to tolerate human cells, problems with oxygen and nutritional supply are the most likely reasons to account for the disappearance of the seeded cells. Results derived from animal marrow stroma cells are difficult to compare with human cells. Human marrow stroma cells are reported to be more delicate with regard to reaction to scaffold material than rodent cells18. Human mesenchymal stem cells are sensitive to serum and oxygen deprivation, which resulted in cell death in vitro when applied in combination for 48 h25. The trabecular bone cells used in the present study cannot be compared directly with human BMSCs or mesenchymal stem cells with respect to their behaviour after transplantation in tissueengineered scaffolds. These cells would be expected to be at least as critical with regard to oxygen and serum supply as fully differentiated cells are more likely to undergo spontaneous apoptosis than cells in the early stages of differentiation. To the knowledge of the authors, the present study reports the first use of human trabecular bone cells in mandibular reconstruction in immuno-compromised rats. Within the limitations of the study it has to be concluded that despite their ability to induce ectopic bone formation, trabecular bone cells have not enhanced bone formation in orthotopic sites in mandibular defects. In vitro fabrication procedures are difficult to evaluate in these models owing to small scaffold volume and questionable cell survival. In order to accomplish final preclinical validation of the successful application of trabecular bone cells in clinically relevant craniofacial defects, novel transplantation methods and appropriate animal models will have to be developed.
Acknowledgements. The authors wish to thank Dr. Johanna Napp for performing the PCR analyses. This study was supported by the Deutsche Forschungsgemeinschaft (DFG) (Schl 368/10-1 & 102 as well as MA 852/7-2 & 7/3).
References 1. Abukawa H, Shin M, Williams WB, Vacanti JP, Kaban LB, Troulis MJ. Reconstruction of mandibular defects with autologous tissue-engineered bone. J Oral Maxillofac Surg 2004: 62: 601– 605. 2. Arinzeh TL, Tran T, Mcalary J, Daculsi G. A comparative study of biphasic calcium phosphate ceramics for human mesenchymal stem cellinduced bone formation. Biomaterials 2005: 26: 3631–3638. 3. Barthold M, Majore I, Fargali S, Stahl F, Schulz R, Lose S, Mayer H, Ja¨ger V. 3-D cultivation and characterization of osteogenic cells for the production of highly viable bone tissue implants. Godia F, Fussenegger M (eds) Animal cell technology meets genomics, Springer, Dordrecht, Netherlands 2005, 199–205. 4. Bruder SP, Kraus KH, Goldberg VM, Kadiyala S. The effect of implants oaded with autologous mesenchymal stem cells on the healing of canine segmental bone defects. J Bone Joint Surg A 1998: 80: 985–996. 5. De Kok IJ, Drapeau SJ, Young R, Cooper LF. Evaluation of mesenchymal stem cells following implantation in alveolar sockets: A canine safety study. Int J Oral Maxillofacial Impl 2005: 20: 511–518. 6. Donath K, Breuner G. A method for the study of Undecalcified bones and teeth with attached sot tissues. The Sa¨ge-Schliff (sawing and grinding) technique. J Oral Pathol 1982: 11: 318–326. 7. Edwards PC, Ruggiero S, Fantasia J, Burakoff R, Moorji SM, Paric E, Razzano P, Grande DA, Mason JM. Sonic hedehog gene-enhanced tissue engineer-
11.
12.
13.
14.
15.
16.
17.
171
ing for bone regeneration. Gene Ther 2005: 12: 75–86. Gelinsky M, Ko¨nig U, Sewing A, Pompe W. Porous scaffolds made of mineralized collagen – a biomimetic bone graft material. Mater Sci Eng Technol 2004: 35: 229–236. Gomes ME, Sikavitsas VI, Behravesh E, Reis RL, Mikos A. Efect of flow perfusion on the osteogenic differentiation of bone marrow stromal cells cultured on starch-based three-dimensional scaffolds. J Biomed Mater Res 2003: 67A: 87–95. Gomes ME, Bossano CM, Johnston CM, Reis RL, Mikos AG. In vitro localization of bone growth factors in constructs of biodegradable scaffolds seeded with marrow stromal cells and cultured in a flow perfusion bioreactor. Tissue Eng 2006: 12: 177–188. Groger A, Klaring S, Merten HA, Holste J, Kaps C, Sittinger M. Tissue engineering of bone for mandibular augmentation in immunocompetent minipigs: preliminary study. Scand J Plast Reconstr Surg Hand Surg 2003: 37: 129–133. Hofmann S, Hagenmu¨ller H, Koch AM, Mu¨ller R, Vunjak-Novakovic G, Kaplan DL, Merkle HP, Meinel L. Control of in vitro tissue-engineered bone-like structures using human mesenchymal stem cells and porous silk scaffolds. Biomaterials 2007: 28: 1152– 1162. Huang YC, Kaigler D, Rice DG, Krebsbach PH, Mooney DJ. Combined angiogenic and osteogenic factor delivery enhances bone marrow stroma cell driven bone regeneration. J Bone Miner Res 2005: 20: 848–857. Ito K, Yamada Y, Nagasaka T, Baba S, Ueda M. Osteogenic potential of injectable tissue-engineered bone: a comparison among autogenous bone, bone substitute (Bio-oss), platelet-rich plasma, and tissueengineered bone with respect to their mechanical and histologic findings. J Biomed Mater Res 2005: 73: 63–72. Ja¨ger V, Lehmann J, Friedl P. Serumfree growth medium for the cultivation of a wide spectrum of mammalian cells in stirred bioreactors. Cytotechnology 1988: 1: 319–329. Janssen FW, Oostra J, Orschot A, van Blitterswijk CA. A perfusion bioreactor system capable of producing clinically relevant volumes of tissue-engineered bone: in vivo bone formation showing proof of concept. Biomaterials 2006: 27: 315–323. Kasten P, Vogel J, Luginbbuhl R, Niemeyer P, Tonak M, Lorenz H, Helbig L, Weiss S, Fellenberg J, Leo A, Simank HG, Richter W. Ectopic bone formation associated with mesenchymal stem cells in a resorbable calcium deficient hydroxylapatite carrier. Biomaterials 2005: 26: 5879–5889.
172
Schliephake et al.
18. Krebsbach P, Kusnetsov SA, Satomura K, Emmons RVB, Rowe DWM, Robey PG. Bone formation in vivo: Comparison of osteogenesis by transplantated mouse and human marrow stromal fibroblasts. Transplantation 1997: 63: 1059– 1069. 19. Kusnetzov SA, Krebsbach PH, Satomura K, Kerr J, Riminucci M, Benayahu D, Robey PG. Single-colony derived strains of human marrow stroma fibroblasts form bone after transplantation in vivo. J Bone Miner Res 1997: 12: 1335–1347. 20. Marei MK, Nouh SR, Saad MM, Ismail NS. Preservation and regeneration of alveolar bone by tissue-engineered implants. Tissue Eng 2005: 11: 751–767. 21. Mo¨best D, Goan SR, Junghahn I, Winkler J, Fichtner I, Becker M, de Lima-Hahn E, Mertelsmann R, Henschler R. Differential Kinetics of Primitive Hematopoietic Cells Assayed In Vitro and In Vivo During Serum-Free Suspension Culture of CD34+ Blood Progenitor Cells. Stem Cells 1999: 17: 152– 161. 22. Niemeyer P, Krause U, Fellenberg J, Kasten P, Seckinger A, Ho AD, Simank HG. Evaluation of mineralized collagen and alpha-tricalcium phosphate as scaffolds for tissue engineering of bone using human mesenchymal stem cells. Cells Tissues Organs 2004: 177: 68–78. 23. Ohya M, Yamada Y, Ozawa R, Ito K, Takahashi M, Ueda M. Sinus floor elevation applied tissue-engineered bone. Comparative study between mesenchymal stem cells/platelet-rich plasma PRP) and autogenous bone with PRP complexes in rabbits. Clin Oral Impl Res 2005: 16: 622–629. 24. Peterson B, Iglesias R, Zhang J, Wang JC, Lieberman JR. Genetically modified human derived bone marrow cells for posterolateral limbar spine fusion in athymic rats. Beyond conventional autologous bone grafting. Spine 2005: 30: 283–290. 25. Potier E, Ferreira E, Meunier A, Sedel L, Logaert-Avramoglou D, Petite H. Prolonged hypoxia concomi-
26.
27.
28.
29.
30.
31.
32.
33.
34.
tant with serum depravation induces massive human mesenchymal cell death. Tissue Eng 2007: 13: 1325–1331. Ren T, Ren J, Jia X, Pan K. The bone formation in vitro and mandibular defect repair using PLGA porous scaffolds. J Biomed Mater Res A 2005: 74: 562–569. Schantz JT, Hutmacher DW, Lam CX, Brinkmann M, Wong KM, Lim TC, Chou N, Guldberg RE, Teoh SE. Repair of calcarial defects with customised tissueengineered grafts II. Evaluation of cellular efficiency and efficacy in vivo. Tissue Eng 2003: 9(Suppl S1):S127–139. Schliephake H, Knebel J, Aufderheide M, Tauscher M. Use of cultivated osteoprogenitor cells to increase bone formation in segmental mandibular defects - an experimental pilot study in mini pigs. Int J Oral Maxillofac Surg 2001: 30: 531–537. Schliephake H, Zghoul N, Ja¨ger V, van Griensven M, Zeichen J, Gelinsky M, Szubtarsky N. Effect of seeding technique and scaffold material on bone formation in tissue engineered constructs. J Biomed Mater Res 2008, June 3 [Epub ahead of print]. Shang Q, Wang Z, Liu W, Shi Y, Cui L, Cao Y. Tissue-engineered bone repair of sheep cranial defects with autologous bone marrow stromal cells. J Craniofac Surg 2001: 12: 586–593. Shimizu K, Ito A, Yoshida T, Yamada Y, Ueda M, Honda H. Bone tissue engineering with human mesenchymal stem cell sheets constructed using magnetite nanoparticles and magnetic force. J Biomed Mater Res 2007: 82: 471–480. Sochaga LA, Tognana E, Penick K, Baskaran H, Goldberg VM, Caplann AI, Welter JF. A rapid seeding technique for the assembly of large cell/scaffold composite constructs. Tissue Eng 2006: 12: 1851–1862. Tsuda H, Wada T, Yamashita T, Hamada H. Enhanced osteoinduction by mesenchymal stem cells transfected with a fiber-mutant adenoviral BMP2 gene. J Gene Med 2005: 7: 1322–1334. Wang J, Asou Y, Sekiya I, Sotome S, Orii H, Shinomiya K. Enhancement of
35.
36. 37.
38.
39.
40.
41. 42.
tissue engineered bone formation by a low pressure system improving cell seeding and medium perfusion into a porous scaffold. Biomaterials 2006: 27: 2738– 2746. Warburton PE, Greig GM, Haaf T et al. PCR amplification of chromosome-specific alpha-satellite DNA: definition of centromeric STS markers and polymorphic analysis. Genomics 1991: 11: 324–333. Weibel ER. Morphometry of the human lung. Berlin: Springer 1963: p. 21. Wu W, Chen X, Mao T, Chen F, Feng X. Bone marrow-derived osteoblasts seeded into porous beta-tricalcium phosphate to repair segmental defect in canine’s mandibula. Ulus Travma Acil Cerrahi Derg 2006: 12: 268–275. Xi Q, Bu RF, Liu HC, Mao TQ. Reconstruction of caprine Mandibular segmental deect by tissue egnieered bone reinforced by titanium reticulum. Chin J Traumatol 2006: 9: 67–71. Xiao Y, Qian H, Young WG, Bartold PM. Tissue engineering for bone regeneration using differentiated alveolar bone cells in collagen scaffolds. Tissue Eng 2003: 9: 1167–1177. Yamada Y, Ueda M, Hibi H, Nagasaki T. Translatioanl research for injectable tissue-engineered bone regeneration using mesenchymal stem cells and platelet-rich plasma: from basic research to clinical case study. Cell Transplant 2004: 13: 343–355. Yamada Y, Hata K, Ueda M. Injectable bone. Clin Calcium 2002: 12: 228–232. Yuan J, Cui L, Zhang WJ, Liu W, Cao Y. Repair of canine Mandibular bone defects with bone marrow stromal cells and porous beta-tricalcium phosphate. Biomaterials 2007: 28: 1005–1013.
Address: Henning Schliephake Department of Oral and Maxillofacial Surgery George-Augusta-University Robert-Koch-Str. 40 37075 Go¨ttingen Germany