Bovine κ-casein induces a hypo-responsive DC population which exhibit a reduced capacity to elicit T-cell responses

Journal of Functional Foods 64 (2020) 103620

Contents lists available at ScienceDirect

Journal of Functional Foods journal homepage: www.elsevier.com/locate/jff

Bovine κ-casein induces a hypo-responsive DC population which exhibit a reduced capacity to elicit T-cell responses Richard Lalor, Sandra O'Neill

T

⁎

Fundamental and Translational Immunology Group, Dublin City University, Dublin 9, Ireland

A R T I C LE I N FO

A B S T R A C T

Keywords: Kappa-casein Dendritic cell Nutraceutical Immunosuppression

The therapeutic potential of bioactive nutraceutical’s has been extensively examined in the context of immune modulators that have the potential to ameliorate inflammatory conditions. This study sheds new light on the immunomodulatory properties exhibited by kappa-casein (a bovine milk derived bioactive protein) on dendritic cells (DCs), key cells involved in the inflammatory process. DCs treated with kappa-casein secrete significantly reduced levels of proinflammatory cytokines (TNF-α, IL-12p70) in response to TLR and non TLR stimuli, expressed reduced levels of co-stimulatory molecules (CD80, OX40L), activation/adhesion receptors (CD54, CD209) and enhanced levels of negative regulators of cytokine signaling (SOCS1, SOCS3). Kappa-casein also impaired the capacity of DCs to elicit antigen specific responses, significantly reducing IL-2 secretion, a key cytokine required for the propagation of T-cells responses, in a non-anergic mechanism. Given the immunomodulatory effects exhibited by kappa-casein, this bioactive subunit warrants further investigation to assess its potential use as a nutraceutical.

1. Introduction The number of individuals who suffer from chronic inflammatory conditions has increased globally representing a major challenge to the medical community (El-Gabalawy, Guenther, & Bernstein, 2010). Novel disease management strategies such as dietary supplementation with bioactive nutraceuticals that display anti-inflammatory properties represent a viable alternative strategy (Gill, Doull, Rutherfurd, & Cross, 2000). Bioactive nutraceuticals are generally small enough to allow efficient delivery/adsorption and display an array of beneficial properties over conventional treatments such as low toxicity, reduced or lack of bioaccumulation (Agyei, Ongkudon, Wei, Chan, & Danquah, 2016; Gokhale & Satyanarayanajois, 2014) and low likelihood of triggering undesirable immune responses (Marx, 2005; Mason, 2010). Casein (CAS), one of the most abundant proteins in bovine milk and its hydrolysed derivatives have shown great potential as a source of bioactive nutraceuticals due to the array of immuno-suppressive properties they exhibit, where studies in mice and humans report the amelioration of inflammatory conditions (Hvas et al., 2016; LópezPosadas et al., 2010; Requena et al., 2008). Studies in particular have focused upon the immuno-modulatory effect of these bioactives on

antigen presenting cells (APCs), which are heavily implicated in the development of chronic inflammatory diseases (Cobrin & Abreu, 2005; Bates & Diehl, 2014; Gren & Grip, 2016). DCs are a heterogeneous population of APCs distributed throughout the body. In a steady state, DCs are less responsive to inflammatory stimuli and produce anti-inflammatory mediators, thought to responsible for the promotion and maintenance of regulatory T-cell populations required for homeostasis (Scott, Aumeunier, & Mowat, 2011). However, abnormal inflammatory responses can alter their function into cells that promote and propagate inflammation capable of producing a variety of pro-inflammatory signaling molecules including; cytokines, chemokines and cell signaling receptors (Patil et al., 2010; Thaiss, Semmling, Franken, Wagner, & Kurts, 2011). DCs express high levels of the co-stimulatory molecules; CD80, CD86, MHC II and CD40, required for efficient antigen presentation upon activation (Steinman, Inaba, Turley, Pierre, & Mellman, 1999). DC migration and acumination is observed in chronic intestinal inflammatory diseases (Silva, 2009). These DCs have been shown to be hyper-responsive to toll-like receptor (TLR) stimulation, secrete high levels of pro-inflammatory cytokines like TNF-α, IL-23 and IL-12 which are crucial for the induction of TH1/TH17 inflammatory T-cell responses observed in intestinal

Abbreviations: APC, antigen presenting cell; BMDC, bone marrow derived dendritic cell; DC, dendritic cell; IL-, interleukin; LPS, lipopolysaccharide; κ-CAS, kappa casein; PMA, phorbol myristate acetate; SOCS, suppressor of cytokine signalling; TNF-α, tumor necrosis factor α; TLR, toll like receptor; ZnPPIX, zinc Protoporphyrin9 ⁎ Corresponding author. E-mail address: [email protected] (S. O'Neill). https://doi.org/10.1016/j.jff.2019.103620 Received 29 August 2019; Received in revised form 2 October 2019; Accepted 4 October 2019 Available online 31 October 2019 1756-4646/ © 2019 Elsevier Ltd. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

425Cbn/J (Charles River, Kent, UK) mice were sacrificed by cervical dislocation. Bone marrow from femurs and tibias were extracted and seeded in petri dishes at a cell density of 20 × 105 cells/10 mL in culture media (RPMI supplemented with 20 ng/mL GM‐CSF, 10% fetal calf serum, 1% l‐glutamine, and 100 μ/mL penicillin/streptomycin). On day 3, an additional 10 mL of fresh culture media was added. On day 6, half the media was aspirated and replaced with fresh culture medium. On day 8, half the media extracted, centrifuged and any residual pellet resuspended in 10 mL of fresh culture media prior to being added back to the plate. On day 10, non-adherent cells were harvested and analysed by flow cytometry with > 95% of the population identified as BMDCs on the basis of a positive expression for CD11c (BioLegend, No. 117317).

inflammatory diseases (IBD) (Baumgart et al., 2009; Sakuraba et al., 2009; Yawalkar, Tscharner, Hunger, & Hassan, 2009; Zaba et al., 2009). In experimental mouse models of IBD, DCs secrete high levels of TNF-α which can increase epithelial barrier permeability, resulting in inflammation and injury similar to that observed in ulcerative colitis (Garrett et al., 2007). We have previously shown that the kappa casein (κ-CAS) subunit primes macrophages towards a novel alternatively activated M2-like suppressive phenotype, which were hypo-responsive to TLR stimulation and suppressed TH1 associated CD4+ T-cell cytokine responses in-vitro (Lalor & O'Neill, 2019). DCs like macrophages are APCs, but are considered more critical in the mediation between innate and adaptive immunity, often termed as professional APCs. While macrophages present antigen in-situ, upon antigen uptake, DCs become activated, mature and migrate to the lymph nodes to present antigens to the Tcells resulting in the systematic initiation of an adaptive immune response. Thus, a bioactive nutraceutical with immuno-modulatory properties that induces a suppressive DC phenotype would be of great interest due to their prominent role in both innate and adaptive immunity. DCs in gastrointestinal inflammatory conditions act as innate professional APCs that are good sources of IL-12p70, a cytokine critical in driving TH1 adaptive immune responses associated with pathology (Lichtenegger et al., 2012). A limited number of studies have examined the impact κ-CAS had on DC function and activation status. Mikkelsen et al., demonstrated that κ-CAS reduced the capacity of bone marrow derived dendritic cells (BMDCs) to produce the pro-inflammatory cytokines; IL-1β, IL-10, IL-12 and TNF-α upon LPS stimulation while GMP, the hydrolysed derivative of κ-CAS was also shown to reduce LPS induced TNF-α and IL-1β production from BMDCs (Mikkelsen, Bakman, Sørensen, Barkholt, & Frøkiaer, 2005). A complete analysis of the BMDC phenotype induced by a κ-CAS is therefore warranted and herein we investigated the ability of κ-CAS to modulate BMDC maturation and function and its impact on adaptive immune responses.

2.4. BMDC activation BMDCs were pre-treated with PBS or the indicated concentrations of κ-CAS 2.5 hr prior, at the same time or 2.5 hr post PBS, phorbol myristate acetate (PMA) (20 ng/mL), or toll like receptor (TLR) agonist (Alexis Biochemicals, San Diego, CA, USA) stimulation. The TLR agonists used were: TLR4 agonist, lipopolysaccharide (LPS) (100 ng/mL); TLR2 agonitst, peptidoglycan (PGN) (5 ug/mL); TLR7 agonist, loxoribine (LOX) (0.5 mM); or TLR9 against, synthetic oligonucleotides containing CpG motifs (CpG) (2 μM). The additions of PMA, TLR agonist alone or PBS were used as controls. To elucidate if heme oxygenase-1 was involved in the signalling pathways by which CAS exerts its effects, cells were cultured with chemical antagonists of heme oxygenase-1; Zinc-protoporphyin-9 (ZnPPIX) (Santa cruz biotechnology, Santa Cruz, CA, USA) at the indicated concentrations, 30 min prior to addition of CAS. Resazurin assays were used to determine cytotoxicity of compounds using a previously described method (Riss, Moravec, & Niles, 2013). Briefly, cells were treated with respective stimulations, at a cell density of 1 × 105 cell/100 μL in 96-well plates. At the end time point, 20 µL of 0.15 mg/mL resazurin salt (Sigma-Aldrich, St. Louis, MO, USA) solution was added and cells were incubated for an additional 6 hr. The absorbance values were recorded at a 560 nm excitation/590 nm emission filters using a microplate reader (Tecan, Männedorf, Switzerland). Cytotoxic effects were measured and compared to vehicle or 5% paraformaldehyde (PFA) stimulated controls.

2. Materials and methods 2.1. Reagents and materials κ-CAS was purchased from Sigma-Aldrich (St. Louis, MO, USA). Lipopolysaccharide (LPS) from E. coli, serotype R515 was purchased from Enzo Life Sciences (Exeter, UK). All antibodies used in this investigation were obtained from commercial sources. Granulocytemacrophage colony stimulating factor (GM‐CSF) was obtained from a GM‐CSF producing cell line X63 (LGC Standards, Middlesex, UK). Cell culture material was purchased from Biosciences (Dun Laoghaire, Ireland).

2.5. BMDC: CD4+ T-cells co-culture Spleens from C57BL/6JCrl (Charles River, Kent, UK) mice were extracted and splenocytes obtained by mechanical homogenization of the spleen through a 40 μm filter (Sarstedt, Nümbrecht, Germany). CD4+ T-cells were isolated from splenocytes using a negative selection CD4+ isolation kit (Stemcell, Vancouver, Canada) and were only used if the purity were determined to be > 95% CD4+ (BioLegend, No. 116005) by flow cytometry. BMDCs were co-cultured with CD4+ Tcells at a ratio of 1:10 in RPMI media supplemented with 10% fetal calf serum, 1% l‐glutamine, and 100 μ/mL penicillin/streptomycin, on 24 well plates (Sarstedt, Nümbrecht, Germany) pre-coated overnight with anti-CD3 (1 µg/mL) (R & D systems, Minneapolis, Minnesota, USA).

2.2. Animals and ethics C57BL/6JClr and B6.Cg-Tg(TcraTcrb)425Cbn/J mice aged 6–8 weeks were purchased from Charles River UK Ltd (Kent, UK) and kept under specific pathogen free conditions at the DCU Bioresources unit. All mice were housed according to the Health Products Regulatory Authority guidelines and standard operating procedure approved by the institutional Animal Welfare Body were strictly adhered too. Ethical permission for the use of animals was approved by the Department of Health or Health Products Regulatory Authority and Dublin City University ethics committee (licence numbers B100/2833, DCUREC/ 2010/033). All procedures involving animals were only performed by licenced personnel.

2.6. Ovalbumin priming assay For ovalbumin (OVA) priming assays, BMDCs derived from B6.CgTg(TcraTcrb)425Cbn/J (OTII) mice were treated in-vitro with PBS or indicated concentration of CAS in the presence of OVA peptide (100 nM) (Sigma-Aldrich, St. Louis, MO, USA) for 24 hr. For in-vitro priming assays, treated BMDCs were washed and co-cultured at a 1:10 ratio with CD4+ T-cells isolated from the spleen of OTII mice in culture media on 24 well plates (Sarstedt, Nümbrecht, Germany). For in-vivo priming assays, 3 × 105 BMDCs treated with PBS or CAS (1 mg/mL) in the presence of OVA peptide (100 nM) for 24 hrs were

2.3. Generation of bone marrow-derived dendritic cells BMDCs were differentiated using a previously described method (Lutz et al., 1999). Briefly, C57BL/6JCrl or B6.Cg-Tg(TcraTcrb) 2

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

delivered over the sternum of OTII mice by subcutaneous injection. Mice were culled after 7 days by cervical dislocation. Skin draining lymph nodes were extracted and single cell suspensions of cells were obtained by passage of the lymph nodes through a 40 μm filter using the plunger from a sterile 1 mL syringe. Draining lymph nodes cells were counted and seeded at 1 × 106 cell/mL in culture media on 24 well plates and stimulated with PBS, OVA (500 nM) or with PMA (25 ng/mL) and anti-CD3 (1 μg/mL) (R & D systems, Minneapolis, Minnesota, USA).

extent that competitive binding contributes to the effects of κ-CAS, the time of exposure on LPS stimulated BMDCs was examined. κ-CAS was shown to attenuate the production of TNF-α (Fig. 1E) and IL-12p70 (Fig. 1F) in LPS stimulated BMDCs when added prior to (−2.5 hr), at the same time or following LPS stimulation. No significant differences were detected between exposure times demonstrating that κ-CAS exerts it effects without the needs for pre-stimulation and may not compete with LPS for TLR4 binding or bind to LPS.

2.7. Flow cytometry

3.2. Novel fragment of κ-CAS responsible for suppression that targets TLR and non-TLR induced inflammatory stimuli

Cells were harvested, re-suspended in ice cold flow cytometry buffer (PBS supplemented with 2% fetal calf serum and 1 mM EDTA) and incubated with the fluorochrome labelled anti-mouse CD40 (BioLegend, No. 124609), CD54 (Ebioscience, No. 12-0541), CD80 (BioLegend, No. 104707), CD86 (BioLegend, No. 105007), CD209 (BioLegend, No. 833003) or OX40L (Ebioscience, No. 12-5905) antibodies for 30 min at 4 °C in the dark. After incubation, the cells were washed with flow cytometry buffer and processed on a FACs Aria (Becton Dickinson, Franklin Lakes, New Jersey, USA). Data were analysed using FlowJo software (Treestar, USA). Unlabeled, single fluorochrome labelled and fluorochrome labelled isotype antibodies were used as controls for nonspecific staining of cells and compensation.

Given that κ-CAS significantly supressed TLR4 mediated cytokine responses in BMDCs, we next investigated if its effects were restricted to TLR4 stimulation or could be observed when BMDCs were stimulated with other TLR (PGN-TLR2, LOX-TLR7 and CpG-TLR9) or non-TLR agonist (PMA). κ-CAS significantly suppressed the secretion of TNF-α (Fig. 2A) in response to all TLR agonists examined. PMA induces the production of TNF-α (Song, Kim, Han, Yoon, & Kim, 2015) via the activation of protein kinase C (PKC) signaling that regulates NFκB activity by mediating the phosphorylation of IκB kinase (IKK) via the activation of MAPKs (Holden et al., 2008; Sun & Yang, 2010). κ-CAS was observed to significantly suppress the secretion of TNF-α (Fig. 2B) in response PMA. Thus, we determined that κ-CAS abrogates TLR and non-TLR induced TNF-α cytokine signaling in BMDCs. The inhibition of LPS mediated inflammatory responses in macrophages by the C-terminal fragment of κ-CAS: GMP and its hydrolysate derivatives (Cheng et al., 2015; Li, Cheng, Du, Chen, & Mao, 2017; Mikkelsen et al., 2005), is attributed to the upregulation of heme oxygenase-1 (Li et al., 2017). Given that, the upregulation of heme oxygenase-1 expression also inhibits BMDC maturation and pro-inflammatory function (Chauveau et al., 2005; Schumacher et al., 2012) we next examined if the suppressive effects of κ-CAS were due to the upregulation of heme oxygenase-1. The inhibition of heme oxygenase-1 by zinc Protoporphyrin-9 (ZnPPIX) did not restore inflammatory cytokine release (Fig. 2C) which would suggest that the suppressive mechanism exerted by κ-CAS on LPS induced cytokine production in BMDCs is independent of heme oxygenase-1. Moreover, we also examined if intact κ-CAS or the release of an active component was responsible for the immunosuppressive activity. We determined that a protease inhibitor cocktail containing; 4-(2-aminoethyl)-benzenesulphonyl fluoride, aprotinin, leupeptin, bestatin, pepstatin A and E-64, which blocks the possible hydrolysis of κ-CAS by cell proteases, reversed the suppressive effects κ-CAS exhibited on LPS induced TNF-α (Fig. 2D) production in BMDCs.

2.8. Quantitative polymerase chain reaction Total RNA were extracted from cells using a RNA isolation kit (Roche Diagnostics, West Sussex, UK) according to the manufacturer’s instructions. cDNA was reverse transcribed from the isolated RNA using a transcriptor first strand cDNA synthesis kit (Roche Diagnostics, West Sussex, UK) according to manufacturer’s instructions. Primer probes (all from Roche Diagnostics, West Sussex, UK) with a primer efficiency of 2 were used for the detection of the murine genes; SOCS1 and SOCS3 (Table 1). The housekeeping gene GAPDH (NM_008084.2) was used as an internal standard. Gene expression was examined using a Light Cycler 96 (Roche Diagnostics, West Sussex, UK). Samples were maintained at 95 °C for 10 s as an initial step, followed by 40 amplification cycles of 95 °C for 15 s and 60 °C for 60 s. Pfaffl’s methods were used to determine relative gene expression (Pfaffl, 2001). 3. Results 3.1. κ-CAS suppresses TLR induced TNF-a and IL-12p70, but not IL-10 in BMDCs We previously demonstrated that κ-CAS suppressed the production of TNF-α and IL-10 in LPS stimulated BMMФ (Lalor & O'Neill, 2019). Here we sought to assess if κ-CAS also altered cytokine production in BMDCs. κ-CAS significantly attenuated LPS induced TNF-α (Fig. 1A), and IL-12p70 (Fig. 1B), but exhibited no inhibitory effects on LPS induced IL-10 production (Fig. 1C). These suppressive effects could not be attributed to cytotoxic effects as κ-CAS did not alter cell viability when cells were stimulated with κ-CAS in the presence of LPS (Fig. 1D) inferring that κ-CAS selectively exerts inhibitory effects on cytokine production. Fragments of κ-CAS were reported to exhibit endotoxin binding properties, thought to contribute to the sequestering of inflammatory cytokine responses (Cheng, Gao, Chen, & Mao, 2015). To examine the

3.3. SOCS1 and SOCS3 upregulated by κ-CAS Since κ-CAS exerts effects on pro-inflammatory cytokine responses, we sought to investigate if κ-CAS induced SOCS1 or SOCS3, prominent negative regulators of cytokine signaling in DCs (Kubo, Hanada, & Yoshimura, 2003). κ-CAS significantly enhanced the expression of SOCS1 (Fig. 3A) and SOCS3 (Fig. 3B) after 1 and 2 hr exposures. However, after 6 h the expression of both genes decreased to baseline levels. 3.4. κ-CAS downregulates the expression of activation markers and costimulatory markers in BMDCs In murine macrophages, κ-CAS induced the expression of the extracellular costimulatory receptors CD40 and OX40L and the adhesion receptor CD54 (Lalor & O'Neill, 2019), indicative of an activated macrophage phenotype. Herein we investigated if these phenomena were also observed in BMDCs. In contrast, BMDCs stimulation with κCAS resulted in a significant decrease in the geometric expression of the co-stimulatory receptors CD80 (Fig. 4A), OX40L (Fig. 4G), while no

Table 1 Gene name

Forward primer

Reverse primer

SOCS1 SOCS3 GAPDH

GAGTGGTTGTGGAGGGTGAG ATTTCGCTTCGGGACTAGC AGCTTGTCATCAACGGGAAG

TGAGAGGTGGGATGAGGTC AACTTGCTGTGGGTGACCAT TTTGATGTTAGTGGGGTCTCG

3

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

Fig. 1. BMDCs were pre-treated with κ-CAS (1 mg/mL) or PBS and subsequently stimulated in the presence or absence of LPS (100 ng/mL) for 18 hr. Supernatants were analysed for the secretion of TNF-α (A), IL-12p70 (B) and IL-10 (C) by ELISA. Results are expressed as mean ± SD of 3 independent experiments. P-values were calculated using student’s t-test. n.s, non-significant; **, p ≤ 0.01 compared to PBS control group. The potential for any cytotoxic effects exerted by κ-CAS (1 mg/mL) was assessed by resazurin assay (D). Figure represents cell viability, expressed as absorbance ± SD of 3 independent experiments. P-values were calculated using one-way ANOVA. n.s, compared to PBS treated control. BMDCs were also treated with κ-CAS (1 mg/mL) 2.5 h prior, at the same time as, or 2.5 after hours post LPS (100 ng/mL) stimulation and analysed for the secretion of TNF-α (E) and IL-12p70 (F) by ELISA. Results are expressed as mean ± SD of 3 independent experiments. P-values were calculated using one-way ANOVA. **, p ≤ 0.01 compared to PBS control group. Fig. 2. BMDCs were pre-treated with κ-CAS (1 mg/ mL) or PBS and subsequently stimulated in the presence or absence of PGN (5 μg/mL), LOX (0.5 mM) or CpG (2 μM) and analysed for the secretion of TNF-α (A) by ELISA. Results are expressed as mean ± SD of 2 independent experiments. P-values were calculated using multiple student’s t tests. **, p ≤ 0.01 compared to PBS control group. To examine the effects of non-TLR inflammatory stimuli, BMDCs were pre-treated with κ-CAS (1 mg/mL) or PBS and subsequently stimulated in the presence of PMA (20 ng/mL) (B). Results are expressed as mean ± SD of 3 independent experiments. P-values were calculated using student’s t tests. *, p ≤ 0.05 compared to PBS control group. BMDCs were also pre-treated with PBS, the heme oxygenase-1 inhibitor: ZnPPIX (10 μM or 20 μM) (C) or a protease inhibitor cocktail (1:500 v/v) (D) prior to κ-CAS (1 mg/mL) treatment, followed by stimulation with LPS (100 ng/mL) and analysed for the secretion of TNF-α by ELISA. Results are expressed as mean ± SD of 3 independent experiments. P-values were calculated using two way ANOVA. **, p ≤ 0.01, κ-CAS treated samples compared to PBS or inhibitor treated controls. n.s, non-significant, PBS compared to ZnPPIX treated controls.

a small but non-significant reduction in the expression of the costimulatory molecules CD86 (Fig. 4D) and CD40 (Fig. 4F).

significant differences were observed for CD86 (Fig. 4C) and CD40 (Fig. 4E) when examining the whole BMDC population. κ-CAS treatment also reduced the expression of the adhesion receptors CD209 (Fig. 4I) and CD54 (Fig. 4K). Furthermore, there is a similar trend, with 4

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

Fig. 3. BMDCs were incubated in the presence or absence of κ-CAS (1 mg/mL) for the indicated times. Total RNA was extracted and after reverse transcription, the cDNA was analysed by qPCR for the expression of SOCS1 (A) and SOCS3 (B). RNA expression was normalized to GAPDH control gene expression and shown as mean fold increase ± SD relative to PBS control. Figures are representative of 2 independent experiments in duplicate. P-values were calculated using ANOVA multiple comparisons test. *, p ≤ 0.05; **, p ≤ 0.01 compared to PBS stimulated control.

co-cultured with κ-CAS treated BMDCs showed no increases in the expression of the cell surface markers; CTLA-4 (Fig. 5F) compared to antiCD3 anergic controls. κ-CAS also significantly attenuated the capacity of BMDCs to induce OVA-specific IL-2 production when co-cultured with OVA sensitized CD4+ T-cells in a concentration dependent manner (0.1–1 mg/mL) (Fig. 6A). Skin draining lymph node cells were isolated from mice that were treated with κ-CAS stimulated BMDCs exhibited reduced levels of IL-2 upon re-stimulation with OVA (Fig. 6C), compared with recipient mice that were treated with BMDCs stimulated with PBS. However, again no significant differences in the levels of IFN-γ were detected invitro (Fig. 6B) or in-vivo (Fig. 6D). This data would indicate that κ-CAS

3.5. κ-CAS treated BMDCs exhibit a reduced capacity to induce T-cell responses DCs are an integral link between innate and adaptive immunity, critical in the activation of CD4+ T-cells (Guermonprez, Valladeau, Zitvogel, Théry, & Amigorena, 2002). Given the reduction in receptors involved in DC:T-cell communication, we investigated if κ-CAS treated BMDCs exhibited any reduced capacity to prime T-cells responces. BMDCs stimulated with κ-CAS induced significantly less IL-2 (Fig. 5A) to non-specific stimulation compared to PBS control. However, no significant differences in the levels of IFN-γ (Fig. 5B), IL-13 (Fig. 5C), IL10 (Fig. 5D), or IL-17 (Fig. 5E) were observed. Moreover, CD4+ T-cells

Fig. 4. Primer sequences used for the qPCR anlysis. BMDCs were treated with κ-CAS (1 mg/mL) or PBS for 18 hr and subsequently analysed by flow cytometry by staining for 30 min with specific antibodies or an isotype matched control for the extracellular expression of CD80 (A), CD86 (C), CD40 (E), OX40L (G), CD209 (I) and CD54 (K). Results were analysed using FlowJo software (Treestar, USA) and are expressed as the geometric MFI ± SD of 3 independent experiments. P-values were calculated using two-tailed student’s t-test. n.s, non-significant; ** , p ≤ 0.01 * , p ≤ 0.05 compared to PBS control. Representative histograms plots show the surface expression of CD80 (B), CD86 (D), CD40 (F), OX40L (H), CD209 (J) and CD54 (L); unstained (gray line), isotype (dotted grey line), PBS (black dotted line) and κ-CAS (black line). 5

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

Fig. 5. BMDCs pre-treated with κ-CAS (1 mg/mL) or PBS were co-cultured with CD4+ T-cells at a ratio of 1:10, on plates that were pre-coated with anti-CD3 (1 μg/ well) overnight. CD4+ T-cells alone with anti-CD3 were used a negative control. After 72 hrs supernatants were analysed for the cytokines IL-2 (A) IFN-γ (B), IL-13 (C), IL-10 (D) and IL-17 (E) by ELISA. Results are expressed as mean ± SD of at least 3 independent experiments. P-values were calculated using one-way ANOVA. n.s, non-significant; *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001 compared to PBS control group. Following co-culture, CD4+ T-cells cells were also analysed for the extracellular surface marker CTLA4 (F) by flow cytometry. Results were expressed as the geometrical mean ± SD of 2 independent experiments. P-values were calculated using one-way ANOVA. n.s, non-significant; *, p ≤ 0.05 compared to PBS control group.

treated BMDCs have a significantly reduced capacity to elicit specific and non-specific T-cell responses, by abrogating the production of IL-2, a cytokine essential for the propagation of adaptive immune responses.

chronic diseases has rapidly expanded (Kitts & Weiler, 2003) and since many of these diseases are immune-driven, extensive research has examined their therapeutic potential in the amelioration of inflammatory conditions (Hvas et al., 2016; López-Posadas et al., 2010; Muñoz et al., 2017; Requena et al., 2008; Roldán, Jiménez, Cervantes-García, Marín, & Salinas, 2016). Limited studies have examined the suppressive potential of κ-CAS on LPS mediated cytokine release from DCs (Mikkelsen

4. Discussion The reported benefits of nutraceutical’s in the management of many

Fig. 6. BMDCs from OTII mice were cultured with OVA (100 nM) in the presence of PBS or indicated concentrations of κ-CAS overnight. Cells were subsequently washed and co-cultured with CD4+ T-cells from naïve OTII mice at a 1:10 ratio. After 72 hr supernatants were analyzed for the cytokines IL-2 (A) and IFN-γ (B) by ELISA. Results are expressed as mean ± SD of 3 individual wells from 3 individual mice. P-values were calculated using one-way ANOVA. *, p ≤ 0.05 **, p ≤ 0.01 compared to PBS control. OVA (100 mM) and PBS or κCAS (1 mg/mL) treated BMDCs were also subcutaneously injected over the sternum of naïve OTII mice. After 7 days, cells from the draining skin lymph nodes were extracted for re-stimulation in-vitro with PBS, OVA (500 nM) or with PMA (20 ng/mL) and anti-CD3 (1 μg/mL). After 72 hr, supernatants were analyzed for the cytokines IL-2 (C) and IFN-γ (D) by ELISA. Results are expressed as mean ± SD from 5 individual mice. P-values were calculated using two-way ANOVA. n.s, nonsignificant; *, p ≤ 0.05 compared to PBS treated group.

6

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

et al., 2005) with a dearth of research examining the ability of κ-CAS to modulate DC maturation, and its ability to prime adaptive immune responses. This study demonstrated that similar to previous studies (Mikkelsen et al., 2005), κ-CAS selectively reduced the secretion of the pro- inflammatory cytokines, TNF-α and IL-12p70. We further showed that the suppression of cytokines by κ-CAS was selective as the levels of the anti-inflammatory/regulatory cytokine, IL-10 was not altered (Moore, de Waal Malefyt, Coffman, & O'Garra, 2001). κ-CAS also rendered BMDCs hypo-responsive to a panel of other TLRs as well as a nonTLR agonist (PMA), that activates DCs to produce TNF-α via the upregulation of protein-kinase C (PKC) signaling (Cejas et al., 2005; Lindner et al., 2007; Song et al., 2015). Many studies have attributed the inhibitory activity of κ-CAS to the C-terminal fragment GMP and its derivatives (Cheng et al., 2015; Li et al., 2017). Cheng et al., demonstrated that GMP and enzymatic derivatives bound the TLR ligand LPS, a mechanism partially thought to contribute to the attenuation of inflammatory cytokine release by blocking NF-κB activation in macrophages (Cheng et al., 2015). However, treatment of BMDCs with κ-CAS pre or post LPS stimulation did not affect the suppressive properties indicating that κ-CAS did not complete for the TLR4 ligand. Another proposed mechanism by which κ-CAS and its derivatives attenuate inflammatory activity was due to the upregulation of heme oxygenase-1, which, when inhibited, resulted in the restoration of inflammatory cytokine expression in macrophages (Li et al., 2017). Studies have demonstrated that the upregulation of heme-oxygenase-1 induces tolerogenic-like DCs, sequestering their inflammatory activity and maintaining them in an immature-like state (Chauveau et al., 2005; Schumacher et al., 2012). However, the inhibition of heme oxygenase-1 by ZnPPIX did not restore inflammatory cytokine release in BMDCs confirming that κ-CAS exerts its suppressive effects independent of heme oxygenase-1. We also demonstrated that proteolytic cleavage by cell proteases was required for the release of an active component responsible for the observed immunosuppressive effects. This would infer that a fragment and not the whole κ-CAS subunit attenuate inflammatory signalling pathways in BMDCs similarly as demonstrated in our previous studies, which revealed that a novel fragment of the κ-CAS subunit was responsible for the immunomodulatory effects on macrophages (Lalor & O’Neill, 2019). Given that similar effects were observed in both macrophages and BMDCs treated with κ-CAS, further studies are warranted to determine if both cell types process and release the same active component which is responsible for the immunomodulatory activity. However, it must be considered that differences may exist between the native and purified κCAS protein used in our experiments due to the harsh methodology required to separate and obtain the purified subunit which can affect protein folding, amino group interactions amongst other chemical and physical properties (Agyei, Ongkudon, Wei, Chan, & Danquah, 2016). These differences could be partially responsible for the observed immunomodulatory effects that would otherwise not be naturally observed when the native proteins interact with the immune system. Further investigations into chemical and structural differences between the native and purified κ-CAS should be carried out to elucidate if this is responsible for the enhanced immunomodulatory effects. SOCS 1 and SOCS 3 which were both upregulated by κ-CAS, have been identified as an important negative regulators of cytokine-mediated processes and antigen presentation by DCs. SOCS proteins have emerged as critical modulators of the TLR pathway. Both SOCS proteins bind and inhibit the janus kinases (JAKs); intracellular, non-receptor tyrosine kinases that signals via the JAK-STAT pathway critical to the initiation of NFκB signalling (Banerjee, Biehl, Gadina, Hasni, & Schwartz, 2017). SOCS3 is a prominent inhibitory protein, normally induced in response to inflammatory stimuli in a negative feedback loop that is essential in the resolution of inflammation (Yoshimura, Nake, & Kubo, 2007). Moreover, SOCS 3-transduced DCs have been demonstrated to exhibit low expression levels of co-stimulatory receptors and immuno-stimulatory cytokines like IL- 12p70 and a

decreased ability to induce T-cell proliferation (Li, Chu, Rostami, & Zhang, 2006). Pathogen derived proteins were shown to enhance SOCS3 expression in DCs, which also display a decreased capacity to prime T-cells (Vukman, Adams, & O’Neill, 2013; Klaver, Kuijk, Lindhorst, Cummings, & van Die, 2015). SOCS1 upregulation has been shown to restrict pro-inflammatory IL-12 production and signaling in DCs (Evel-Kabler, Song, Aldrich, Huang, & Chen, 2005). Moreover, studies have also demonstrated that the silencing of the SOCS1 gene resulted in enhanced antigen presentation capacity, greater TLR sensitivity and induce enhanced pro-inflammatory T-cell responses compared to DCs that expressed functional SOCS1 (Hanada et al., 2005; Sachithanandan et al., 2011; Shen, Evel-Kabler, Strube, & Chen, 2004). A DCs maturation and activation status is generally defined by the production of inflammatory mediators such as cytokines like TNF-α, IL12p70, amongst others and the elevated expression of cell surface costimulatory markers (Dowling, Hamilton, & O'Neill, 2008). We demonstrated that κ-CAS reduced the capacity of BMDCs to secrete inflammatory mediators and reduced the expression of receptors associated with co-stimulation, maturation, activation and adhesion. The co-stimulatory molecules CD80 and OX40L are rapidly upregulated upon DC activation and maturation. These receptors are associated with the induction of T-cell responses by DCs through the amplification of TCR signaling promoting effector T-cell expansion and survival (Croft, So, Duan, & Soroosh, 2009; Guermonprez et al., 2002). Low level expression of CD80 is normally associated with immature (steady state) DCs and has been shown to be involved in down-regulation of immune responses (Lohr, Knoechel, Kahn, & Abbas, 2004). Reduced OX40L expression on DCs has also been shown stunt the capacity of DCs to induce robust T-cell responses (Soroosh, Ine, Sugamura, & Ishii, 2006). We also saw a reduced expression of the extracellular receptors CD54 and CD209. CD54 is an extracellular adhesion molecule and there is supporting evidence for its upregulation as a marker for assessing APC activation (Sheikh & Jones, 2008). CD54 has also been shown to be implicated in the promotion of lymphocyte adhesion (Van Seventer, Shimizu, Horgan, & Shaw, 1990) and its expression on DCs is correlated with its antigen-presentation properties (McCarthy et al., 1997). Adhesion receptors like CD54 has been shown to ligate with LFA-1 on the surface of T-cells, enhancing cell-cell contact necessary for the formation of the immunologic synapse and optimal activation and differentiation of T-cells (Bachmann et al., 1997; Springer, 1995). The importance of CD54 in this process has been demonstrated by antibodyblocking studies, which show that CD54 is necessary for DC clustering of T-cells (Scheeren, Koopman, Van der Baan, Meijer, & Pals, 1991) and stimulating allogeneic T-cell responses (Sheikh & Jones, 2008; Xu et al., 1992). CD209 is a C-type lectin receptor highly expressed by DCs involved in the internalization of antigens and DC trafficking (Geijtenbeek, Engering, & Van Kooyk, 2002). Moreover, it has been implicated in the early interaction between DCs and naive T-cells. CD209 has been demonstrated to bind the extracellular adhesion molecules CD50 and CD102 on T-cells, thereby promoting the adhesion of DCs to naive T-cells (Geijtenbeek et al., 2000). This further highlights the impact κ-CAS treatment exhibits on BMDC maturation and cell signaling capabilities, a reduction of which being classically associated with immature DCs phenotypes. The reduction in inflammatory mediator release and receptor repertoire induced by κ-CAS would suggest it renders BMDCs in an immature, non-active state. This would suggest that these BMDCs would have a limited capacity to interact with T-cells, as proper maturation and activation is critical to a DCs ability to participate in the priming of T-cells to trigger the development of adaptive immune responses (Pasare & Medzhitov, 2004). Indeed we demonstrated that κ-CAS treated BMDCs were shown to have significantly reduced capacity to induce T-cell responses in in-vitro and in-vivo models, similar to our previous studies of κ-CAS treated macrophages (Lalor & O’Neill, 2019), abrogating the induction of IL-2, a cytokine critical to the induction of T-cell responses (Cornish, Sinclair, & Cantrell, 2006). Interestingly, we 7

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

observed no significant differences in the levels of IFN-γ, IL-10, IL-13 or IL-17. Studies in humans have previously shown that anergic T-cells secreted IFN-γ and not IL-2 as the result of poor immunological synapses (the contact between T cells and APCs) (Carlin et al., 2005). However, CD4+ T-cells cultured with κ-CAS treated BMDCs did not display CTLA4, a prominent extracellular surface markers associated with anergic T-cells (Buchbinder & Desai, 2016). The downregulation of inflammatory mediator release and receptors essential in T-cell contact and activation by κ-CAS likely results in the observed attenuated capacity to induce robust T-cell responses, but more studies are required to elucidate the exact mechanism.

2 by anergic human T cells correlates with assembly of an immature immune synapse. Blood, 106, 3874–3879. https://doi.org/10.1182/blood-2005-03-0996. Cejas, P. J., Carlson, L. M., Zhang, J., Padmanabhan, S., Kolonias, D., Lindner, I., et al. (2005). Protein kinase C betaII plays an essential role in dendritic cell differentiation and autoregulates its own expression. Journal of Biological Chemistry, 280(31), 28412–28423. Chauveau, C., Rémy, S., Royer, P. J., Hill, M., Tanguy-Royer, S., Hubert, F. X., et al. (2005). Heme oxygenase-1 expression inhibits dendritic cell maturation and proinflammatory function but conserves IL-10 expression. Blood, 106, 1694–1702. https:// doi.org/10.1182/blood-2005-02-0494. Cheng, X., Gao, D., Chen, B., & Mao, X. (2015). Endotoxin-binding peptides derived from casein glycomacropeptide inhibit lipopolysaccharide-stimulated inflammatory responses via blockade of NF-κB activation in macrophages. Nutrients, 7, 3119–3137. https://doi.org/10.3390/nu7053119. Cobrin, G. M., & Abreu, M. T. (2005). Defects in mucosal immunity leading to Crohn's disease. Immunological Reviews, 206, 277–295. https://doi.org/10.1111/j.0105-2896. 2005.00293.x. Cornish, G. H., Sinclair, L. V., & Cantrell, D. A. (2006). Differential regulation of T-cell growth by IL-2 and IL-15. Blood, 108, 600–608. https://doi.org/10.1182/blood2005-12-4827. Croft, M., So, T., Duan, W., & Soroosh, P. (2009). The significance of OX40 and OX40L to T cell biology and immune disease. Immunological Reviews, 229(1), 173–191. https:// doi.org/10.1111/j.1600-065X.2009.00766.x. Dowling, D., Hamilton, C. M., & O'Neill, S. M. (2008). A comparative analysis of cytokine responses, cell surface marker expression and MAPKs in DCs matured with LPS compared with a panel of TLR ligands. Cytokine, 41(3), 254–262. https://doi.org/10. 1016/j.cyto.2007.11.020. El-Gabalawy, H., Guenther, L. C., & Bernstein, C. N. (2010). Epidemiology of immunemediated inflammatory diseases: Incidence, prevalence, natural history, and comorbidities. Journal of Rheumatology. Supplement, 85, 2–10. https://doi.org/10.3899/ jrheum.091461. Evel-Kabler, K., Song, X. T., Aldrich, M., Huang, X. F., & Chen, S. Y. (2005). SOCS1 restricts dendritic cells' ability to break self tolerance and induce antitumor immunity by regulating IL-12 production and signaling. The Journal of clinical investigation, 116(1), 90–100. Garrett, W. S., Lord, G. M., Punit, S., Lugo-Villarino, G., Mazmanian, S. K., Ito, S., et al. (2007). Communicable ulcerative colitis induced by T-bet deficiency in the innate immune system. Cell, 131(1), 33–45. https://doi.org/10.1016/j.cell.2007.08.017. Geijtenbeek, T. B., Engering, A., & Van Kooyk, Y. (2002). DC-SIGN, a C-type lectin on dendritic cells that unveils many aspects of dendritic cell biology. Journal of Leukocyte Biology, 71, 921. Geijtenbeek, T. B., Torensma, R., van Vliet, S. J., van Duijnhoven, G. C., Adema, G. J., van Kooyk, Y., et al. (2000). Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell, 100(5), 575–585. Gill, H. S., Doull, F., Rutherfurd, K. J., & Cross, M. L. (2000). Immunoregulatory peptides in bovine milk. British Journal of Nutrition, 84, S111–S117. https://doi.org/10.1017/ S0007114500002336. Gokhale, A. S., & Satyanarayanajois, S. (2014). Peptides and peptidomimetics as immunomodulators. Immunotherapy, 6, 755–774. https://doi.org/10.2217/imt.14.37. Gren, S. T., & Grip, O. (2016). Role of monocytes and intestinal macrophages in Crohn's disease and ulcerative colitis. Inflammatory Bowel Diseases, 22, 1992–1998. https:// doi.org/10.1097/MIB.0000000000000824. Guermonprez, P., Valladeau, J., Zitvogel, L., Théry, C., & Amigorena, S. (2002). Antigen presentation and T cell stimulation by dendritic cells. Annual Review of Immunology, 20, 621–667. https://doi.org/10.1146/annurev.immunol.20.100301.064828. Hanada, T., Tanaka, K., Matsumura, Y., Yamauchi, M., Nishinakamura, H., Aburatani, H., et al. (2005). Induction of hyper Th1 cell-type immune responses by dendritic cells lacking the suppressor of cytokine signaling-1 gene. Journal of Immunology, 174(7), 4325–4332. Holden, N. S., Squires, P. E., Kaur, M., Bland, R., Jones, C. E., & Newton, R. (2008). Phorbol ester-stimulated NF-kB-dependent transcription: Roles for isoforms of novel protein kinase C. Cellular Signalling, 20(7), 1338–1348. https://doi.org/10.1016/j. cellsig.2008.03.001. Hvas, C. L., Dige, A., Bendix, M., Wernlund, P. G., Christensen, L. A., Dahlerup, J. F., et al. (2016). Casein glycomacropeptide for active distal ulcerative colitis: A randomized pilot study. European Journal of Clinical Investigation, 46, 555–563. https://doi.org/ 10.1111/eci.12634. Kitts, D. D., & Weiler, K. (2003). Bioactive proteins and peptides from food sources. Applications of bioprocesses used in isolation and recovery. Current Pharmaceutical Design, 9, 1309–1323. https://doi.org/10.2174/1381612033454883. Klaver, E. J., Kuijk, L. M., Lindhorst, T. K., Cummings, R. D., & van Die, I. (2015). Schistosoma mansoni soluble egg antigens induce expression of the negative regulators SOCS1 and SHP1 in human dendritic cells via interaction with the mannose receptor. PLoS ONE, 10(4), e0124089. https://doi.org/10.1371/journal.pone. 0124089. Kubo, M., Hanada, T., & Yoshimura, A. (2003). Suppressors of cytokine signaling and immunity. Nature Immunology, 4(12), 1169–1176. https://doi.org/10.1038/ni1012. Lalor, R., & O'Neill, S. (2019). Bovine κ-Casein fragment induces hypo-responsive M2-like macrophage phenotype. Nutrients, 11(7), E1688. https://doi.org/10.3390/ nu11071688. Li, T., Cheng, X., Du, M., Chen, B., & Mao, X. (2017). Upregulation of heme oxygenase-1 mediates the anti-inflammatory activity of casein glycomacropeptide (GMP) hydrolysates in LPS-stimulated macrophages. Food & Function, 8, 2475–2484. https://doi. org/10.1039/c7fo00481h. Li, Y., Chu, N., Rostami, A., & Zhang, G. (2006). Dendritic cells transduced with SOCS-3 exhibit a tolerogenic/DC2 phenotype that directs type 2 Th cell differentiation in

5. Conclusion The results obtained in the present study demonstrated that κ-CAS renders BMDCs hypo-responsive to inflammatory signals, reducing extracellular receptors associated with their maturation, activation and adhesion, which may interfere with the inflammatory capabilities of DCs. We also presented evidence which suggests that κ-CAS treated BMDCs acquire an immature-like phenotype which impairs their function and ultimately their capacity to induce and propagate T-cell responses. Given the powerful immunomodulatory effects exhibited by κCAS on BMDCs, a cell type heavily involved in initiation and propagation of adaptive immune responses, a greater understanding of the mechanisms by which κ-CAS exerts these effects may lead to the development of novel immune-modulatory nutraceutical therapeutic for the treatment of inflammatory diseases, by sequestering the initiation of T-cell responses, a critical process in the propagation of inflammatory responses. Ethical statement Ethical permission for the use of animals in this research was approved by the Department of Health or Health Products Regulatory Authority and Dublin City University ethics committee (licence numbers B100/2833, DCUREC/2010/033). Declaration of Competing Interest The authors declared that there is no conflict of interest. Appendix A. Supplementary material Supplementary data to this article can be found online at https:// doi.org/10.1016/j.jff.2019.103620. References Agyei, D., Ongkudon, C. M., Wei, C. Y., Chan, A. S., & Danquah, M. K. (2016). Bioprocess challenges to the isolation and purification of bioactive peptides. Food and Bioproducts Processing, 98, 244–256. https://doi.org/10.1016/j.fbp.2016.02.003. Bachmann, M. F., McKall-Faienza, K., Schmits, R., Bouchard, D., Beach, J., Speiser, D. E., et al. (1997). Distinct roles for LFA-1 and CD28 during activation of naive T cells: Adhesion versus costimulation. Immunity, 7(4), 549–557. https://doi.org/10.1016/ s1074-7613(00)80376-3. Banerjee, S., Biehl, A., Gadina, M., Hasni, S., & Schwartz, D. M. (2017). JAK-STAT signaling as a target for inflammatory and autoimmune diseases: Current and future prospects. Drugs, 77(5), 521–546. https://doi.org/10.1007/s40265-017-0701-9. Bates, J., & Diehl, L. (2014). Dendritic cells in IBD pathogenesis: An area of therapeutic opportunity? The Journal of Pathology, 232, 112–120. https://doi.org/10.1002/path. 4277. Baumgart, D. C., Thomas, S., Przesdzing, I., Metzke, D., Bielecki, C., Lehmann, S. M., et al. (2009). Exaggerated inflammatory response of primary human myeloid dendritic cells to lipopolysaccharide in patients with inflammatory bowel disease. Clinical and Experimental Immunology, 157(3), 423–436. https://doi.org/10.1111/j.1365-2249. 2009.03981.x. Buchbinder, E. I., & Desai, A. (2016). CTLA-4 and PD-1 pathways: Similarities, differences, and implications of their inhibition. American Journal of Clinical Oncology, 39(1), 98–106. https://doi.org/10.1097/COC.0000000000000239. Carlin, L. M., Yanagi, K., Verhoef, A., Nolte-'t Hoen, E. N. M., Yates, J., Gardner, L., Lamb, J., Lombardi, G., Dallman, M. J., & Davis, D. M. (2005). Secretion of IFN-γ and not IL-

8

Journal of Functional Foods 64 (2020) 103620

R. Lalor and S. O'Neill

https://doi.org/2023–31. 10.2337/db11-0259. Sakuraba, A., Sato, T., Kamada, N., Kitazume, M., Sugita, A., & Hibi, T. (2009). Th1/Th17 immune response is induced by mesenteric lymph node dendritic cells in Crohn's disease. Gastroenterology, 137(5), 1736–1745. https://doi.org/10.1053/j.gastro. 2009.07.049. Scheeren, R. A., Koopman, G., Van der Baan, S., Meijer, C. J., & Pals, S. T. (1991). Adhesion receptors involved in clustering of blood dendritic cells and T lymphocytes. European Journal of Immunology, 21(5), 1101–1105. Schumacher, A., Wafula, P. O., Teles, A., El-Mousleh, T., Linzke, N., Zenclussen, M. L., et al. (2012). Blockage of heme oxygenase-1 abrogates the protective effect of regulatory T cells on murine pregnancy and promotes the maturation of dendritic cells. PLoS ONE, 7(8), e42301. https://doi.org/10.1371/journal.pone.0042301. Scott, C. L., Aumeunier, A. M., & Mowat, A. M. (2011). Intestinal CD103+ dendritic cells: Master regulators of tolerance? Trends in Immunology, 32(9), 412–419. https://doi. org/10.1016/j.it.2011.06.003. Sheikh, N. A., & Jones, L. A. (2008). CD54 is a surrogate marker of antigen presenting cell activation. Cancer Immunology, Immunotherapy, 57(9), 1381–1390. https://doi.org/ 10.1007/s00262-008-0474-9. Shen, L., Evel-Kabler, K., Strube, R., & Chen, S. Y. (2004). Silencing of SOCS1 enhances antigen presentation by dendritic cells and antigen-specific anti-tumor immunity. Nature Biotechnology, 22(12), 1546–1553. Silva, M. A. (2009). Intestinal dendritic cells and epithelial barrier dysfunction in Crohn's disease. Inflammatory Bowel Diseases, 15, 436–453. https://doi.org/10.1002/ibd. 20660. Song, J. S., Kim, Y. J., Han, K. U., Yoon, B. D., & Kim, J. W. (2015). Zymosan and PMA activate the immune responses of Mutz3-derived dendritic cells synergistically. Immunology Letters, 167(1), 41–46. https://doi.org/10.1016/j.imlet.2015.07.002. Soroosh, P., Ine, S., Sugamura, K., & Ishii, N. (2006). OX40-OX40 ligand interaction through T cell-T cell contact contributes to CD4 T cell longevity. Journal of Immunology, 176(10), 5975–5987. https://doi.org/10.4049/jimmunol.176.10.5975. Springer, T. A. (1995). Traffic signals on endothelium for lymphocyte recirculation and leukocyte emigration. Annual Review of Physiology, 57, 827–872. https://doi.org/10. 1146/annurev.ph.57.030195.004143. Steinman, R. M., Inaba, K., Turley, S., Pierre, P., & Mellman, I. (1999). Antigen capture, processing, and presentation by dendritic cells: Recent cell biological studies. Human Immunology, 60, 562–567. https://doi.org/10.1016/S0198-8859(99)00030-0. Sun, W., & Yang, J. (2010). Molecular basis of lysophosphatidic acid-induced NF-B activation. Cellular Signalling, 22(12), 1799–1803. https://doi.org/10.1016/j.cellsig. 2010.05.007. Thaiss, C. A., Semmling, V., Franken, L., Wagner, H., & Kurts, C. (2011). Chemokines: A new dendritic cell signal for T cell activation. Frontiers in Immunology, 2, 31. https:// doi.org/10.3389/fimmu.2011.00031. Van Seventer, G. A., Shimizu, Y., Horgan, K. J., & Shaw, S. (1990). The LFA-1 ligand ICAM-1 provides an important costimulatory signal for T cell receptor-mediated activation of resting T cells. Journal of Immunology, 144(12), 4579–4586. Vukman, K. V., Adams, P. A., & O’Neill, S. M. (2013). Fasciola hepatica tegumental coat antigen suppresses MAPK signalling in dendritic cells and up-regulates the expression of SOCS3. Parasite Immunology, 35(7–8), 234–238. https://doi.org/10.1111/pim. 12033. Xu, H., Friedrichs, U., Gieseler, R. K., Ruppert, J., Ocklind, G., & Peters, J. H. (1992). Human blood dendritic cells exhibit a distinct T-cell-stimulating mechanism and differentiation pattern. Journal of Immunology, 36(5), 689–696. Yawalkar, N., Tscharner, G. G., Hunger, R. E., & Hassan, A. S. (2009). Increased expression of IL-12p70 and IL-23 by multiple dendritic cell and macrophage subsets in plaque psoriasis. Journal of Dermatological Science, 54, 99–105. https://doi.org/10. 1016/j.jdermsci.2009.01.003. Yoshimura, A., Nake, T., & Kubo, M. (2007). SOCS proteins, cytokine signalling and immune regulation. Nature Reviews: Immunology, 7, 45–465. Zaba, L. C., Fuentes-Duculan, J., Eungdamrong, N. J., Abello, M. V., Novitskaya, I., Pierson, K. C., et al. (2009). Psoriasis is characterized by accumulation of immunostimulatory and Th1/Th17 cell-polarizing myeloid dendritic cells. Journal of Investigative Dermatology, 129(1), 79–88. https://doi.org/10.1038/jid.2008.194.

vitro and in vivo. Journal of Immunology, 177(3), 1679–1688. Lichtenegger, F. S., Mueller, K., Otte, B., Beck, B., Hiddemann, W., Schendel, D. J., et al. (2012). CD86 and IL-12p70 are key players for T helper 1 polarization and natural killer cell activation by toll-like receptor-induced dendritic cells. PLoS ONE, 7(9), e44266. https://doi.org/10.1371/journal.pone.0044266. Lindner, I., Cejas, P. J., Carlson, L. M., Torruellas, J., Plano, G. V., & Lee, K. P. (2007). Signal transduction in DC differentiation: Winged messengers and Achilles' heel. Advances in Experimental Medicine and Biology, 590, 1–29. Lohr, J., Knoechel, B., Kahn, E. C., & Abbas, A. K. (2004). Role of B7 in T cell tolerance. Journal of Immunology, 173, 5028–5035. https://doi.org/10.4049/jimmunol.173.8. 5028. López-Posadas, R., Requena, P., González, R., Suárez, M. D., Zarzuelo, A., Sánchez de Medina, F., et al. (2010). Bovine glycomacropeptide has intestinal antiinflammatory effects in rats with dextran sulfate-induced colitis. Journal of Nutrition, 140, 2014–2019. https://doi.org/10.3945/jn.109.118448. Lutz, M. B., Kukutsch, N., Ogilvie, A. L., Rössner, S., Koch, F., Romani, N., et al. (1999). An advanced culture method for generating large quantities of highly pure dendritic cells from mouse bone marrow. Journal of Immunological Methods, 223(1), 77–92. https://doi.org/10.1016/s0022-1759(98)00204-x. Marx, V. (2005). Watching peptides grow up. Chemical and Engineering News, 83, 17–24. https://doi.org/10.1021/cen-v083n011.p017. Mason, J. M. (2010). Design and development of peptides and peptide mimetics as antagonists for therapeutic intervention. Future Medicinal Chemistry, 2, 1813–1822. https://doi.org/10.4155/fmc.10.259. McCarthy, D. A., Macey, M. G., Bedford, P. A., Knight, S. C., Dumonde, D. C., & Brown, K. A. (1997). Adhesion molecules are upregulated on dendritic cells isolated from human blood. Immunology, 92(2), 244–251. Mikkelsen, T. L., Bakman, S., Sørensen, E. S., Barkholt, V., & Frøkiaer, H. (2005). Sialic acid-containing milk proteins show differential immunomodulatory activities independent of sialic acid. Journal of Agriculture and Food Chemistry, 53, 7673–7680. https://doi.org/10.1021/jf050398o. Moore, K. W., de Waal Malefyt, R., Coffman, R. L., & O'Garra, A. (2001). Interleukin-10 and the interleukin-10 receptor. Annual Review of Immunology, 19, 683–765. Muñoz, F. C., Cervantes, M. M., Cervantes-García, D., Jiménez, M., Ventura-Juárez, J., & Salinas, E. (2017). Glycomacropeptide attenuates inflammation, pruritus, and Th2 response associated with atopic dermatitis induced by 2,4-dinitrochlorobenzene in rat. Journal of Immunology Research, 6935402. https://doi.org/10.1155/2017/ 6935402. Pasare, C., & Medzhitov, R. (2004). Toll-like receptors and acquired immunity. Seminars in Immunology, 16, 23–26. Patil, S., Pincas, H., Seto, J., Nudelman, G., Nudelman, I., & Sealfon, S. C. (2010). Signaling network of dendritic cells in response to pathogens: A community-input supported knowledgebase. BMC Systems Biology, 4, 137. https://doi.org/10.1186/ 1752-0509-4-137. Pfaffl, M. W. (2001). A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Research, 29(9), e45-e45. https://doi.org/10.1093/nar/29.9. e45. Requena, P., Daddaoua, A., Martínez-Plata, E., González, M., Zarzuelo, A., Suárez, M. D., et al. (2008). Bovine glycomacropeptide ameliorates experimental rat ileitis by mechanisms involving downregulation of interleukin 17. British Jornal of Pharmacology, 154, 825–832. https://doi.org/10.1038/bjp.2008.138. Riss, T. L., Moravec, R. A., & Niles, A. L. (2013). Cell viability assays (updated 2016 Jul 1). In G. S. Sittampalam, N. P. Coussens, & K. Brimacombe (Eds.). Assay Guidance Manual [Internet]Bethesda (MD): Eli Lilly & Company and the National Center for Advancing Translational Sciences 2004. Roldán, N. R., Jiménez, M., Cervantes-García, D., Marín, E., & Salinas, E. (2016). Glycomacropeptide administration attenuates airway inflammation and remodeling associated to allergic asthma in rat. Inflammation Research, 65, 273–283. https://doi. org/10.1007/s00011-015-0913-y. Sachithanandan, N., Graham, K. L., Galic, S., Honeyman, J. E., Fynch, S. L., Hewitt, K. A., et al. (2011). Macrophage deletion of SOCS1 increases sensitivity to LPS and palmitic acid and results in systemic inflammation and hepatic insulin resistance. Diabetes, 60

9