- Email: [email protected]
Boundaries of the nutL antiterminator of coliphage lambda and effects of mutations in the spacer region between boxA and boxB
Gene, 50 (1986) 87-96 Elsevier
87
GEN 01880
Boundaries of the n&L antiterminator of coliphage lambda and effects of mutations in the spacer region between boxA and boxB (Recombinant DNA; transcriptional cloning; triple-stop codon)
controls; luc promoter; galactokinase;
termination;
plasmid vector;
Noaman Hasan and Waclaw Szybalski * McArdle Laboratory for Cancer Research, University of Wkonsin, Madiron. WI 53706 (U.S.A.) Tel. (608)262-1259 or 262-2047 (Received June 1lth, 1986) (Revision received September 15th. 1986) (Accepted September 29th, 1986)
SUMMARY
To study the relationship of sequence to function for the phage 1 nutL transcriptional antiterminator, we cloned the 354-bp H&II Iz DNA fragment (coordinates 35261-35 615; Daniels et al., in Lambda II, 1983, pp. 485-486 and 618-619) between the hat promoter and Rho-dependent or Rho-independent terminators (t) in the p,,,-f-gaZK plasmid derived from vector pK03, and assayed the guZK expression in Escherichiu coli hosts in the presence or absence of the N gene product. The 354-bp fragment displayed the complete antitermination activity, as did several shorter fragments obtained by restriction cutting, exonucleolytic deletions and ligations. The minimal length of cloned and fully active nutL comprises 43 bp and consists (in the 5’-to-3’ order) of(i) a lo-bp sequence upstream from boxA, (ii) the 8-bp boxA (5’-CGC’JCTTA-3’), (iii) the 7-bp A-B spacer between box4 and boxB; (iv) the 17-bp boxB (n&L core; 5’-AGCCCTGAAGAAGGGCA-3’) and 1-bp downstream from the nutL core. Deletion of the IO-bp sequence upstream from boxA reduces antitermination by 40%. Deletion of both that sequence and boxA reduces antitermination by 90% at both 30” C and 42°C. Most of the deletions entering boxB abolish antitermination. Also, some of the small internal deletions within the 7-bp A-B spacer region have a strong negative effect on the nutL function, when transcription is from the p,,, promoter.
* To whom correspondence addressed.
and reprint requests should be
Abbreviations: Ap, ampicillin; bp, base pair(s); CIAP, calfintestinal alkaline phosphatase; Del. or A, deletion; IPTG, isopropyl/I-D-thiogalactopyraside; LB, Luria’s broth; Mac-Ap, MacConkey base (Difco) supplemented with 50 pg Ap/ml; nt, nucleotide(s); nut, N utilization site (Salstrom and Szybalski, 1976; 1978); p. promoter; PolIk, Klenow (large) fragment of E. coliDNA polymerase I; t, terminator; TSC, triple-stop codon (Patterson et al., 1983); wt, wild type. 037%1119/86/$03.50
0 1986 Elsevier
Science Publishers
B.V. (Biomedical
INTRODUCTION
Synthesis of RNA is regulated by various control elements. Transcription originates at the promoter and is terminated at the terminator. Termination, in turn, is controlled by various antitermination systems, one of which evolved in bacteriophage 1 and consists of the c&acting antiterminator signal nut, the phage N protein, and several host factors (for Division)
88
review see Friedman and Gottesman, 1983; and Szybalski et al., 1983; 1987). The nutL element, whose location is defined by nutL_ mutations (Salstrom and Szybalski, 1976; 1978), was shown to function as an autonomous module when cloned between a promoter and a terminator (Drahos and Szybalski, 198 1). However, the sequence cloned by Drahos and Szybalski (198 1) displayed only 60% antitermination efficiency at 30°C. Moreover, it was later shown that the antitermination function of the cloned element was thermosensitive (Peltz et al., 1985), whereas this is not the case for the native n&L function. The nutL sequence cloned by Drahos and Szybalski (1981) comprised nt 35467-35 541 on the Daniels et al. (1983a,b) map, an> did cont,ain the 17-bp nutL core (box@, AGCCCTGAAGAAGGGCA, but not the so-called boxA sequence, CGCTCTTA (nt 35 542-35 549), postulated by Olson et al. (1982) to be a site of NusA protein action and a vital part of the nutR antiterminator. Moreover, it was shown by Drahos et al. (1982) that the nutL core alone (nt 35 518-35 534), prepared by chemical synthesis, has only a very weak antitermination function. These results suggested that additional DNA sequences were needed for a more complete antitermination. This was confirmed by cloning a larger (354 bp) nutL fragment of 3,DNA, and its shortened derivatives containing all the elements required for antitermination. These data were presented by Hasan and Szybalski (1984) and are cited in Peltz et al. (1985) and Szybalski et al. (1987). The above results, together with some of their inconsistencies, made it important to determine the exact boundaries of the native n&L sequence, to explore the functions of the boxA, boxB (nutL core) and boxC modules (see Fig. l), and to examine the effect of sequence changes within and between those modules. The present studies employed the pi,, promoter, but the effects of other promoters are being explored (see Hasan and Szybalski, 1986).
MATERIALS
AND METHODS
(a) Plasmids, hosts and media
The plasmids which were used as vehicles for cloning various nutL fragments are shown and
described in Fig. 1. The null-carrying constructs are shown and listed in Fig. 2 and in Tables I-IV. The following E. coli K-12 strains were employed: D1210 (Sadler et al., 1980) is a red-, la@ derivative of HB 101 (Boyer and Roulland-Dussoix, 1969). N4830galKand N5260galKcarry defective IZdBamN’cIts857dHl prophages and MBamN7N53cIts857dH1, respectively, and are galK_ derivatives (constructed by A.J. Podhajska employing transduction with phage Pl grown on gulK- cells and selection for the Gal- phenotypes; see Peltz et al., 1985) of N4830 and N5260 obtained from S. Adhya (Gottesman et al., 1980). C600K is galK_, rho+, nus+, and produces an SuII suppressor (supE44). The media are described by Brown and Szybalski (1985). (b) Cloning,
restriction
analysis
and
nuckotide
sequencing
Restriction enzymes and linkers were from commercial sources and they were used as described by manufacturers. DNA manipulations were as described by Maniatis et al. (1982). The sequences of the critical regions and junctions for all the described constructs were confirmed using the method of Maxam and Gilbert (1980).
RESULTS
(a) The experimental principle To assay the antiterminator
activity of various fragments of I DNA, we cloned them between promoter and terminator and assayed the activity of the galK gene located downstream of the terminator, using basically the same approach as that of Drahos and Szybalski (1981) and Drahos et al. (1982), but supplying the N function not only in cis but for some experiments also in trans. We used the 1acZp promoter (p,,), and the tL1 or t,,t, terminators of 1. First, we cloned into the BumHI site of the special plasmid vehicle (Fig. 1) a large (354-bp) 1 DNA Hz&II fragment containing all the postulated nutL elements, boxA, boxB and boxC. Then a series of deletions in the nutL fragment was generated and their effect on antitermination was determined by
89
measuring the GalK activity. The individual constructs are depicted and described in Figs. 1 and 2 and in Tables I-IV. We show that some sequences are essential, since their loss abolishes nutL function, whereas other sequences seem to be less important since their loss causes only moderate decreases in antitermination efficiency. The use of the p,,, promoter and the D1210 (ZucZQ)host permitted regulation of the rate of transcription by IPTG. By comparing antitermination activity at 30’ C and 42’ C we were able to assess the possible thermosensitivity of the antitermination, as observed by Peltz et al. (1985). Moreover, heating to 42’ C was used as a means to provide the transacting N function in experiments described in Tables II and IV. P A#
pNH158
(b) The boundaries of the n&L element
t
Fig. 1. Construction and structure of plasmids designed for the study of the nurL antiterminator. (A)Plasmid pNH48-2 was constructed as follows. The large HindIII-PstI fragment from plasmid pD553 (Drahos and Szybalski, 1981) was ligated with the small HindIII-PsrI fragment from plasmid pK03 (McKenney et al., 1981; employed by Drahos and Szybalski, 1981) creating plasmid pNH48 (containing the N-r,,-gulK module), which was transformed into E. coli C600, and white (GalK- ) ApR colonies of C6OO[pNH48] were selected on Mac-Ap agar. A 224bp Hind111 fragment carrying the 1acZpo (p,,) promoter and the N-terminal portion of la&Z, was excised from plasmid pKL200 obtained from Dr. K. McKenney (personal communication) and inserted into the Hind111 site of pNH48. The orientation of plac was determined by restriction analysis, and the p,,-N-t,,-galK construct was designated pNH48H. The plac function was determined by subcloning the 224-bp Hind111 fragment (bearing p,,) from pNH48H into the ZfindIII-cleaved pK03, creating pNH156, and measuring its g& expression. To convert pNH48H to pNH48-2, a synthetic oligodeoxynucleotide bearing the translational TGA triple-stop codons (TSC; see XXX box) was inserted downstream of the la& fragment (see Fig. 1A and B) in the. following steps: the HindIII-BarnHI fragment bearing TSC was excised from plasmid pKTH601 (Pattersson et al., 1983), its Hind111 terminus was converted to a SmaI terminus by ligation with a HindIII-SmaI adapter, and the resulting TSC fragment was inserted into BamHI + SmaIdigested pKL200, giving rise to plasmid pNH200; the structure and orientation of the TSC insert were confirmed by nucleotide sequencing. Then, the large PsrI fragment of pNH48H was ligated to the small PstI fragment of pNH200, generating pNH48-2. (B) Plasmid pNH159 differs horn pNH48-2 by not containing gene N and having two strong Rho-independent terminators, rLStI, instead of Rho-dependent r,, (Salstrom and
The results presented in Table I define the boundaries of the nutL antiterminator. All the nutL subunits seem to be present in the 43-bp fragment (line 13), which comprises boxA, boxB, the A-B spacer between those boxes, a IO-bp sequence upstream from bad, and 1 bp downstream from boxB. Deletion of 10 bp upstream from box,4 reduced antitermination by about 40% (line 10 vs. lines l-9). The function of this IO-bp region was not dissected any further. Deletion of 1 bp downstream from boxB together with the last base pair of boxB reduces antitermination by about 50% (line 14 vs. lines l-9).
Szybalski, 1978b). It was constructed by excising a small SmaI-SmI fragment (bearing z&,) from plasmid pD123 (Luk et al., 1982), ligating it with Sal1 linkers, and inserting it into pNH200 [see legend (A) above]. (C) Plasmid pNH158, which differs from pNH159 by not containing TSC, was constructed in the same manner as pNH159, but using pNH156 [see legend (A) above] instead of pNH200. All three plasmids (A, B, C) do not express galK, unless a nut antiterminator is inserted between plac and the terminator(s), and the N function is supplied in cis (for A) or in trans (for B and C). Arrows specify the orientation of genes and control sites. Restriction site abbreviations are: B, BornHI; H, HirrdIII; P, PsrI; R, EcoRI; S, SmaI; Sa, Sal1 (only pertinent sites are shown). The plasmids are not drawn to scale. The sequence of TSC is as follows: 5’-GGGAGCTTGCTGATTGATTGACCG CCCTCGAACGACTAACTAACTGGCCTAG BarnHI Sma I
90
35,590 DdcI
35,614 HlncII
4
1
GRCRTfiRRTRCCRCldGCGGlGRTRiTGR c 'GRTCCCG
5’-
'GRTCCCG pNH428 pNH429
v.
CRCRTCRGCRG
R
3iRCTGRCCRC
'GRTCC 4 pNH472-1
pNIi455-1 pNH456
'GRTCCC pNH472-5-l
vGRTCCCG II pNH124
vGRTCC6 pNH129
s;
pNH455-18
35,56&t
IYRTGRR V
GRTCCGG
t
pNH104-A pNH104-B pNHf04-BC pNHl04-BC
pNH5 RGCT+
Minimal
pDX1
nutL
pNH104.B
35,510
35,4 bqs
~RGCRGRRGG~TTTGG~~~RTR~GR~RCGRRGCRT~G~
pNH129 pNH428 pNH455-1 pNH472-1 pNH472-5-1
'RGCT pDX1
'~GFRTCC pNH104-A pNH105 pNH460
'RGCCG~RTCC pNH5 Fig. 2. Nucleotide sequence of the cloned nutL-bearing DNA fragment (148.bp class; Table I, line 2) and of the endpoints of various deletions. The orientation of the fragment is opposite to that on the conventional a map (see Daniels et al., 1983), with the cuts indicated by downward arrows, accordingly. Only the antisense (mRNA-like) strand is shown. All the deletions were derived from a 354-bp HlncII L DNA fragment (bp 35262-35615) cloned in the BnmHI site ofplasmid pNH48-2 (Fig. 1A). The 3’ end of ah deletions is at the HaeIII site (bp 35467), with exception of the deletion in pNHlO+B, which ends at the MtjoII site (bp 35 516). For all deletions, the adjoining sequences (including the BumHI linkers and cuts represented by downward open arrowheads) and the designations of the resulting plasmids are shown (see Table I). Most of the deletions have regenerated the Hue111site at the 3’ end with exception of those in plasmids
91
In contrast, deletions entering boti practically abolish the nutL function (lines 11 and 12). Antitermination activity mediated by all the complete nutL + sequences (lines l-9), including the 43-bp nutL+ fragment (line 13), must be optimal, since the g&K expression levels matched that observed in the terminator-less controls (lines 15-17). Also as shown In Table I, the pi,,-promoted transcription is not enhanced by the N product (line 16 vs. 17), whereas twofold to threefold stimulation was observed for the pP, pL, pR and pk pro-
pNH
moters (Drahos and Szybalski, 1981; Szybalski et al., 1983; 1987; Huet al., 1979; Hu and Szybalski, 1979; Hasan and Szybalski, 1986). The results shown in Table II generally corroborate those in Table I, although there were two major ditkences in the experimental design: (i)N product was supplied in tram by the heatinduced prophage, and (ii) the Rho-independent strong z&r terminators were used. The results in Tables I and II also show that complete antitermination can be achieved even in the
W-A, pNHIO5, pNH5, pNH104-B and pNH460. The sequences ofbox and the nutL core (box&) are framed. The minimal 43-bp nutL region present in plasmid pNH 104-B is indicated. Some of the nutL tiagments (carrying various deletions) were transferred to other plasmids (see Fig. 1) as described in the legends to Tables II, III and IV. Starting with pNH429 (354-bp nutL insert), plasmids carrying nutL fragments with various deletions were constructed as follows. pNH456: the 354-bp nufL fragment was isolated from plasmid pNH429 following digestion with HindHI + EcoRI, purified, then cut with D&I, blunted with Sl endonuclease, and ligated with BarnHI linkers (5’-CGGGATCCCG). The DNA was digested with BamHI and the excess of linkers was removed by precipitation with spermine. HCl (Hoopes and McClure, 1981). Tbe 323-bp n#L fragment was then cloned into the BumHI-cut and CIAP-treated pNH48-2, giving rise to plasmid pNH456. pNH428: the BumHI nufL fragment was isolated from pNH429, then cut with HaelI and ligated with BarnHI linkers (5’-CCGGATCCGG), with further treatment as for pNH456, above, giving rise to pNH428. pNH455-1: this plasmid was constructed from pNH456 in the manner described above for pNH428. pNH472-1, pNH472-5-1, pNH124, and pNH129: the&rmHInufL fragment ofpNH455-1 was cloned into theBamH1 site ofpNH48H (see Fig. 1A legend) giving rise to plasmid pNH455, which was used to introduce unidirectional deletions into the cloned 119-bp nutL fragment. The DNA was first digested with EcoRI, and the large EcoRI fragment was purified and then digested with endonuclease Sl. Following ligation of the BumHI linker, the resected fragments were cloned in the BumHI site of plasmid pNH48H and were later recloned in pNH48-2 (see Table I). Several tr~sfo~ants were selected on MacCo~ey-g~actose-Ap plates (Drahos and Szybalski, 1981). These clones were characterized with various restriction enzymes and the sequences of the cloned fragments were determined. Different BumHI linkers were used for constructing pNH472-1 and pNH129 (5’-CCGGATCCGG) and for pNH472-5-l and pNH124 (5’-CGGGATCCCG). pNH104A: the BamHI nutL fragment of pNH456 was treated as described above for pNH472-1 and pNH129, generating plasmid pNH103, which subsequently was digested with BumHI. The BarnHI nurL fra8ment was isolated, digested with HueHI, ligated with BumHI linkers (5’-CGGATCCG), and then treated as described for pNH456, giving rise to pNH104A. pDX1: described by Drahos and Szybalski (1981). pNH5: plasmid pDE3 (Drahos and Szybalski, 1981) was cut with EcoRI; the isolated nutL fragment was digested with AluI, ligated with BumHI linkers (5’-CCGGATCCGG), and cloned in pNH48-2 (Fig. lA), as described for pNH456. pNHlO5 and pNH460: these plasmids were derived Born pNH104-A by cutting with EcoRI + HindIII. The resulting nutL fragment carried the 5’-CCGGATCCGGATGAAGGTGA sequence containing the F&I-recognition site (underlined), the 5’-portion of which, CCGGATCCGG, is the BarnHI linker fused to the I sequence ATGAAGGTGA..... The EcoRI-Hind111 nurL fragment was digested with FokI, and cohesive ends were blunted (a) by filling-in with PolIk (for pNHlO5) or (b) by digestion with E. coli DNA polymerase I (for pNH460). A EarnHI linker (5’-CGGATCCG) was added, with further treatment as for pNH456, above. pNHlOCB and pNH104-BC: both plasmids were derived from pNH104 (see Table I, footnote b) by isolating the EcoRI-Hind111 nurL fragment and digesting it with MboII. The cohesive ends were removed with Si endonuciease, the fragment was cut with SmaI and cloned into the SmaI site of pNH48H (see Fig. 1A legend). Two clones with diflerent 3’ ends were obtained, one contained a 43-bp nutL fragment (pNH143) and the other a 41-bp nutL fragment (pNH141). The nutL fragment from these two plasmids was excised by BumHI and cloned into the BumHI site of pNH48-2, giving rise to plasmids pNH104-B and pNH104-BC, respectively. pNH455-18, pNH455-4A and pNH455-2A: these plasmids are the internal deletion derivatives of plasmid pNH455-1, which was digested with HtidIII. The IIindIII fragment containing the 119-bp nurL was isolated and further digested with HphI. The ends were then digested with E. coli DNA polymerase I at 37°C in the presence of all four deoxyribonucleotides. The resulting fragments were then religated, digested with BomHI and inserted into the EarnHI-cut pNH482. Three mutants giving rise to white colonies on MacConkey-galactose-Ap (Mac-Ap + gaiactose) were isolated and characterized by sequencing. pNH455-4A and pNH455-2A suffered internal deletions of one and three A’s, respectively, in the A, cluster of the A-B spacer, whereas pNH455-18 lost an Wbp segment comprising the entire boti and the IO-bp sequence upstream.
92 TABLE I Antitermination activity of nutL fragments, with the N function supplied in cti * Plasmid designation b
Modules b PhC
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
pNH429 pNH428 pNH456 pNH455-1 pNH472-1 pNH472-5-l pNHl24 pNH129 pNH 104-A pNHlO5 pNH460 pNH5 pNHlOCB pNHlO4-BC pNH358 pNH67 pKL200 pNH48-2 pNH48 pNHlO4R
+ + + + + + + + + + + + + + + + + + -
nutL=
N
(box)
(bp)
A
B
C
354 148 323 119 108 107 105 104 92 82 76 74 43 41 119 0 0 0 0
+ + + + + + + + + += + + + -
+ + + + + + + + + + + + +
+ + + + + + + + + + + + -
f + -
+ -
+
+
+
92
+ + + + + + + + + + + + + +
hl
+ + + + + + + + + + + + + + -
+ -
-
+ + +
+ + +
GalK (units)d 30°C
42°C
nd 144 nd 148 139 149 139 142 142 93 36 33 146 80 147 125 143 20 1 5
299 271 286 278 293 267 263 270 270 185 52 43 281 160 293 281 264 32 4 8
a The basic structure of all the null-carrying plasmids was plac -nutL-N-1,,-galK, with both the N and galK genes transcribed from the same pLae promoter. The pLec, N, t,, , and gaZK modules were the same as in the parent pNH48-2 (Fig. 1A). The host was E. coli strain Dl2lO(laclQ, galK_, recA-). ’ Plasmids in lines 1 to 14 were constructed by cloning the nutL fragments (shown in Fig. 2) into the BamHl site of pNH48-2 (Fig. 1A). Lines 15-20 represent various (p-, N-, t-) controls. Plasmid pNH358 (line 15) was derived from pNH200 (see Fig. 1A legend) by inserting the 119-bp nurL fragment (see Fig. 2, pNH455-1) into the BamHl site. The N-carrying plasmid pNH67 (line 16) was obtained by cloning a 446-bp Hue111 fragment of 1. DNA (containing the Ngene) into the Smal site of pKL300 (gift from K. McKenney, unpublished). For pKL200, pNH48-2 and pNH48 (lines 17-19) see Fig. 1 legend. Plasmid pNHl04R (line 20) was derived from pNH48H (see Fig. IA legend) in two steps: (i) the n&L fragment present in pNHlW-A was cloned into pNH48H, and (ii) the resulting plasmid pNHl04 was then digested with EcoRl and religated as to delete the plac promoter and the sequence upstream. ’ The nutL fragments and the junction sequences are shown in Fig. 2. Symbols A, B and C refer to boxA, boxB and boxC, respectively (Fig. 2). Symbols + and - indicate the presence or absence of the specified module. Symbol f indicates a small defect in a given module (see Fig. 2 for the sequence). Since the parental plasmid pNH48-2 happens to carry a boxC sequence just upstream from gene N, most of the pNH48-2 derivatives contain this sequence. However, all plasmids shown in Table II do not carry the boxC-N module. d GalK (galactokmase) was assayed as follows: cells were grown overnight in LB + 50 pg Ap/ml at 3O”C, diluted 1: 100 into fresh LB + Ap medium containing 1 mM IPTG, and then propagated at 30°C or 42°C for 3 h to an A,,, of 0.4-0.6. Samples of 1 ml were treated with toluene and GalK activity assayed (see McKenney et al., 1981; Drahos and Szybalski, 1981). GalK units are expressed as nmol of [ “‘Clgalactose phosphorylated per min per A,,,. nd, not determined. ’ The entire sequence upstream from boxA is deleted.
absence of boxC. Especially significant is the result with plasmid pNH43 (Table II, line 3) since it does not carry any boxC sequence; most of the plasmid vectors in Table I do carry boxC, in conjunction with
the N fragment, but this boxC is in a highly abnormal location with respect to the boxA and boxB (64 bp downstream of the 3’-terminal A of boxB, as compared with 23 bp in the wt n&L).
93 TABLE II Antitermination activity of nutL fragments for the plac-nutL-r&r-gull: Plasmid designation b
1 2 3 4 5 6
pNH119 pNH92 pNH43 pNH41 pNH159 pNH358
module arrangement, with the N function supplied in ltansa
nutL (box)” (bp)
A
B
c
119 92 43 41 0 119
+ + + +
+ + +
+ +
+
+
* f
nl&L fragment (Table I, Fig. 2) d
30°C N-
42°C N+
455-l 104-A 104-B 104-BC Fig. 1B 358
2 2 2 1 2 300
322 320 317 150 4 320
GalK (units)=
a Thep iacttr_St II and galiy modules were the same as in the parental pNHl59 plasmid (Fig. lB), which did not contain the boxC-N module. The host was E. cob N4830 gaily -(MBam N+ cIts857dHl) (see MATERIALS AND METHODS, section a), which supplied the N function at 42°C but not at 30°C. b The plasmid numbers (lines l-4) reflect the length (in bp) of the cloned nutL fragment. Plasmid pNH159 is described in Fig. 1B. Plasmid pNH358 is described in Table I, footnote b. c See Table I, footnote c. d The numbers in lines l-4 and 6 @NH prefix removed) indicate the nurL fragments as shown in Fig. 2 and Table I. These fragments were all cloned in the BarnHI site of plasmid pNH159 (line 5 and Fig. IS). 4 See Table I. footnote d.
(c) Effect of deletions in box,4 and the A-B spacer region
of the nut +nut - or nut -nuf + order. These results indicate that the nut + function is &r-dominant.
As shown in Tables III and IV, deletions of one or three A nucleotides in the A-E spacer region result in almost complete loss of ~tit~atio~ both at 30” C and 42 ’ C (lines 2 and 3). This is true when the N product is supplied either in cti or in tram Deletion of the entire boxA (line 4, Table III) also abolishes antitermination at both temperatures, when pi,= is used as promoter. This appears to differ from the fmding of Peltz et al. (1985) that loss of boxA resulted in th~os~siti~ty of the antitermination; however, they used a different promoter (p,) (see Appendix). Control experiments in lines 6 and 7 (Table III) and 5 and 6 (Table IV) show that the deletions did not create any new terminators.
(e) Conclusions and discussion
(d) Cis-dominance of the nutL+ function Results in Table III, lines 8-12, show that deletions in the A-B spacer have no effect if such a defective nutL is cloned in series with the wt nutL + fragment. The dominance of nutL+ is independent
(1) When tested in the p,,-nutL-t-g& or p,,-nutL-N-r-guK arrangements, the nutL function is fully active if it contains the complete boxA, the 7-bp A-B spacer, and the complete boxB (nutL core). Its left boundary lies witbin the IO-bp sequence upstream from boxA and the right boundary is 1 bp do~stre~ from the nurL core, as defined by the 43-bp n&L fragment. While this sequence provides the complete nutL function, it is possible that a 33-bp to 42-bp sequence would stice, i.e., ifbp 1 to 9 were trimmed from the left end and 1 bp was removed from the right terminus of the 43-bp fragment. Our data indicate only that trimming the entire IO-bp sequence located at the left end of the 43-bp fragment halves the ~tite~ation activity, as does the removal of 2 bp from the right end (Table I, lines 10 and 14). (2) The boxC element does not seem to have any effect on nutL activity under the conditions tested. (3) The results are essentially the same, independent of whether the N function is supplied in cis
94 TABLE III Effect of deletions in boxA and the A-B spacer on the hurl-N-mediated &-dominance of the nurL + element a Plasmid designation b
antitermination, with the N function supplied in cb; the
Modules c
GalK (units)d N
nutL (box)
@PI
A
A-B spacer
B
C
kl
Del.
30°C
42°C
278 30 25 33 293 216 285
(A)
(bp) 1 2 3 4 5 6 I
8 9 10 11 12
pNH455-1 pNH455-4A pNH455-2A pNH455-18 pNH358 pNH358-4A pNH358-2A
pNH455-4 pNH455-2 pNH455-3 pNH455-5 pNH455-6
119 118 116 101 119 118 116
+ + + + + +
(bp) 118+wt 116+wt wt+ 116 116 + 116 wt + wt
7 6 4 1 1 6 4
+ + + + + + +
+ + + + + + +
wt AlA A3A Al8 wt AlA A3A
+ + + +
+ + + +
-
-
148 8 10 12 147 138 145
Two tandem nutLe
N
‘Ll
30°C
42°C
nutL(AlA)-nutL(wt) nurL(A3A)-nutL(wt) nutL(wt)-nutL(A3A) nutL(A3A)-nutL(A3A) nutL(wt)-nutL(wt)
+ + + + +
+ + + + +
140 nd nd 12 150
293 315 303 30 292
a Plasmids with the wild-type (wt) nutL (pNH455-1 and pNH358) and the host were the same as described in Table I. b Plasmids in lines l-7 contain one nurL site. Plasmids in lines 8-12 contain two tandemly arranged nutL sites, one of those (wt) the same as in pNH455-1. Lines 5-7 represent the N- t- controls. ’ Deletions (Del.) AlA and A3A [in the 7-bp A-B spacer (wt = AAAATTA) between boxA and boxB] and Al8 are shown and described in Fig. 2. The fragments were cloned in the BamHI site of pNH48-2 (Fig. 1A) (lines 2-4) or pNH200 (see legend to Fig. 1A) (lines 6-7). d See Table I, footnote d. e Plasmids pNH455-2 and pNH455-4 were constructed from pNH455-2A and pNH455-4A, respectively. The BamHI fragment containing nutL was isolated from pNH455-1 and ligated with either pNH455-4A or pNH455-2A partially digested with BumHI. Several clones were isolated and one of each type was sequenced. In both cases the wt nutL was located downstream of the mutant nutL. Plasmid pNH455-3 was constructed by digesting pNH458-1 and pNH23 with BcoRI + BglI. The small BcoRI-BgZI fragment from pNH23 was replaced with that from pNH458-1. Plasmid pNH23 was constructed as described for pNHl04R (Table I, footnote b), using the nutL fragment from pNH455-2A. Plasmid pNH458-1 contains the wt 119-bp nurL fragment in which the BamHI sites at both ends were converted into BcoRI sites by cloning an BcoRI-BglII linkers into the BamHI sites of the nutL fragments. The nutL fragment was then cloned into the EcoRI site of pKL200. Subsequently, the BcoRI site at the 5’-end was filled-in with PolIk. The resulting plasmid pNH357 was then digested with PstI, and the fragment containing the pLacpromoter and the nutL antiterminator was used to replace the PstI fragment containing the plac promoter of pNH48-2. Plasmid pNH455-5 was constructed by digesting pNH455-2A with BamHI followed by religation. Clones containing two tandem nutLs in the wt orientation were selected. Plasmid pNH455-6 was constructed from pNH455-1 as described for pNH455-5.
(Non the plasmid) or in truns (Non the host genome). (4) When the plac promoter is used, deletion of boxA or internal deletions (1 or 3 bp) in the A-B spacer abolish the nutL function at both 30°C and 42°C. This contrasts with the retention of thermosensitive activity of the same or similar nutL mutants at 30°C when tested with several other promoters
(Peltz et al., 1985; Hasan and Szybalski, 1986). The discrepancy might be due to (i) the intrinsic properties of given promoters (plac is not stimulated by the N product, unlike pp and pk, which permit thermosensitive antitermination by boxA-less nutL); (ii) some elements associated with promoters; (iii) the junction sequences, or (iv) the absence of a
95 TABLE IV Effect of
deletionsin the A-B spacer (between box4 and boxB) on nutL antitermination, with the N function supplied in rrua.r* Plasmid designation b
Modules c
GalK (units)d
nutL (box) (bp)
t,,tr A
A-B
B
c
spacer
Del.
30°C
42°C
2 1 2 300 303 308
322 11 13 320 312 306
(A)
(bp) 1 2 3 4 5 6
pNH258 pNH258-4A pNH258-2A pNH358 pNH358-4A pNH358-2A
119 118 116 119 118 116
+ + + + + +
I 6 4 I 6 4
+ + + + + +
+ + + + + +
wt AlA A3A wt AlA A3A
+ + + -
a See footnote a, Table II (however, plasmids did not contain TSC). b Plasmid pNH258 is derived from pNH158 (Fig. 1C) by cloning the 119-bp nutL (the same as in Table I, line 4) into the BumHI site. Plasmid pNH358 is described in footnote b of Table I. Plasmids in lines 2 and 3, and 5 and 6 were derived from the above plasmids by cloning the 118- and 116-bp nutL fragments (see Table III, lines 2 and 3, or 6 and 7). c See Table III, footnote c (nutL; Del.) and Table II footnote a (t&. d See Table I, footnote d.
long intervening region between plac and nutL in our constructs; however, in our design the distance between these two elements approximated that of the natural p,-nutl assembly in phage 1. (5) Our studies seem to indicate that the complete nutL sequence functions well with most promoters and terminators, but the effectiveness of a partially deleted nutL depends on the specific type of promoter and terminator, and on the conditions of the assay. The data presented here indicate that the nutL element is composed of subunits properly aligned for maximum interaction with each other and/or their interaction with the antitermination complex. For plac and nutL, any decrease in the spacing between these subunits results in disruption of their alignment and thus interferes with antitermination. The somewhat analogous antitermination studies employing the synthetic nutR antiterminator of II and pP promoter were outlined by Brown and Szybalski (1985). Our results reveal the intricate multi-unit structure of the nut antiterminator signal, and the complex nature of interactions between all elements of the transcriptional machinery.
ACKNOWLEDGEMENTS
This research was supported by the NIH, NCR Program Project Grant (5-POl-CA-23076) to W.S. and core grant 5-P30-CA-07175. We are thankful to Dr. A.J. Podhajska for E. coli K-12 strains N4830 and N5260, Dr. K. McKenney for plasmids pKL200 and pKL300, and Dr. D. Drahos for plasmids pD552, pD509, pNP109 and pDX1. The skillful help of Cindy Seeliger Diedrich is greatly appreciated.
REFERENCES Boyer, H.W. and Roulland-Dussoiz, D.: A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41 (1969) 459-472. Brown, A.L. and Szybalski, W.: Transcriptional antitermination activity of the synthetic nut elements of coliphage lambda, I. Assembly of the nutR recognition site from synthetic boxA and nut core elements. Gene 39 (1985) 121-127; 42 (1986) E125-El32 (Erratum). Daniels, D.L., Schroeder, J.L., Szybalski, W., Sanger, F. and Blattner, F.R.: A molecular map of coliphage lambda. In Hendriz, R.W., Roberts, J.W., Stahl, F.W. and Weisberg, R.A. (Eds.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983a, pp. 469-517.
96 Daniels, D.L., Schroeder, J.L., Szybalski, W., &urger, F., Coulson, A.R., Hong, G.-F., Hill, D.F., Peterson, G.B. and Blattner, F.R.: Complete annotated lambda sequence. In Hendrix, R.W., Roberts, J.W., Stahl, F.W. and Weisberg, R.A. (Eds.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983b, pp. 519-676. Drahos, D. and Szybalski, W.: Antitermination and termination functions of the cloned nutL, N and fr, modules of coliphage lambda. Gene 16 (1981) 261-274; 17 (1982) 354-355 (Erratum). Drahos, D., Galluppi, G.R., Caruthers, M. and Szybalski, W.: Synthesis of the nutL DNA segments and analysis of antitermination and termination functions in coliphage lambda. Gene 18 (1982) 343-354. Friedman, D.I. and Gottesman, M.: Lytic mode of lambda development. In Her&ix, R.W., Roberts, J.W., Stahl, F.W. and Weisberg, R.A. (Eds.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983, pp. 21-51. Gottesman, M.E., Adhya, S. and Das, A.: Transcription antitermination by bacteriophage lambda N gene product. J. Mol. Biol. 140 (1980) 57-75. Hasan, N. and Szybalski, W.: Structure of the coliphage lambda nutL antiterminator module. Abstracts, Bacteriophage Meeting, Cold Spring Harbor, NY, August 21-26, 1984, p. 74. Hasan, N. and Szybalski, W.: Effect of the promoter structure on the nutL transcription antitermination function. Gene 50 (1986) 97-100. Hoopes, B.C. and McClure, W.R.: Studies on the selectivity of DNA precipitation by spermine. Nucl. Acids Res. 9 (1981) 5493-5504. Hu, S.-L. and Szybalski, W.: Control of rightward transcription in coliphage lambda by the regulatory functions of phage genes N and cm. Virology 98 (1979) 424-432. Hu, S.-L., Salstrom, J.S. and Szybalski, W.: Stimulation of Tof function and p,proximal transcription by the N gene product of coliphage lambda. Virology 98 (1979) 411-423. Luk, K.-C. and Szybalski, W.: Characterization of the cloned terminators t,,, IL3and t,, and of the nutR antitermination site of coliphage lambda. Gene 20 (1982) 127-134. Luk, K.-C., Dobrzanski, P. and Szybalski, W.: Cloning and characterization of the termination site t, for the gene inr transcript in coliphage lambda. Gene 17 (1982) 259-262. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Maxam, A.M. and Gilbert, W.: Sequencing end-labelled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560. McKenney, K., Shimatake, H., Court, D., Schmeissner, U.,
Brady, C. and Rosenberg, M.: A system to study promoter and terminator signals recognized by Escherichia coli RNA polymerase. In Chirikjian, J.C. and Papas, T.S. (Ed%), Gene Amplification and Analysis, Vol. II: Analysis of Nucleic Acids by Enzymatic Methods. Elsevier, New York, 1981 pp. 383-415. Olson, E.R., Flamm, E.L. and Friedman, D.I.: Analysis of nutR: a region of phage lambda required for antitermination of transcription. Cell 31 (1982) 61-70. Pettersson, R.F., Lundstrom, K., Chattopadhyaya, J.B., Josephson, S., Philipson, L., KZLtilinen, L. and Palva, I.: Chemical synthesis and molecular cloning of a STOP oligonucleotide encoding an UGA translation terminator in all three reading frames. Gene 24 (1983) 15-27. Peltz, SW., Brown, A.L., Hasan, N. Podhajska, A.J. and Szybalski, W.: Thermosensitivity of a DNA recognition site: activity of a truncated nutL antiterminator of coliphage lambda. Science 228 (1985) 91-93. Sadler, J.R., Tecklenburg, M. and Betz, J.L.: Plasmids containing many tandem copies of a synthetic lactose operator. Gene 8 (1980) 279-300. Salstrom, J.S. and Szybalski, W.: Phage lambda nutL mutants unable to utilize N product for leftward transcription. Fed. Proc. 35 (1976) 1538. Salstrom, J.S. and Szybalski, W.: Coliphage )JlutL- : a unique class of mutants defective in the site of gene N product utilization for antitermination of leftward transcription. J. Mol. Biol. 124 (1978a) 195-221. Salstrom, J.S. and Szybalski, W.: Transcription termination sites in the major leftward operon of coliphage lambda. Virology 88 (1978b) 252-260. Somasekhar, G. and Szybalski, W.: Mapping ofthe Q-utilization site (qut) required for antitermination of late transcription in bacteriophage lambda. Gene 26 (1983) 291-294. Szybalski, W., Drahos, D., Luk, K.-C. and Somasekhar, G.: Modules for termination and antitermination of transcription in coliphage lambda. In Schlessinger, D. (Ed.), Microbiology - 1983. American Society for Microbiology, Washington, DC, 1983, pp. 35-38. Szybalski, W., Brown, A.L., Hasan, N., Podhajska, A.J. and Somasekhar, G.: Modular structure of the nut and qut antiterminators of transcription. Interactions between control elements of phage lambda and construction of novel regulatory circuits. In Reznikoff, W.S., Burgess, R.R., Dahlberg, J.E., Gross, CA., Record, M.T. and Wickens, M.P. (Eds.), RNA Polymerase and the Regulation of Transcription. Elsevier, New York, 1987, pp. 381-390. Communicated by Z. HradeEna.
87
GEN 01880
Boundaries of the n&L antiterminator of coliphage lambda and effects of mutations in the spacer region between boxA and boxB (Recombinant DNA; transcriptional cloning; triple-stop codon)
controls; luc promoter; galactokinase;
termination;
plasmid vector;
Noaman Hasan and Waclaw Szybalski * McArdle Laboratory for Cancer Research, University of Wkonsin, Madiron. WI 53706 (U.S.A.) Tel. (608)262-1259 or 262-2047 (Received June 1lth, 1986) (Revision received September 15th. 1986) (Accepted September 29th, 1986)
SUMMARY
To study the relationship of sequence to function for the phage 1 nutL transcriptional antiterminator, we cloned the 354-bp H&II Iz DNA fragment (coordinates 35261-35 615; Daniels et al., in Lambda II, 1983, pp. 485-486 and 618-619) between the hat promoter and Rho-dependent or Rho-independent terminators (t) in the p,,,-f-gaZK plasmid derived from vector pK03, and assayed the guZK expression in Escherichiu coli hosts in the presence or absence of the N gene product. The 354-bp fragment displayed the complete antitermination activity, as did several shorter fragments obtained by restriction cutting, exonucleolytic deletions and ligations. The minimal length of cloned and fully active nutL comprises 43 bp and consists (in the 5’-to-3’ order) of(i) a lo-bp sequence upstream from boxA, (ii) the 8-bp boxA (5’-CGC’JCTTA-3’), (iii) the 7-bp A-B spacer between box4 and boxB; (iv) the 17-bp boxB (n&L core; 5’-AGCCCTGAAGAAGGGCA-3’) and 1-bp downstream from the nutL core. Deletion of the IO-bp sequence upstream from boxA reduces antitermination by 40%. Deletion of both that sequence and boxA reduces antitermination by 90% at both 30” C and 42°C. Most of the deletions entering boxB abolish antitermination. Also, some of the small internal deletions within the 7-bp A-B spacer region have a strong negative effect on the nutL function, when transcription is from the p,,, promoter.
* To whom correspondence addressed.
and reprint requests should be
Abbreviations: Ap, ampicillin; bp, base pair(s); CIAP, calfintestinal alkaline phosphatase; Del. or A, deletion; IPTG, isopropyl/I-D-thiogalactopyraside; LB, Luria’s broth; Mac-Ap, MacConkey base (Difco) supplemented with 50 pg Ap/ml; nt, nucleotide(s); nut, N utilization site (Salstrom and Szybalski, 1976; 1978); p. promoter; PolIk, Klenow (large) fragment of E. coliDNA polymerase I; t, terminator; TSC, triple-stop codon (Patterson et al., 1983); wt, wild type. 037%1119/86/$03.50
0 1986 Elsevier
Science Publishers
B.V. (Biomedical
INTRODUCTION
Synthesis of RNA is regulated by various control elements. Transcription originates at the promoter and is terminated at the terminator. Termination, in turn, is controlled by various antitermination systems, one of which evolved in bacteriophage 1 and consists of the c&acting antiterminator signal nut, the phage N protein, and several host factors (for Division)
88
review see Friedman and Gottesman, 1983; and Szybalski et al., 1983; 1987). The nutL element, whose location is defined by nutL_ mutations (Salstrom and Szybalski, 1976; 1978), was shown to function as an autonomous module when cloned between a promoter and a terminator (Drahos and Szybalski, 198 1). However, the sequence cloned by Drahos and Szybalski (198 1) displayed only 60% antitermination efficiency at 30°C. Moreover, it was later shown that the antitermination function of the cloned element was thermosensitive (Peltz et al., 1985), whereas this is not the case for the native n&L function. The nutL sequence cloned by Drahos and Szybalski (1981) comprised nt 35467-35 541 on the Daniels et al. (1983a,b) map, an> did cont,ain the 17-bp nutL core (box@, AGCCCTGAAGAAGGGCA, but not the so-called boxA sequence, CGCTCTTA (nt 35 542-35 549), postulated by Olson et al. (1982) to be a site of NusA protein action and a vital part of the nutR antiterminator. Moreover, it was shown by Drahos et al. (1982) that the nutL core alone (nt 35 518-35 534), prepared by chemical synthesis, has only a very weak antitermination function. These results suggested that additional DNA sequences were needed for a more complete antitermination. This was confirmed by cloning a larger (354 bp) nutL fragment of 3,DNA, and its shortened derivatives containing all the elements required for antitermination. These data were presented by Hasan and Szybalski (1984) and are cited in Peltz et al. (1985) and Szybalski et al. (1987). The above results, together with some of their inconsistencies, made it important to determine the exact boundaries of the native n&L sequence, to explore the functions of the boxA, boxB (nutL core) and boxC modules (see Fig. l), and to examine the effect of sequence changes within and between those modules. The present studies employed the pi,, promoter, but the effects of other promoters are being explored (see Hasan and Szybalski, 1986).
MATERIALS
AND METHODS
(a) Plasmids, hosts and media
The plasmids which were used as vehicles for cloning various nutL fragments are shown and
described in Fig. 1. The null-carrying constructs are shown and listed in Fig. 2 and in Tables I-IV. The following E. coli K-12 strains were employed: D1210 (Sadler et al., 1980) is a red-, la@ derivative of HB 101 (Boyer and Roulland-Dussoix, 1969). N4830galKand N5260galKcarry defective IZdBamN’cIts857dHl prophages and MBamN7N53cIts857dH1, respectively, and are galK_ derivatives (constructed by A.J. Podhajska employing transduction with phage Pl grown on gulK- cells and selection for the Gal- phenotypes; see Peltz et al., 1985) of N4830 and N5260 obtained from S. Adhya (Gottesman et al., 1980). C600K is galK_, rho+, nus+, and produces an SuII suppressor (supE44). The media are described by Brown and Szybalski (1985). (b) Cloning,
restriction
analysis
and
nuckotide
sequencing
Restriction enzymes and linkers were from commercial sources and they were used as described by manufacturers. DNA manipulations were as described by Maniatis et al. (1982). The sequences of the critical regions and junctions for all the described constructs were confirmed using the method of Maxam and Gilbert (1980).
RESULTS
(a) The experimental principle To assay the antiterminator
activity of various fragments of I DNA, we cloned them between promoter and terminator and assayed the activity of the galK gene located downstream of the terminator, using basically the same approach as that of Drahos and Szybalski (1981) and Drahos et al. (1982), but supplying the N function not only in cis but for some experiments also in trans. We used the 1acZp promoter (p,,), and the tL1 or t,,t, terminators of 1. First, we cloned into the BumHI site of the special plasmid vehicle (Fig. 1) a large (354-bp) 1 DNA Hz&II fragment containing all the postulated nutL elements, boxA, boxB and boxC. Then a series of deletions in the nutL fragment was generated and their effect on antitermination was determined by
89
measuring the GalK activity. The individual constructs are depicted and described in Figs. 1 and 2 and in Tables I-IV. We show that some sequences are essential, since their loss abolishes nutL function, whereas other sequences seem to be less important since their loss causes only moderate decreases in antitermination efficiency. The use of the p,,, promoter and the D1210 (ZucZQ)host permitted regulation of the rate of transcription by IPTG. By comparing antitermination activity at 30’ C and 42’ C we were able to assess the possible thermosensitivity of the antitermination, as observed by Peltz et al. (1985). Moreover, heating to 42’ C was used as a means to provide the transacting N function in experiments described in Tables II and IV. P A#
pNH158
(b) The boundaries of the n&L element
t
Fig. 1. Construction and structure of plasmids designed for the study of the nurL antiterminator. (A)Plasmid pNH48-2 was constructed as follows. The large HindIII-PstI fragment from plasmid pD553 (Drahos and Szybalski, 1981) was ligated with the small HindIII-PsrI fragment from plasmid pK03 (McKenney et al., 1981; employed by Drahos and Szybalski, 1981) creating plasmid pNH48 (containing the N-r,,-gulK module), which was transformed into E. coli C600, and white (GalK- ) ApR colonies of C6OO[pNH48] were selected on Mac-Ap agar. A 224bp Hind111 fragment carrying the 1acZpo (p,,) promoter and the N-terminal portion of la&Z, was excised from plasmid pKL200 obtained from Dr. K. McKenney (personal communication) and inserted into the Hind111 site of pNH48. The orientation of plac was determined by restriction analysis, and the p,,-N-t,,-galK construct was designated pNH48H. The plac function was determined by subcloning the 224-bp Hind111 fragment (bearing p,,) from pNH48H into the ZfindIII-cleaved pK03, creating pNH156, and measuring its g& expression. To convert pNH48H to pNH48-2, a synthetic oligodeoxynucleotide bearing the translational TGA triple-stop codons (TSC; see XXX box) was inserted downstream of the la& fragment (see Fig. 1A and B) in the. following steps: the HindIII-BarnHI fragment bearing TSC was excised from plasmid pKTH601 (Pattersson et al., 1983), its Hind111 terminus was converted to a SmaI terminus by ligation with a HindIII-SmaI adapter, and the resulting TSC fragment was inserted into BamHI + SmaIdigested pKL200, giving rise to plasmid pNH200; the structure and orientation of the TSC insert were confirmed by nucleotide sequencing. Then, the large PsrI fragment of pNH48H was ligated to the small PstI fragment of pNH200, generating pNH48-2. (B) Plasmid pNH159 differs horn pNH48-2 by not containing gene N and having two strong Rho-independent terminators, rLStI, instead of Rho-dependent r,, (Salstrom and
The results presented in Table I define the boundaries of the nutL antiterminator. All the nutL subunits seem to be present in the 43-bp fragment (line 13), which comprises boxA, boxB, the A-B spacer between those boxes, a IO-bp sequence upstream from bad, and 1 bp downstream from boxB. Deletion of 10 bp upstream from box,4 reduced antitermination by about 40% (line 10 vs. lines l-9). The function of this IO-bp region was not dissected any further. Deletion of 1 bp downstream from boxB together with the last base pair of boxB reduces antitermination by about 50% (line 14 vs. lines l-9).
Szybalski, 1978b). It was constructed by excising a small SmaI-SmI fragment (bearing z&,) from plasmid pD123 (Luk et al., 1982), ligating it with Sal1 linkers, and inserting it into pNH200 [see legend (A) above]. (C) Plasmid pNH158, which differs from pNH159 by not containing TSC, was constructed in the same manner as pNH159, but using pNH156 [see legend (A) above] instead of pNH200. All three plasmids (A, B, C) do not express galK, unless a nut antiterminator is inserted between plac and the terminator(s), and the N function is supplied in cis (for A) or in trans (for B and C). Arrows specify the orientation of genes and control sites. Restriction site abbreviations are: B, BornHI; H, HirrdIII; P, PsrI; R, EcoRI; S, SmaI; Sa, Sal1 (only pertinent sites are shown). The plasmids are not drawn to scale. The sequence of TSC is as follows: 5’-GGGAGCTTGCTGATTGATTGACCG CCCTCGAACGACTAACTAACTGGCCTAG BarnHI Sma I
90
35,590 DdcI
35,614 HlncII
4
1
GRCRTfiRRTRCCRCldGCGGlGRTRiTGR c 'GRTCCCG
5’-
'GRTCCCG pNH428 pNH429
v.
CRCRTCRGCRG
R
3iRCTGRCCRC
'GRTCC 4 pNH472-1
pNIi455-1 pNH456
'GRTCCC pNH472-5-l
vGRTCCCG II pNH124
vGRTCC6 pNH129
s;
pNH455-18
35,56&t
IYRTGRR V
GRTCCGG
t
pNH104-A pNH104-B pNHf04-BC pNHl04-BC
pNH5 RGCT+
Minimal
pDX1
nutL
pNH104.B
35,510
35,4 bqs
~RGCRGRRGG~TTTGG~~~RTR~GR~RCGRRGCRT~G~
pNH129 pNH428 pNH455-1 pNH472-1 pNH472-5-1
'RGCT pDX1
'~GFRTCC pNH104-A pNH105 pNH460
'RGCCG~RTCC pNH5 Fig. 2. Nucleotide sequence of the cloned nutL-bearing DNA fragment (148.bp class; Table I, line 2) and of the endpoints of various deletions. The orientation of the fragment is opposite to that on the conventional a map (see Daniels et al., 1983), with the cuts indicated by downward arrows, accordingly. Only the antisense (mRNA-like) strand is shown. All the deletions were derived from a 354-bp HlncII L DNA fragment (bp 35262-35615) cloned in the BnmHI site ofplasmid pNH48-2 (Fig. 1A). The 3’ end of ah deletions is at the HaeIII site (bp 35467), with exception of the deletion in pNHlO+B, which ends at the MtjoII site (bp 35 516). For all deletions, the adjoining sequences (including the BumHI linkers and cuts represented by downward open arrowheads) and the designations of the resulting plasmids are shown (see Table I). Most of the deletions have regenerated the Hue111site at the 3’ end with exception of those in plasmids
91
In contrast, deletions entering boti practically abolish the nutL function (lines 11 and 12). Antitermination activity mediated by all the complete nutL + sequences (lines l-9), including the 43-bp nutL+ fragment (line 13), must be optimal, since the g&K expression levels matched that observed in the terminator-less controls (lines 15-17). Also as shown In Table I, the pi,,-promoted transcription is not enhanced by the N product (line 16 vs. 17), whereas twofold to threefold stimulation was observed for the pP, pL, pR and pk pro-
pNH
moters (Drahos and Szybalski, 1981; Szybalski et al., 1983; 1987; Huet al., 1979; Hu and Szybalski, 1979; Hasan and Szybalski, 1986). The results shown in Table II generally corroborate those in Table I, although there were two major ditkences in the experimental design: (i)N product was supplied in tram by the heatinduced prophage, and (ii) the Rho-independent strong z&r terminators were used. The results in Tables I and II also show that complete antitermination can be achieved even in the
W-A, pNHIO5, pNH5, pNH104-B and pNH460. The sequences ofbox and the nutL core (box&) are framed. The minimal 43-bp nutL region present in plasmid pNH 104-B is indicated. Some of the nutL tiagments (carrying various deletions) were transferred to other plasmids (see Fig. 1) as described in the legends to Tables II, III and IV. Starting with pNH429 (354-bp nutL insert), plasmids carrying nutL fragments with various deletions were constructed as follows. pNH456: the 354-bp nufL fragment was isolated from plasmid pNH429 following digestion with HindHI + EcoRI, purified, then cut with D&I, blunted with Sl endonuclease, and ligated with BarnHI linkers (5’-CGGGATCCCG). The DNA was digested with BamHI and the excess of linkers was removed by precipitation with spermine. HCl (Hoopes and McClure, 1981). Tbe 323-bp n#L fragment was then cloned into the BumHI-cut and CIAP-treated pNH48-2, giving rise to plasmid pNH456. pNH428: the BumHI nufL fragment was isolated from pNH429, then cut with HaelI and ligated with BarnHI linkers (5’-CCGGATCCGG), with further treatment as for pNH456, above, giving rise to pNH428. pNH455-1: this plasmid was constructed from pNH456 in the manner described above for pNH428. pNH472-1, pNH472-5-1, pNH124, and pNH129: the&rmHInufL fragment ofpNH455-1 was cloned into theBamH1 site ofpNH48H (see Fig. 1A legend) giving rise to plasmid pNH455, which was used to introduce unidirectional deletions into the cloned 119-bp nutL fragment. The DNA was first digested with EcoRI, and the large EcoRI fragment was purified and then digested with endonuclease Sl. Following ligation of the BumHI linker, the resected fragments were cloned in the BumHI site of plasmid pNH48H and were later recloned in pNH48-2 (see Table I). Several tr~sfo~ants were selected on MacCo~ey-g~actose-Ap plates (Drahos and Szybalski, 1981). These clones were characterized with various restriction enzymes and the sequences of the cloned fragments were determined. Different BumHI linkers were used for constructing pNH472-1 and pNH129 (5’-CCGGATCCGG) and for pNH472-5-l and pNH124 (5’-CGGGATCCCG). pNH104A: the BamHI nutL fragment of pNH456 was treated as described above for pNH472-1 and pNH129, generating plasmid pNH103, which subsequently was digested with BumHI. The BarnHI nurL fra8ment was isolated, digested with HueHI, ligated with BumHI linkers (5’-CGGATCCG), and then treated as described for pNH456, giving rise to pNH104A. pDX1: described by Drahos and Szybalski (1981). pNH5: plasmid pDE3 (Drahos and Szybalski, 1981) was cut with EcoRI; the isolated nutL fragment was digested with AluI, ligated with BumHI linkers (5’-CCGGATCCGG), and cloned in pNH48-2 (Fig. lA), as described for pNH456. pNHlO5 and pNH460: these plasmids were derived Born pNH104-A by cutting with EcoRI + HindIII. The resulting nutL fragment carried the 5’-CCGGATCCGGATGAAGGTGA sequence containing the F&I-recognition site (underlined), the 5’-portion of which, CCGGATCCGG, is the BarnHI linker fused to the I sequence ATGAAGGTGA..... The EcoRI-Hind111 nurL fragment was digested with FokI, and cohesive ends were blunted (a) by filling-in with PolIk (for pNHlO5) or (b) by digestion with E. coli DNA polymerase I (for pNH460). A EarnHI linker (5’-CGGATCCG) was added, with further treatment as for pNH456, above. pNHlOCB and pNH104-BC: both plasmids were derived from pNH104 (see Table I, footnote b) by isolating the EcoRI-Hind111 nurL fragment and digesting it with MboII. The cohesive ends were removed with Si endonuciease, the fragment was cut with SmaI and cloned into the SmaI site of pNH48H (see Fig. 1A legend). Two clones with diflerent 3’ ends were obtained, one contained a 43-bp nutL fragment (pNH143) and the other a 41-bp nutL fragment (pNH141). The nutL fragment from these two plasmids was excised by BumHI and cloned into the BumHI site of pNH48-2, giving rise to plasmids pNH104-B and pNH104-BC, respectively. pNH455-18, pNH455-4A and pNH455-2A: these plasmids are the internal deletion derivatives of plasmid pNH455-1, which was digested with HtidIII. The IIindIII fragment containing the 119-bp nurL was isolated and further digested with HphI. The ends were then digested with E. coli DNA polymerase I at 37°C in the presence of all four deoxyribonucleotides. The resulting fragments were then religated, digested with BomHI and inserted into the EarnHI-cut pNH482. Three mutants giving rise to white colonies on MacConkey-galactose-Ap (Mac-Ap + gaiactose) were isolated and characterized by sequencing. pNH455-4A and pNH455-2A suffered internal deletions of one and three A’s, respectively, in the A, cluster of the A-B spacer, whereas pNH455-18 lost an Wbp segment comprising the entire boti and the IO-bp sequence upstream.
92 TABLE I Antitermination activity of nutL fragments, with the N function supplied in cti * Plasmid designation b
Modules b PhC
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20
pNH429 pNH428 pNH456 pNH455-1 pNH472-1 pNH472-5-l pNHl24 pNH129 pNH 104-A pNHlO5 pNH460 pNH5 pNHlOCB pNHlO4-BC pNH358 pNH67 pKL200 pNH48-2 pNH48 pNHlO4R
+ + + + + + + + + + + + + + + + + + -
nutL=
N
(box)
(bp)
A
B
C
354 148 323 119 108 107 105 104 92 82 76 74 43 41 119 0 0 0 0
+ + + + + + + + + += + + + -
+ + + + + + + + + + + + +
+ + + + + + + + + + + + -
f + -
+ -
+
+
+
92
+ + + + + + + + + + + + + +
hl
+ + + + + + + + + + + + + + -
+ -
-
+ + +
+ + +
GalK (units)d 30°C
42°C
nd 144 nd 148 139 149 139 142 142 93 36 33 146 80 147 125 143 20 1 5
299 271 286 278 293 267 263 270 270 185 52 43 281 160 293 281 264 32 4 8
a The basic structure of all the null-carrying plasmids was plac -nutL-N-1,,-galK, with both the N and galK genes transcribed from the same pLae promoter. The pLec, N, t,, , and gaZK modules were the same as in the parent pNH48-2 (Fig. 1A). The host was E. coli strain Dl2lO(laclQ, galK_, recA-). ’ Plasmids in lines 1 to 14 were constructed by cloning the nutL fragments (shown in Fig. 2) into the BamHl site of pNH48-2 (Fig. 1A). Lines 15-20 represent various (p-, N-, t-) controls. Plasmid pNH358 (line 15) was derived from pNH200 (see Fig. 1A legend) by inserting the 119-bp nurL fragment (see Fig. 2, pNH455-1) into the BamHl site. The N-carrying plasmid pNH67 (line 16) was obtained by cloning a 446-bp Hue111 fragment of 1. DNA (containing the Ngene) into the Smal site of pKL300 (gift from K. McKenney, unpublished). For pKL200, pNH48-2 and pNH48 (lines 17-19) see Fig. 1 legend. Plasmid pNHl04R (line 20) was derived from pNH48H (see Fig. IA legend) in two steps: (i) the n&L fragment present in pNHlW-A was cloned into pNH48H, and (ii) the resulting plasmid pNHl04 was then digested with EcoRl and religated as to delete the plac promoter and the sequence upstream. ’ The nutL fragments and the junction sequences are shown in Fig. 2. Symbols A, B and C refer to boxA, boxB and boxC, respectively (Fig. 2). Symbols + and - indicate the presence or absence of the specified module. Symbol f indicates a small defect in a given module (see Fig. 2 for the sequence). Since the parental plasmid pNH48-2 happens to carry a boxC sequence just upstream from gene N, most of the pNH48-2 derivatives contain this sequence. However, all plasmids shown in Table II do not carry the boxC-N module. d GalK (galactokmase) was assayed as follows: cells were grown overnight in LB + 50 pg Ap/ml at 3O”C, diluted 1: 100 into fresh LB + Ap medium containing 1 mM IPTG, and then propagated at 30°C or 42°C for 3 h to an A,,, of 0.4-0.6. Samples of 1 ml were treated with toluene and GalK activity assayed (see McKenney et al., 1981; Drahos and Szybalski, 1981). GalK units are expressed as nmol of [ “‘Clgalactose phosphorylated per min per A,,,. nd, not determined. ’ The entire sequence upstream from boxA is deleted.
absence of boxC. Especially significant is the result with plasmid pNH43 (Table II, line 3) since it does not carry any boxC sequence; most of the plasmid vectors in Table I do carry boxC, in conjunction with
the N fragment, but this boxC is in a highly abnormal location with respect to the boxA and boxB (64 bp downstream of the 3’-terminal A of boxB, as compared with 23 bp in the wt n&L).
93 TABLE II Antitermination activity of nutL fragments for the plac-nutL-r&r-gull: Plasmid designation b
1 2 3 4 5 6
pNH119 pNH92 pNH43 pNH41 pNH159 pNH358
module arrangement, with the N function supplied in ltansa
nutL (box)” (bp)
A
B
c
119 92 43 41 0 119
+ + + +
+ + +
+ +
+
+
* f
nl&L fragment (Table I, Fig. 2) d
30°C N-
42°C N+
455-l 104-A 104-B 104-BC Fig. 1B 358
2 2 2 1 2 300
322 320 317 150 4 320
GalK (units)=
a Thep iacttr_St II and galiy modules were the same as in the parental pNHl59 plasmid (Fig. lB), which did not contain the boxC-N module. The host was E. cob N4830 gaily -(MBam N+ cIts857dHl) (see MATERIALS AND METHODS, section a), which supplied the N function at 42°C but not at 30°C. b The plasmid numbers (lines l-4) reflect the length (in bp) of the cloned nutL fragment. Plasmid pNH159 is described in Fig. 1B. Plasmid pNH358 is described in Table I, footnote b. c See Table I, footnote c. d The numbers in lines l-4 and 6 @NH prefix removed) indicate the nurL fragments as shown in Fig. 2 and Table I. These fragments were all cloned in the BarnHI site of plasmid pNH159 (line 5 and Fig. IS). 4 See Table I. footnote d.
(c) Effect of deletions in box,4 and the A-B spacer region
of the nut +nut - or nut -nuf + order. These results indicate that the nut + function is &r-dominant.
As shown in Tables III and IV, deletions of one or three A nucleotides in the A-E spacer region result in almost complete loss of ~tit~atio~ both at 30” C and 42 ’ C (lines 2 and 3). This is true when the N product is supplied either in cti or in tram Deletion of the entire boxA (line 4, Table III) also abolishes antitermination at both temperatures, when pi,= is used as promoter. This appears to differ from the fmding of Peltz et al. (1985) that loss of boxA resulted in th~os~siti~ty of the antitermination; however, they used a different promoter (p,) (see Appendix). Control experiments in lines 6 and 7 (Table III) and 5 and 6 (Table IV) show that the deletions did not create any new terminators.
(e) Conclusions and discussion
(d) Cis-dominance of the nutL+ function Results in Table III, lines 8-12, show that deletions in the A-B spacer have no effect if such a defective nutL is cloned in series with the wt nutL + fragment. The dominance of nutL+ is independent
(1) When tested in the p,,-nutL-t-g& or p,,-nutL-N-r-guK arrangements, the nutL function is fully active if it contains the complete boxA, the 7-bp A-B spacer, and the complete boxB (nutL core). Its left boundary lies witbin the IO-bp sequence upstream from boxA and the right boundary is 1 bp do~stre~ from the nurL core, as defined by the 43-bp n&L fragment. While this sequence provides the complete nutL function, it is possible that a 33-bp to 42-bp sequence would stice, i.e., ifbp 1 to 9 were trimmed from the left end and 1 bp was removed from the right terminus of the 43-bp fragment. Our data indicate only that trimming the entire IO-bp sequence located at the left end of the 43-bp fragment halves the ~tite~ation activity, as does the removal of 2 bp from the right end (Table I, lines 10 and 14). (2) The boxC element does not seem to have any effect on nutL activity under the conditions tested. (3) The results are essentially the same, independent of whether the N function is supplied in cis
94 TABLE III Effect of deletions in boxA and the A-B spacer on the hurl-N-mediated &-dominance of the nurL + element a Plasmid designation b
antitermination, with the N function supplied in cb; the
Modules c
GalK (units)d N
nutL (box)
@PI
A
A-B spacer
B
C
kl
Del.
30°C
42°C
278 30 25 33 293 216 285
(A)
(bp) 1 2 3 4 5 6 I
8 9 10 11 12
pNH455-1 pNH455-4A pNH455-2A pNH455-18 pNH358 pNH358-4A pNH358-2A
pNH455-4 pNH455-2 pNH455-3 pNH455-5 pNH455-6
119 118 116 101 119 118 116
+ + + + + +
(bp) 118+wt 116+wt wt+ 116 116 + 116 wt + wt
7 6 4 1 1 6 4
+ + + + + + +
+ + + + + + +
wt AlA A3A Al8 wt AlA A3A
+ + + +
+ + + +
-
-
148 8 10 12 147 138 145
Two tandem nutLe
N
‘Ll
30°C
42°C
nutL(AlA)-nutL(wt) nurL(A3A)-nutL(wt) nutL(wt)-nutL(A3A) nutL(A3A)-nutL(A3A) nutL(wt)-nutL(wt)
+ + + + +
+ + + + +
140 nd nd 12 150
293 315 303 30 292
a Plasmids with the wild-type (wt) nutL (pNH455-1 and pNH358) and the host were the same as described in Table I. b Plasmids in lines l-7 contain one nurL site. Plasmids in lines 8-12 contain two tandemly arranged nutL sites, one of those (wt) the same as in pNH455-1. Lines 5-7 represent the N- t- controls. ’ Deletions (Del.) AlA and A3A [in the 7-bp A-B spacer (wt = AAAATTA) between boxA and boxB] and Al8 are shown and described in Fig. 2. The fragments were cloned in the BamHI site of pNH48-2 (Fig. 1A) (lines 2-4) or pNH200 (see legend to Fig. 1A) (lines 6-7). d See Table I, footnote d. e Plasmids pNH455-2 and pNH455-4 were constructed from pNH455-2A and pNH455-4A, respectively. The BamHI fragment containing nutL was isolated from pNH455-1 and ligated with either pNH455-4A or pNH455-2A partially digested with BumHI. Several clones were isolated and one of each type was sequenced. In both cases the wt nutL was located downstream of the mutant nutL. Plasmid pNH455-3 was constructed by digesting pNH458-1 and pNH23 with BcoRI + BglI. The small BcoRI-BgZI fragment from pNH23 was replaced with that from pNH458-1. Plasmid pNH23 was constructed as described for pNHl04R (Table I, footnote b), using the nutL fragment from pNH455-2A. Plasmid pNH458-1 contains the wt 119-bp nurL fragment in which the BamHI sites at both ends were converted into BcoRI sites by cloning an BcoRI-BglII linkers into the BamHI sites of the nutL fragments. The nutL fragment was then cloned into the EcoRI site of pKL200. Subsequently, the BcoRI site at the 5’-end was filled-in with PolIk. The resulting plasmid pNH357 was then digested with PstI, and the fragment containing the pLacpromoter and the nutL antiterminator was used to replace the PstI fragment containing the plac promoter of pNH48-2. Plasmid pNH455-5 was constructed by digesting pNH455-2A with BamHI followed by religation. Clones containing two tandem nutLs in the wt orientation were selected. Plasmid pNH455-6 was constructed from pNH455-1 as described for pNH455-5.
(Non the plasmid) or in truns (Non the host genome). (4) When the plac promoter is used, deletion of boxA or internal deletions (1 or 3 bp) in the A-B spacer abolish the nutL function at both 30°C and 42°C. This contrasts with the retention of thermosensitive activity of the same or similar nutL mutants at 30°C when tested with several other promoters
(Peltz et al., 1985; Hasan and Szybalski, 1986). The discrepancy might be due to (i) the intrinsic properties of given promoters (plac is not stimulated by the N product, unlike pp and pk, which permit thermosensitive antitermination by boxA-less nutL); (ii) some elements associated with promoters; (iii) the junction sequences, or (iv) the absence of a
95 TABLE IV Effect of
deletionsin the A-B spacer (between box4 and boxB) on nutL antitermination, with the N function supplied in rrua.r* Plasmid designation b
Modules c
GalK (units)d
nutL (box) (bp)
t,,tr A
A-B
B
c
spacer
Del.
30°C
42°C
2 1 2 300 303 308
322 11 13 320 312 306
(A)
(bp) 1 2 3 4 5 6
pNH258 pNH258-4A pNH258-2A pNH358 pNH358-4A pNH358-2A
119 118 116 119 118 116
+ + + + + +
I 6 4 I 6 4
+ + + + + +
+ + + + + +
wt AlA A3A wt AlA A3A
+ + + -
a See footnote a, Table II (however, plasmids did not contain TSC). b Plasmid pNH258 is derived from pNH158 (Fig. 1C) by cloning the 119-bp nutL (the same as in Table I, line 4) into the BumHI site. Plasmid pNH358 is described in footnote b of Table I. Plasmids in lines 2 and 3, and 5 and 6 were derived from the above plasmids by cloning the 118- and 116-bp nutL fragments (see Table III, lines 2 and 3, or 6 and 7). c See Table III, footnote c (nutL; Del.) and Table II footnote a (t&. d See Table I, footnote d.
long intervening region between plac and nutL in our constructs; however, in our design the distance between these two elements approximated that of the natural p,-nutl assembly in phage 1. (5) Our studies seem to indicate that the complete nutL sequence functions well with most promoters and terminators, but the effectiveness of a partially deleted nutL depends on the specific type of promoter and terminator, and on the conditions of the assay. The data presented here indicate that the nutL element is composed of subunits properly aligned for maximum interaction with each other and/or their interaction with the antitermination complex. For plac and nutL, any decrease in the spacing between these subunits results in disruption of their alignment and thus interferes with antitermination. The somewhat analogous antitermination studies employing the synthetic nutR antiterminator of II and pP promoter were outlined by Brown and Szybalski (1985). Our results reveal the intricate multi-unit structure of the nut antiterminator signal, and the complex nature of interactions between all elements of the transcriptional machinery.
ACKNOWLEDGEMENTS
This research was supported by the NIH, NCR Program Project Grant (5-POl-CA-23076) to W.S. and core grant 5-P30-CA-07175. We are thankful to Dr. A.J. Podhajska for E. coli K-12 strains N4830 and N5260, Dr. K. McKenney for plasmids pKL200 and pKL300, and Dr. D. Drahos for plasmids pD552, pD509, pNP109 and pDX1. The skillful help of Cindy Seeliger Diedrich is greatly appreciated.
REFERENCES Boyer, H.W. and Roulland-Dussoiz, D.: A complementation analysis of the restriction and modification of DNA in Escherichia coli. J. Mol. Biol. 41 (1969) 459-472. Brown, A.L. and Szybalski, W.: Transcriptional antitermination activity of the synthetic nut elements of coliphage lambda, I. Assembly of the nutR recognition site from synthetic boxA and nut core elements. Gene 39 (1985) 121-127; 42 (1986) E125-El32 (Erratum). Daniels, D.L., Schroeder, J.L., Szybalski, W., Sanger, F. and Blattner, F.R.: A molecular map of coliphage lambda. In Hendriz, R.W., Roberts, J.W., Stahl, F.W. and Weisberg, R.A. (Eds.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983a, pp. 469-517.
96 Daniels, D.L., Schroeder, J.L., Szybalski, W., &urger, F., Coulson, A.R., Hong, G.-F., Hill, D.F., Peterson, G.B. and Blattner, F.R.: Complete annotated lambda sequence. In Hendrix, R.W., Roberts, J.W., Stahl, F.W. and Weisberg, R.A. (Eds.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983b, pp. 519-676. Drahos, D. and Szybalski, W.: Antitermination and termination functions of the cloned nutL, N and fr, modules of coliphage lambda. Gene 16 (1981) 261-274; 17 (1982) 354-355 (Erratum). Drahos, D., Galluppi, G.R., Caruthers, M. and Szybalski, W.: Synthesis of the nutL DNA segments and analysis of antitermination and termination functions in coliphage lambda. Gene 18 (1982) 343-354. Friedman, D.I. and Gottesman, M.: Lytic mode of lambda development. In Her&ix, R.W., Roberts, J.W., Stahl, F.W. and Weisberg, R.A. (Eds.), Lambda II. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1983, pp. 21-51. Gottesman, M.E., Adhya, S. and Das, A.: Transcription antitermination by bacteriophage lambda N gene product. J. Mol. Biol. 140 (1980) 57-75. Hasan, N. and Szybalski, W.: Structure of the coliphage lambda nutL antiterminator module. Abstracts, Bacteriophage Meeting, Cold Spring Harbor, NY, August 21-26, 1984, p. 74. Hasan, N. and Szybalski, W.: Effect of the promoter structure on the nutL transcription antitermination function. Gene 50 (1986) 97-100. Hoopes, B.C. and McClure, W.R.: Studies on the selectivity of DNA precipitation by spermine. Nucl. Acids Res. 9 (1981) 5493-5504. Hu, S.-L. and Szybalski, W.: Control of rightward transcription in coliphage lambda by the regulatory functions of phage genes N and cm. Virology 98 (1979) 424-432. Hu, S.-L., Salstrom, J.S. and Szybalski, W.: Stimulation of Tof function and p,proximal transcription by the N gene product of coliphage lambda. Virology 98 (1979) 411-423. Luk, K.-C. and Szybalski, W.: Characterization of the cloned terminators t,,, IL3and t,, and of the nutR antitermination site of coliphage lambda. Gene 20 (1982) 127-134. Luk, K.-C., Dobrzanski, P. and Szybalski, W.: Cloning and characterization of the termination site t, for the gene inr transcript in coliphage lambda. Gene 17 (1982) 259-262. Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1982. Maxam, A.M. and Gilbert, W.: Sequencing end-labelled DNA with base-specific chemical cleavages. Methods Enzymol. 65 (1980) 499-560. McKenney, K., Shimatake, H., Court, D., Schmeissner, U.,
Brady, C. and Rosenberg, M.: A system to study promoter and terminator signals recognized by Escherichia coli RNA polymerase. In Chirikjian, J.C. and Papas, T.S. (Ed%), Gene Amplification and Analysis, Vol. II: Analysis of Nucleic Acids by Enzymatic Methods. Elsevier, New York, 1981 pp. 383-415. Olson, E.R., Flamm, E.L. and Friedman, D.I.: Analysis of nutR: a region of phage lambda required for antitermination of transcription. Cell 31 (1982) 61-70. Pettersson, R.F., Lundstrom, K., Chattopadhyaya, J.B., Josephson, S., Philipson, L., KZLtilinen, L. and Palva, I.: Chemical synthesis and molecular cloning of a STOP oligonucleotide encoding an UGA translation terminator in all three reading frames. Gene 24 (1983) 15-27. Peltz, SW., Brown, A.L., Hasan, N. Podhajska, A.J. and Szybalski, W.: Thermosensitivity of a DNA recognition site: activity of a truncated nutL antiterminator of coliphage lambda. Science 228 (1985) 91-93. Sadler, J.R., Tecklenburg, M. and Betz, J.L.: Plasmids containing many tandem copies of a synthetic lactose operator. Gene 8 (1980) 279-300. Salstrom, J.S. and Szybalski, W.: Phage lambda nutL mutants unable to utilize N product for leftward transcription. Fed. Proc. 35 (1976) 1538. Salstrom, J.S. and Szybalski, W.: Coliphage )JlutL- : a unique class of mutants defective in the site of gene N product utilization for antitermination of leftward transcription. J. Mol. Biol. 124 (1978a) 195-221. Salstrom, J.S. and Szybalski, W.: Transcription termination sites in the major leftward operon of coliphage lambda. Virology 88 (1978b) 252-260. Somasekhar, G. and Szybalski, W.: Mapping ofthe Q-utilization site (qut) required for antitermination of late transcription in bacteriophage lambda. Gene 26 (1983) 291-294. Szybalski, W., Drahos, D., Luk, K.-C. and Somasekhar, G.: Modules for termination and antitermination of transcription in coliphage lambda. In Schlessinger, D. (Ed.), Microbiology - 1983. American Society for Microbiology, Washington, DC, 1983, pp. 35-38. Szybalski, W., Brown, A.L., Hasan, N., Podhajska, A.J. and Somasekhar, G.: Modular structure of the nut and qut antiterminators of transcription. Interactions between control elements of phage lambda and construction of novel regulatory circuits. In Reznikoff, W.S., Burgess, R.R., Dahlberg, J.E., Gross, CA., Record, M.T. and Wickens, M.P. (Eds.), RNA Polymerase and the Regulation of Transcription. Elsevier, New York, 1987, pp. 381-390. Communicated by Z. HradeEna.