- Email: [email protected]
Brucella abortus S19 rfbD mutant is highly attenuated, DIVA enable and confers protection against virulent challenge in mice
Biologicals xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Biologicals journal homepage: www.elsevier.com/locate/biologicals
Brucella abortus S19 rfbD mutant is highly attenuated, DIVA enable and confers protection against virulent challenge in mice Jonathan Lalsiamthara1, Gurpreet Kaur, Neha Gogia2, Syed Atif Ali, Tapas Kumar Goswami, Pallab Chaudhuri∗ Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, 243122, India
A R T I C LE I N FO
A B S T R A C T
Keywords: Brucella abortus S19 Brucellosis Rough mutant vaccine DIVA Mice model Cytokines Vaccine
Brucella abortus S19 is an important tool for controlling bovine brucellosis across the globe. However, vaccination with S19 suffers critical shortcomings such as, presence of residual virulence, induction of abortion and sero-diagnostic interference. In this study, rfbD gene deleted mutant S19 was developed. The mutant strain designated S19ΔR displayed rough LPS phenotype, which was confirmed by acriflavine dye-agglutination and LPS-SDS-PAGE analysis. The virulence was amply reduced as suggested by increased sensitivity to complement killing; reduction in splenic-bacterial load and the recovery time RT50 as validated in mice model. Anti-brucella humoral response was significantly lower as compared to S19 immunization. The minimal induction of Brucella specific IgG1, IgG2a & IgG2b, and IgG3 resulted in no apparent reactivity to RBPT antigen. S19ΔR showed protective index of 1.90 against virulent challenge. S19ΔR being highly attenuated and DIVA compatible may facilitate a platform for developing a safer bovine adulthood vaccine.
1. Introduction
2. Materials and methods
Brucellosis, a worldwide zoonosis caused by Brucella species, affects man, livestock, wild as well as marine mammals. It remained one of the most important bacterial zoonotic diseases with more than 500,000 new cases reported annually [1]. Till date, no effective human vaccine is available and the control of brucellosis in livestock and wild animal is important to check the zoonotic transmission cycle. Brucella abortus S19 is the most widely used live vaccine and it confers robust protection. The disadvantage of S19 vaccine is residual virulence and sero-interference [2,3]. Rough strain brucellae with incomplete lipopolysaccharide (LPS) happen to be devoid of these drawbacks. Several LPS synthesis genes were knocked out from Brucella as a means of LPS disruption and were studied for their usefulness as vaccine candidates [4,5]. In this study, we report vaccine potential of a modified S19 strain, designated as S19ΔR, devoid of rfbD gene. The gene product is an O-antigen export system permease involved in biosynthesis of LPS present in cell surface of Brucella organism. The newly developed S19ΔR mutant was assessed for its phenotype, residual virulence and its suitability as a vaccine candidate in an experimental mouse model.
2.1. Ethics, biosafety and animals experimentation Swiss albino mice (5–6 week old) were obtained from the Laboratory Animal Resource Section, Indian Veterinary Research Institute (IVRI), Izatnagar, India. Animal experiments were performed with the approval and following the guidelines of Institute Animal Ethics Committee (IAEC). Brucella organism was handled and processed in accordance to guidelines provided by institute biosafety committee, IVRI. All animal experiments comply with the ARRIVE guidelines. . All efforts were made to ensure humane handling of animals and to minimize animals suffering. 2.2. Bacterial strains, media and growth conditions Bacterial strains used in this study are described and listed in Table 1. Brucella abortus S19 and strain 544 used in this study were obtained from Division of Biological Standardization and the Brucella Reference Laboratory at IVRI, respectively. Organisms were grown routinely in BBL-Brucella agar (BBA), tryptic soy agar (TSA) and
∗
Corresponding author. GEB Lab, B&M Division, IVRI, Izatnagar, Bareilly, UP, 243122, India. E-mail addresses: [email protected], [email protected] (P. Chaudhuri). 1 Present address: Department of Molecular Microbiology & Immunology, School of Medicine, Oregon Health & Science University, OR, USA. 2 Present address: Department of Biology, University of Dayton, Ohio, USA. https://doi.org/10.1016/j.biologicals.2019.11.005 Received 10 May 2018; Received in revised form 9 September 2019; Accepted 26 November 2019 1045-1056/ © 2019 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Please cite this article as: Jonathan Lalsiamthara, et al., Biologicals, https://doi.org/10.1016/j.biologicals.2019.11.005
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Table 1 Bacterial strains, plasmids, and PCR primers used in this study. Strain/Plasmids/Primers E. coli TOP10 B. abortus S19 B. abortus 544 B. abortus S19ΔR pZErO®-1 pUM24 pTZ57 R/T pZrfbD pZrfbD::kan
Description
Reference or Source
−
F mcrA Δ(mrr-hsdRMS-mcrBC) ϕ 80lacZ ΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697galU galK rpsL endA1 nupG Cotton vaccine strain 19; smooth Wild type; smooth; virulent; for challenge study Candidate vaccine strain ΔrfbD mutant of S19; Kanr Cloning vector, backbone vector for suicidal construct; PlaclacZα-ccdB; pUC-derived ori; Zeor. pUCK 21 derivative containing Kanr Kanamycin cassette; sacB (levansucrase) TA cloning vector; rep bla lacZα; Ampr pZErO®-1 derivative suicidal plasmid containing flanking sequences of rfbD gene pZErO®-1 derivative suicidal plasmid containing flanking sequences of rfbD gene; Kanr kanamycin resistance cassette for selection
Invitrogen IVRI This study Invitrogen [7] ThermoScientific This study This study
PCR primers BMEII0428f BMEII0428r E11 E12
5′-GCCGCTATTATGTGGACTGG 5′-AATGACTTCACGGTCGTTCG 5′-GACGAACGGAATTTTTCCAATCCC 5′-TGCCGATCACTTAAGGGCCTTCAT
S19 specific [18]
rfbD rfbD rfbD rfbD rfbD rfbD rfbD rfbD
5′5′5′5′5′5′5′5′-
Lab designed primers for cloning deletion plasmid construct
Up BamHI - F Up PstI – R Do PstI – F Do XhoI– R OT - F OT – R IN − F IN – R
Brucella specific [19]
actGGATCCCCGCGATAAGCA actCTGCAGTGATCCAGCCAT actCTGCAGCACTAAATGTGG actCTCGAGCGGTACTACCAA GCGCCGCATACTCAATAAGG TTTTTCCCGCCAGCCCATCGT CAATCCACCCTGCCTGAACAT TTGCAATTTACACGCTTAGGA
Lab designed primers for deletion confirmation
Fig. 1. Genotypic and phenotypic characterization of S19ΔR. A) PCR amplification and confirmation of the deletion event. Lane 4 depicts absence of amplified DNA band and signifies the absence of rfbD gene. Lane 6 depicts replacement of rfbD gene with kanamycin cassette. M − DNA size marker (100bp, Gene Ruler plus, Thermo Scientific). Amplicons on lane 1 and 2 were amplified using Brucella specific primers; lane 3 and 4, amplified using rfbD inner primers; lane 5 and 6, amplified using rfbD outer primers. B) Silver staining for validation of LPS profile. Arrow head depicts absence of OPS. M (protein marker). C) Acriflavine dye agglutination test validation of rough phenotype of S19ΔR. S19ΔR agglutinates acriflavine dye due to hydrophobic interactions, which was absent in S19 strain.
tryptose phosphate broth (TPB) media at 37 °C with or without 5% CO2. The S19 and S19ΔR strains were incubated in aerobic conditions while S544 was grown under 5% CO2 atmosphere at 37 °C. For the growth of S19ΔR mutant, kanamycin antibiotics at 50 μg/mL was supplemented in the medium. Erythritol at 2 mg/mL was supplemented on BBA for to differentiate S19 and 544 strains.
Fig. 2. Growth kinetic of bacterial strains. In vitro growth rate of the Brucella strains was determined in Brucella broth medium. S19ΔR showed slower growth rate as compared to wild type S19. A) Growth rate determined based on optical density measured at 600 nm. B) Growth rate determined based on plate count.
2
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Fig. 3. Evaluation of progression of Brucella specific immunoglobulin isotypes. The effect of immunization on the production of the IgG isotypes was evaluated. Serum samples of immunized mice were collected weekly for 4 weeks and the antibody levels were determined. Significant differences P ≤ 0.05.
organisms in the culture was determined using spectrometry based or enumerated as per protocol described earlier [7]. Colony counts were expressed as mean log colony forming unit (cfu/mL).
2.3. Construction and characterization of S19ΔR mutant In order to construct the deletion plasmid, pZrfbD:kan, the flanking regions of rfbD gene were amplified by PCR. Primers were engineered with BamHI-PstI and PstI-XhoI restriction sites for cloning into a suicide vector, pZErO-1 (Invitrogen, USA). A kanamycin resistance gene cassette (Kanr) was inserted between the flanking sequences via PstI site. The deletion plasmid construct was electroporated to Brucella abortus S19 at 2.5 kV, 20 msecτ (Multiporator, Eppendorf). The event of recombination was screened using kanamycin and zeocin BBA medium. Colonies were further confirmed using colony PCR and DNA sequencing that encompassed the rfbD gene region. The developed rfbD gene deletion mutant was designated as S19ΔR. LPS of the mutant strain was extracted from culture grown on solid medium (TSA plate) by hot aqueous-phenol extraction method as per protocol described earlier [6]. Extracted LPS was electrophoresed on SDS–PAGE and subjected to silver staining. For growth curve determination, single colony of the strains were inoculated into 5 mL of Tryptose phosphate broth (TPB) and incubated in a shaker incubator. A volume of 0.2 mL inoculums of the 24 h broth culture was then transferred to 19.8 mL TPB in 50 mL conical flask, which was incubated at 37 °C while shaking. Culture samples were collected every 6 h interval for 72 h of incubation and the number of
2.4. Complement sensitivity assay Sensitivity of the S19ΔR mutant to serum complement was tested by incubating the organism in freshly collected Brucella antibody free-bovine serum; the results were compared to B. abortus S19 wild type. A total of1 x103 cfu were incubated in 200 μL 50% of the serum and bacterial viability was checked hourly for 2 h. In parallel, cells were also incubated with de-complemented bovine serum and PBS controls. Each of the test lot was then spread-plated on BBA medium. After 6 days of incubation at 37 °C, the number of viable organisms were determined and expressed as log10 cfu. The experiment was performed in duplicate to ensure reproducibility. The cfu obtained were expressed as mean cfu and the percentage reduction from mean cfu (PBS) was determined. 2.5. Systemic IgG isotype responses The level of antigen specific IgG isotype antibodies, viz. IgG1, IgG2a, IgG2b and IgG3 were measured in the sera of mice. A total of 5 3
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Table 2 Splenic bacterial recovery of Brucella strains. Mice Groups (cfu)
6)
S19 (1 × 10 S19ΔR (1 × 106)
Days post inoculation (log cfu/spleen ± SEM) 30
60
90
7.08 ± 0.02 4.96 ± 0.037*
6.72 ± 0.035 2.87 ± 0.09*
4.14 ± 0.066 0 ± 0.0*
* indicates significant difference at P ≤ 0.05. Table 3 Protection index at 30 days post challenge. Mice groups
Splenic bacterial count Log cfu/spleen ± SEM
Log protection
PBS S19 S19ΔR
5.32 ± 0.192 2.41 ± 0.085* 3.42 ± 0.061*
0.00a 2.91b 1.90c
* indicates significant difference at P ≤ 0.05. abc represents different subsets.
Fig. 4. Capture ELISA based quantification of IL-2 and IL-4. The effect of immunization on the expression of the selected cytokines was evaluated. Serum samples of immunized mice were collected weekly for 4 weeks and the cytokine levels were determined. Significant differences P ≤ 0.05.
Fig. 6. Rose Bengal plate test based DIVA evaluation of immunized mice sera. Serum agglutination of Brucella whole cell antigen was determined on mice immunized with S19 and S19ΔR. Serum samples were screened weekly for 5 weeks. S19ΔR immunized mice sera failed to agglutinate the antigen while S19 immunized mice sera showed strong agglutinations.
mice were bled via retro-orbital plexus at weekly interval for four weeks and serum samples were harvested. Sonicated whole cell lysate from S19 and S19ΔR was used as coating antigen on Maxisorp ELISA plate (Nunc, USA) at a concentration of 250 ng per well. Primary serum was diluted at 1:100, and secondary goat anti-mouse IgG, IgG1, IgG2a, IgG2b and IgG3 HRPO conjugates (Santa Cruz, USA) were diluted at 1:4000. OPD was used as a substrate and the colorimetric changes were measured at 492 nm after 10 min of incubation. The relative antibody titres were expressed as mean OD ± SEM. 2.6. Cytokines profiles To assess cytokine response in immunized mice, blood samples were collected and sera harvested. A total of 5 mice serum samples were collected and assayed for interleukin (IL)-2 and IL-4 using sandwich ELISA format (KOMA BIOTECH Inc., South Korea). The experiments were conducted according to the manufacturer's instructions. 2.7. Residual virulence of the brucella strains Residual virulence analysis of S19 and S19ΔR was conducted in mice model according to protocol described earlier [6]. For recovery 50 (RT50) determinations, sixty four mice were distributed equally into two groups for S19 and S19ΔR inoculation. A total number of 1 × 106 cfu of Brucella organisms were inoculated to each mouse of either group through intra-peritoneal (IP) route. Eight mice from each group were euthanized at 3, 6, 9, 12 weeks, and clearance of bacteria from spleen was determined. To determine bacterial load in the spleen,
Fig. 5. Complement sensitivity assay. The sensitivity of the strains to complement killing was evaluated using fresh bovine serum. A) S19ΔR showed increase sensitivity to complement killing at 1 h and 2 h post incubation with 50% bovine serum. B) Percentage reduction of cfu post incubation with serum.
4
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
thirty mice were equally distributed in two groups and were inoculated with 1 × 106 cfu of either strains of Brucella as described in previous step. At 30, 60 and 90 days post inoculation, the mice were euthanized and the spleen collected to determine the number of Brucella organisms present in the organ. The whole spleen was homogenised with sterile pestle and mortar and a 10-fold serial dilution of homogenate was made in PBS. Each dilution was plated out on BBA medium to enumerate total colony forming units in the spleen. The cfu obtained were adjusted with dilution factors and expressed as mean log10 cfu/spleen ± SEM.
agglutination pattern similar to rough Brucella colonies, while the wild type S19 being a smooth phenotype did not show agglutination (Fig. 1C). Sedimentation rate of S19ΔR was faster than the parent strain S19 due to auto-agglutination that cause clumping of the bacterial cells (Supplementary Fig. S2). The growth rate of S19 and S19ΔR was also determined. Marked decrease in the growth rate of the mutant was observed as compared to wild type (Fig. 2).
2.8. Protective efficacy Protective efficacy of S19ΔR mutant was evaluated in mice model and compared with the reference vaccine strain, S19 as per protocol described earlier [6]. Five weeks old mice (n = 30) were divided equally in to three groups. The mice were inoculated with 1 × 105 cfu of either Brucella abortus S19 or S19ΔR or PBS through intra-peritoneal route. At 30 days post immunization, the animals were challenged with 2 × 105 cfu of virulent B. abortus S544. The spleens were processed according to protocol described in section 2.8. Ability of immunized mice to clear virulent B. abortus S544 was determined by total cell counts in the spleen of each group of animals. The cell counts were mathematically transformed using formula: y = log (x/logx) according to previously described method [8] to make it statistically fit. Protective Index (PI) was obtained by subtracting y value of PBS log count and y value of test vaccine log count. The observation was expressed as meanlog10 cfu/spleen ± SEM.
Brucella antigen specific humoral immune response was evaluated by indirect ELISA. The relative levels of total systemic IgG and IgG isotypes were ascertained from the serum samples of the mice immunized with the vaccine strains (Fig. 3). Predictably, S19ΔR immunized mice induced lesser antibody level as compared to smooth S19 parent strain. However, significant increase in titre of IgG and its subtypes were clearly visible in immunized animals. Among the subtypes, IgG3 induction was weakest both in parent strain and the mutant. Cytokine response evoked by immunization of Brucella was determined based on sandwich ELISA. Levels of selected cytokines, IL-2 and IL-4 were measured in mice serum samples. The production of IL-2 among mice immunized with S19 depicted a decreasing trend, while mice immunized with S19ΔR showed increasing pattern (Fig. 4A). The IL-2 levels were significantly different at weeks 1 and 4 (P ≤ 0.05). IL-4 secretions in serum of mice immunized with S19 showed increasing trend while the levels in S19ΔR mice samples were rather flat and significantly lower (P ≤ 0.05) than the S19 counterpart (Fig. 4B).
2.9. DIVA capability assessment
3.3. Complement sensitivity assay and residual virulence
Blood samples were collected from S19 or S19ΔR inoculated mice weekly for four weeks. Serum samples were separated and Rose Bengal Plate Agglutination Test (RBPT) was performed. A volume of 30 μL of test serum sample and 30 μL of RBPT test antigen were mixed using a sterile tooth pick on a sterile glass plate and then observed for agglutination. Positive control and negative control were also included in the experiment.
The sensitivity of S19 and S19ΔR strains to complement mediated killing was evaluated. Rough strain S19ΔR showed increase degree of sensitivity as compared to wild type S19 (Fig. 5A). After 1 h incubation, 53.73% and 87.83% complement mediated killing was observed and additional 1 h incubation yielded 94.62% and 100% killing of the strains, S19 and S19ΔR respectively (Fig. 5B). Residual virulence assessment of S19ΔR showed that the mutant was cleared off from the spleens of mock infected mice much earlier than the parental wild type S19 (Table 2). The RT50 of the strains was determined as 6.12 and 11.76 weeks for S19ΔR and S19, respectively (Supplementary Table S3).
3.2. Humoral and cytokine response
2.10. Statistical analysis Statistical analyses were used wherever applicable. Analyses were performed with SPSS 16.0 (SPSS Inc., USA). One-way analysis of variance (ANOVA) and Student's t-tests were used to determine statistically significant differences, with P values of ≤0.05 or ≤0.01 considered significant.
3.4. Mice protection study The efficacy of S19ΔR as a vaccine was assessed by immunization of swiss albino mice (Table 3). At 30 days post challenge, the log challenge bacterial counts recovered from spleen were 5.32 ± 0.192, 2.41 ± 0.0849 and 3.42 ± 0.061 for PBS, S19 and S19ΔR mice groups. The protective indices derived were 2.91 and 1.90 for S19 and S19ΔR, respectively.
3. Results 3.1. Brucella S19ΔR mutant confirmation and characterization S19ΔR colonies were sensitive to zeocin and resistant to kanamycin antibiotics. To confirm at genomic level, S19ΔR colonies were subjected to PCR using a set of inner primer targeting rfbD gene. S19ΔR mutant did not show amplification due to deletion of the gene (Fig. 1A). The accuracy of the mutation was further confirmed using DNA sequencing encompassing the rfbD region. The data obtained was then annotated and deposited in NIH genetic sequence database, Genbank (GenBank accession number KR608271.1). Microbiological tests confirmed identical properties of the mutant strain, S19ΔR and its parent strain, S19 (Supplementary Fig. S1). This experiment revealed that no unwanted mutation occur elsewhere in the genome at least related to the panel of test conducted. LPS extracted from S19ΔR showed absence of O-polysaccharide on SDS-PAGE after silver nitrate staining. However, the O-polysaccharide of S19 resolved at approximately ~50 KDa relative of protein molecular weight marker (Fig. 1B). Acriflavine dye agglutination test of S19ΔR revealed
3.5. DIVA capability The DIVA capability of the mutant strain upon vaccination was ascertained by the most commonly used diagnostic test, RBPT. Serum samples of mice immunized with S19ΔR failed to agglutinate RBPT antigen (Fig. 6). This feature would make S19ΔR a DIVA enable vaccine candidate. However, serum of mice immunized with S19 showed strong agglutination reaction which indirectly would interfere with sero-diagnosis of clinical infection. 4. Discussion LPS of Brucella is an important virulence factor and causes inhibition of phagosome-lysosome fusion when engulfed by macrophages [9]. Brucella containing vacuoles (BCV) is the niche where the organism 5
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Declaration of competing interest
replicates by avoiding lysosomal degradation. Disruption of LPS hence result in failure to formation of BCV, thus reduced its persistency [10]. Antibody reaction towards LPS is the main cause of sero-interference. The removal of LPS would thus result in DIVA capability of the vaccine. Brucella abortus S19 is the common vaccine of choice in several countries. It elicits strong immune response and confers high protection. The drawbacks of S19 - its residual virulence and interference to sero-diagnosis were overcome by the developed LPS defective mutant, S19ΔR. The rfbD gene product, O-antigen permease of S19 when subjected to blastp analysis (Protein BLAST [11]), revealed amino acid sequence homology of 98.69% and 97.736% of wzm gene product, ABC transporter of Brucella abortus and Brucella melitensis species, respectively. Like other rough Brucella strains which give clear agglutination with acriflavine dye, the S19ΔR cells also exhibited similar agglutination reaction with the acriflavine dye test. As reported in Brucella melitensis16 M wzm knock-out counterpart, the S19ΔR also exhibited rough phenotype I pattern of rough strains i.e. with complete disruption of OPS but with intact core [12]. In the present study, we observed that the growth kinetics of S19ΔR mutant differs from parent strain, S19. It was evident from total cell count at different time points that S19ΔR grew much slower than S19 and total yield of cell was also less. Increased hydrophobicity of the mutant occurred due to loss of surface exposed hydrophilic OPS component. This might lead to change in the permeability of nutrients and molecules across the more hydrophobic surface of the S19 [6]. The S19ΔR mutant was highly sensitive to complement mediated killing. The increase in complement killing may well be attributed to its truncated LPS structure. Due to loss of OPS in S19ΔR, the membrane attack complex had more access to the bacterial cell membrane. It can be presumed that S19ΔR mutant would be cleared off from the blood circulation earlier than S19 strain and may also reduce bacterial systemic dissemination. Also, fulminant bacteraemia was not observed in S19ΔR infected mice, attempts to isolate the bacteria from blood yield no colonies when tested on blood harvest from IP mocked infected mice at 24 and 48 h post infection (unpublished data). The present findings demonstrated that S19ΔR is suitable as a vaccine candidate particularly on safety perspectives and DIVA capability. However, S19ΔR showed moderate protective efficacy as compared to S19 strain. The lower protection level may be attributed to loss of LPS, which is highly immunogenic component [13]. Several experiments have shown the importance of LPS in protective immunity against wild type challenge [14–16]. Further, the minimal colonization of S19ΔR in the mice may also attribute to the reduction in protection levels. This persistency and protection efficacy relationship was also established in other mutants [17]. The present study reported that the RT50 of the S19ΔR was 6.12 weeks as compared to 11.76 weeks in case of S19. At 90 days post infection, 100% of the mice were negative of the S19ΔR. Not surprisingly, the S19 wild type strain outperformed S19ΔR mutant on induction of humoral response (Fig. 3) and expression of cytokines (Fig. 4).
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Acknowledgement We are thankful to the Director, IVRI, Izatnagar for providing necessary support to carry out this study. We are also thankful to DBT, New Delhi for funding under Brucellosis Network Program. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.biologicals.2019.11.005. References [1] Adone R, Pasquali P. Epidemiosurveillance of brucellosis. In: Plumb GE, Olsen SC, Pappas G, editors. Brucell. Recent Dev. Towar. One heal., rev. Sci. Tech. Off. Int. Epiz. 2013. p. 199–205. [2] Nicoletti P. Vaccination against Brucella. Adv Biotechnol Process 1990;13:147–68. [3] Schurig GG, Sriranganathan N, Corbel MJ. Brucellosis vaccines: past, present and future. Vet Microbiol 2002;90:479–96. [4] Monreal D, Grillo MJ, Gonzalez D, Marin CM, De Miguel MJ, Lopez-Goni I, et al. Characterization of Brucella abortus O-polysaccharide and core lipopolysaccharide mutants and demonstration that a complete core is required for rough vaccines to be efficient against Brucella abortus and Brucella ovis in the mouse model. Infect Immun 2003;71:3261–71. https://doi.org/10.1128/iai.71.6.3261-3271.2003. [5] Ugalde JE, Comerci DJ, Leguizamón MS, Ugalde RA. Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new live rough-phenotype vaccine. Infect Immun 2003;71:6264–9. https://doi.org/10.1128/IAI.71.11.6264-6269.2003. [6] Lalsiamthara J, Gogia N, Goswami TK, Singh RK, Chaudhuri P. Intermediate rough Brucella abortus S19Δper mutant is DIVA enable, safe to pregnant Guinea pigs and confers protection to mice. Vaccine 2015;33:2577–83. https://doi.org/10.1016/j. vaccine.2015.04.004. [7] Ried J, Collmer A. An nptI-sacB-sacR cartridge for constructing directed unmarked mutations in gram-negative bacteria by marker exchange-eviction mutagenesis. Gene 1987;57:239–46. [8] Bosseray N, Plommet M. Brucella suis S2, brucella melitensis Rev. 1 and Brucella abortus S19 living vaccines: residual virulence and immunity induced against three Brucella species challenge strains in mice. Vaccine 1990;8:462–8. [9] Porte F, Naroeni A, Ouahrani-Bettache S, Liautard J. Role of the Brucella suis lipopolysaccharide O antigen in phagosomal genesis and in inhibition of phagosomelysosome fusion in murine macrophages. Infect Immun 2003;71:1481–90. [10] Celli J, de Chastellier C, Franchini DD-M, Pizarro-Cerda J, Moreno E, Gorvel J-PJ. Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum. J Exp Med 2003;198:545–56. https://doi.org/10.1084/ jem.20030088. [11] Protein BLAST N. Protein BLAST: for alignment of amino acid sequences n.d https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins, Accessed date: 18 February 2017. [12] González D, Grilló M-J, De Miguel M-J, Ali T, Arce-Gorvel V, Delrue R-M, et al. Brucellosis vaccines: assessment of Brucella melitensis lipopolysaccharide rough mutants defective in core and O-polysaccharide synthesis and export. PLoS One 2008;3:e2760https://doi.org/10.1371/journal.pone.0002760. [13] Bhattacharjee AK, Izadjoo MJ, Zollinger WD, Nikolich MP, Hoover DL. Comparison of protective efficacy of subcutaneous versus intranasal immunization of mice with a Brucella melitensis lipopolysaccharide subunit vaccine. Infect Immun 2006;74:5820–5. https://doi.org/10.1128/IAI.00331-06. [14] Jacques I, Cloeckaert A, Limet JN, Dubray G. Protection conferred on mice by combinations of monoclonal antibodies directed against outer-membrane proteins or smooth lipopolysaccharide of Brucella. J Med Microbiol 1992;37:100–3. https:// doi.org/10.1099/00222615-37-2-100. [15] Montaraz JA, Winter AJ, Hunter DM, Sowa BA, Wu AM, Adams LG. Protection against Brucella abortus in mice with O-polysaccharide-specific monoclonal antibodies. Infect Immun 1986;51:961–3. [16] Plommet M, Plommet AM. Immune serum-mediated effects on brucellosis evolution in mice. Infect Immun 1983;41:97–105. [17] Yang X, Skyberg JA, Cao L, Clapp B, Thornburg T, Pascual DW. Progress in Brucella vaccine development. Front Biol 2013;8:60–77. https://doi.org/10.1007/s11515012-1196-0. [18] Bovine Brucellosis OIE. OIE Terr Man 2009;2009:1–35. [19] Bricker BJ, Halling SM. Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51. J Clin Microbiol 1995;33:1640–2.
5. Conclusion Development of a safer Brucella vaccine using strain 19 as platform is pragmatic due to its genetic stability and superior immunogenic properties. Additionally, vaccine developed on S19 backbone would overcome stringent regulatory hurdles as the vaccine is in use worldwide since decades with proven records. In this study we demonstrated that the rfbD gene knock-out mutant of S19 is highly attenuated and DIVA compatible. This attributes of S19ΔR would pave stride for developing an alternate Brucella vaccine keeping safety as priority requisite. Nonetheless, protective efficacy of S19ΔR could be improved through incorporation of suitable adjuvant in the vaccine preparation and new vaccination regimen with booster immunization or even the adult vaccination for control of brucellosis in animals.
6
Contents lists available at ScienceDirect
Biologicals journal homepage: www.elsevier.com/locate/biologicals
Brucella abortus S19 rfbD mutant is highly attenuated, DIVA enable and confers protection against virulent challenge in mice Jonathan Lalsiamthara1, Gurpreet Kaur, Neha Gogia2, Syed Atif Ali, Tapas Kumar Goswami, Pallab Chaudhuri∗ Division of Bacteriology and Mycology, Indian Veterinary Research Institute, Izatnagar, Uttar Pradesh, 243122, India
A R T I C LE I N FO
A B S T R A C T
Keywords: Brucella abortus S19 Brucellosis Rough mutant vaccine DIVA Mice model Cytokines Vaccine
Brucella abortus S19 is an important tool for controlling bovine brucellosis across the globe. However, vaccination with S19 suffers critical shortcomings such as, presence of residual virulence, induction of abortion and sero-diagnostic interference. In this study, rfbD gene deleted mutant S19 was developed. The mutant strain designated S19ΔR displayed rough LPS phenotype, which was confirmed by acriflavine dye-agglutination and LPS-SDS-PAGE analysis. The virulence was amply reduced as suggested by increased sensitivity to complement killing; reduction in splenic-bacterial load and the recovery time RT50 as validated in mice model. Anti-brucella humoral response was significantly lower as compared to S19 immunization. The minimal induction of Brucella specific IgG1, IgG2a & IgG2b, and IgG3 resulted in no apparent reactivity to RBPT antigen. S19ΔR showed protective index of 1.90 against virulent challenge. S19ΔR being highly attenuated and DIVA compatible may facilitate a platform for developing a safer bovine adulthood vaccine.
1. Introduction
2. Materials and methods
Brucellosis, a worldwide zoonosis caused by Brucella species, affects man, livestock, wild as well as marine mammals. It remained one of the most important bacterial zoonotic diseases with more than 500,000 new cases reported annually [1]. Till date, no effective human vaccine is available and the control of brucellosis in livestock and wild animal is important to check the zoonotic transmission cycle. Brucella abortus S19 is the most widely used live vaccine and it confers robust protection. The disadvantage of S19 vaccine is residual virulence and sero-interference [2,3]. Rough strain brucellae with incomplete lipopolysaccharide (LPS) happen to be devoid of these drawbacks. Several LPS synthesis genes were knocked out from Brucella as a means of LPS disruption and were studied for their usefulness as vaccine candidates [4,5]. In this study, we report vaccine potential of a modified S19 strain, designated as S19ΔR, devoid of rfbD gene. The gene product is an O-antigen export system permease involved in biosynthesis of LPS present in cell surface of Brucella organism. The newly developed S19ΔR mutant was assessed for its phenotype, residual virulence and its suitability as a vaccine candidate in an experimental mouse model.
2.1. Ethics, biosafety and animals experimentation Swiss albino mice (5–6 week old) were obtained from the Laboratory Animal Resource Section, Indian Veterinary Research Institute (IVRI), Izatnagar, India. Animal experiments were performed with the approval and following the guidelines of Institute Animal Ethics Committee (IAEC). Brucella organism was handled and processed in accordance to guidelines provided by institute biosafety committee, IVRI. All animal experiments comply with the ARRIVE guidelines. . All efforts were made to ensure humane handling of animals and to minimize animals suffering. 2.2. Bacterial strains, media and growth conditions Bacterial strains used in this study are described and listed in Table 1. Brucella abortus S19 and strain 544 used in this study were obtained from Division of Biological Standardization and the Brucella Reference Laboratory at IVRI, respectively. Organisms were grown routinely in BBL-Brucella agar (BBA), tryptic soy agar (TSA) and
∗
Corresponding author. GEB Lab, B&M Division, IVRI, Izatnagar, Bareilly, UP, 243122, India. E-mail addresses: [email protected], [email protected] (P. Chaudhuri). 1 Present address: Department of Molecular Microbiology & Immunology, School of Medicine, Oregon Health & Science University, OR, USA. 2 Present address: Department of Biology, University of Dayton, Ohio, USA. https://doi.org/10.1016/j.biologicals.2019.11.005 Received 10 May 2018; Received in revised form 9 September 2019; Accepted 26 November 2019 1045-1056/ © 2019 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Please cite this article as: Jonathan Lalsiamthara, et al., Biologicals, https://doi.org/10.1016/j.biologicals.2019.11.005
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Table 1 Bacterial strains, plasmids, and PCR primers used in this study. Strain/Plasmids/Primers E. coli TOP10 B. abortus S19 B. abortus 544 B. abortus S19ΔR pZErO®-1 pUM24 pTZ57 R/T pZrfbD pZrfbD::kan
Description
Reference or Source
−
F mcrA Δ(mrr-hsdRMS-mcrBC) ϕ 80lacZ ΔM15 ΔlacX74 recA1 araΔ139 Δ(ara-leu)7697galU galK rpsL endA1 nupG Cotton vaccine strain 19; smooth Wild type; smooth; virulent; for challenge study Candidate vaccine strain ΔrfbD mutant of S19; Kanr Cloning vector, backbone vector for suicidal construct; PlaclacZα-ccdB; pUC-derived ori; Zeor. pUCK 21 derivative containing Kanr Kanamycin cassette; sacB (levansucrase) TA cloning vector; rep bla lacZα; Ampr pZErO®-1 derivative suicidal plasmid containing flanking sequences of rfbD gene pZErO®-1 derivative suicidal plasmid containing flanking sequences of rfbD gene; Kanr kanamycin resistance cassette for selection
Invitrogen IVRI This study Invitrogen [7] ThermoScientific This study This study
PCR primers BMEII0428f BMEII0428r E11 E12
5′-GCCGCTATTATGTGGACTGG 5′-AATGACTTCACGGTCGTTCG 5′-GACGAACGGAATTTTTCCAATCCC 5′-TGCCGATCACTTAAGGGCCTTCAT
S19 specific [18]
rfbD rfbD rfbD rfbD rfbD rfbD rfbD rfbD
5′5′5′5′5′5′5′5′-
Lab designed primers for cloning deletion plasmid construct
Up BamHI - F Up PstI – R Do PstI – F Do XhoI– R OT - F OT – R IN − F IN – R
Brucella specific [19]
actGGATCCCCGCGATAAGCA actCTGCAGTGATCCAGCCAT actCTGCAGCACTAAATGTGG actCTCGAGCGGTACTACCAA GCGCCGCATACTCAATAAGG TTTTTCCCGCCAGCCCATCGT CAATCCACCCTGCCTGAACAT TTGCAATTTACACGCTTAGGA
Lab designed primers for deletion confirmation
Fig. 1. Genotypic and phenotypic characterization of S19ΔR. A) PCR amplification and confirmation of the deletion event. Lane 4 depicts absence of amplified DNA band and signifies the absence of rfbD gene. Lane 6 depicts replacement of rfbD gene with kanamycin cassette. M − DNA size marker (100bp, Gene Ruler plus, Thermo Scientific). Amplicons on lane 1 and 2 were amplified using Brucella specific primers; lane 3 and 4, amplified using rfbD inner primers; lane 5 and 6, amplified using rfbD outer primers. B) Silver staining for validation of LPS profile. Arrow head depicts absence of OPS. M (protein marker). C) Acriflavine dye agglutination test validation of rough phenotype of S19ΔR. S19ΔR agglutinates acriflavine dye due to hydrophobic interactions, which was absent in S19 strain.
tryptose phosphate broth (TPB) media at 37 °C with or without 5% CO2. The S19 and S19ΔR strains were incubated in aerobic conditions while S544 was grown under 5% CO2 atmosphere at 37 °C. For the growth of S19ΔR mutant, kanamycin antibiotics at 50 μg/mL was supplemented in the medium. Erythritol at 2 mg/mL was supplemented on BBA for to differentiate S19 and 544 strains.
Fig. 2. Growth kinetic of bacterial strains. In vitro growth rate of the Brucella strains was determined in Brucella broth medium. S19ΔR showed slower growth rate as compared to wild type S19. A) Growth rate determined based on optical density measured at 600 nm. B) Growth rate determined based on plate count.
2
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Fig. 3. Evaluation of progression of Brucella specific immunoglobulin isotypes. The effect of immunization on the production of the IgG isotypes was evaluated. Serum samples of immunized mice were collected weekly for 4 weeks and the antibody levels were determined. Significant differences P ≤ 0.05.
organisms in the culture was determined using spectrometry based or enumerated as per protocol described earlier [7]. Colony counts were expressed as mean log colony forming unit (cfu/mL).
2.3. Construction and characterization of S19ΔR mutant In order to construct the deletion plasmid, pZrfbD:kan, the flanking regions of rfbD gene were amplified by PCR. Primers were engineered with BamHI-PstI and PstI-XhoI restriction sites for cloning into a suicide vector, pZErO-1 (Invitrogen, USA). A kanamycin resistance gene cassette (Kanr) was inserted between the flanking sequences via PstI site. The deletion plasmid construct was electroporated to Brucella abortus S19 at 2.5 kV, 20 msecτ (Multiporator, Eppendorf). The event of recombination was screened using kanamycin and zeocin BBA medium. Colonies were further confirmed using colony PCR and DNA sequencing that encompassed the rfbD gene region. The developed rfbD gene deletion mutant was designated as S19ΔR. LPS of the mutant strain was extracted from culture grown on solid medium (TSA plate) by hot aqueous-phenol extraction method as per protocol described earlier [6]. Extracted LPS was electrophoresed on SDS–PAGE and subjected to silver staining. For growth curve determination, single colony of the strains were inoculated into 5 mL of Tryptose phosphate broth (TPB) and incubated in a shaker incubator. A volume of 0.2 mL inoculums of the 24 h broth culture was then transferred to 19.8 mL TPB in 50 mL conical flask, which was incubated at 37 °C while shaking. Culture samples were collected every 6 h interval for 72 h of incubation and the number of
2.4. Complement sensitivity assay Sensitivity of the S19ΔR mutant to serum complement was tested by incubating the organism in freshly collected Brucella antibody free-bovine serum; the results were compared to B. abortus S19 wild type. A total of1 x103 cfu were incubated in 200 μL 50% of the serum and bacterial viability was checked hourly for 2 h. In parallel, cells were also incubated with de-complemented bovine serum and PBS controls. Each of the test lot was then spread-plated on BBA medium. After 6 days of incubation at 37 °C, the number of viable organisms were determined and expressed as log10 cfu. The experiment was performed in duplicate to ensure reproducibility. The cfu obtained were expressed as mean cfu and the percentage reduction from mean cfu (PBS) was determined. 2.5. Systemic IgG isotype responses The level of antigen specific IgG isotype antibodies, viz. IgG1, IgG2a, IgG2b and IgG3 were measured in the sera of mice. A total of 5 3
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Table 2 Splenic bacterial recovery of Brucella strains. Mice Groups (cfu)
6)
S19 (1 × 10 S19ΔR (1 × 106)
Days post inoculation (log cfu/spleen ± SEM) 30
60
90
7.08 ± 0.02 4.96 ± 0.037*
6.72 ± 0.035 2.87 ± 0.09*
4.14 ± 0.066 0 ± 0.0*
* indicates significant difference at P ≤ 0.05. Table 3 Protection index at 30 days post challenge. Mice groups
Splenic bacterial count Log cfu/spleen ± SEM
Log protection
PBS S19 S19ΔR
5.32 ± 0.192 2.41 ± 0.085* 3.42 ± 0.061*
0.00a 2.91b 1.90c
* indicates significant difference at P ≤ 0.05. abc represents different subsets.
Fig. 4. Capture ELISA based quantification of IL-2 and IL-4. The effect of immunization on the expression of the selected cytokines was evaluated. Serum samples of immunized mice were collected weekly for 4 weeks and the cytokine levels were determined. Significant differences P ≤ 0.05.
Fig. 6. Rose Bengal plate test based DIVA evaluation of immunized mice sera. Serum agglutination of Brucella whole cell antigen was determined on mice immunized with S19 and S19ΔR. Serum samples were screened weekly for 5 weeks. S19ΔR immunized mice sera failed to agglutinate the antigen while S19 immunized mice sera showed strong agglutinations.
mice were bled via retro-orbital plexus at weekly interval for four weeks and serum samples were harvested. Sonicated whole cell lysate from S19 and S19ΔR was used as coating antigen on Maxisorp ELISA plate (Nunc, USA) at a concentration of 250 ng per well. Primary serum was diluted at 1:100, and secondary goat anti-mouse IgG, IgG1, IgG2a, IgG2b and IgG3 HRPO conjugates (Santa Cruz, USA) were diluted at 1:4000. OPD was used as a substrate and the colorimetric changes were measured at 492 nm after 10 min of incubation. The relative antibody titres were expressed as mean OD ± SEM. 2.6. Cytokines profiles To assess cytokine response in immunized mice, blood samples were collected and sera harvested. A total of 5 mice serum samples were collected and assayed for interleukin (IL)-2 and IL-4 using sandwich ELISA format (KOMA BIOTECH Inc., South Korea). The experiments were conducted according to the manufacturer's instructions. 2.7. Residual virulence of the brucella strains Residual virulence analysis of S19 and S19ΔR was conducted in mice model according to protocol described earlier [6]. For recovery 50 (RT50) determinations, sixty four mice were distributed equally into two groups for S19 and S19ΔR inoculation. A total number of 1 × 106 cfu of Brucella organisms were inoculated to each mouse of either group through intra-peritoneal (IP) route. Eight mice from each group were euthanized at 3, 6, 9, 12 weeks, and clearance of bacteria from spleen was determined. To determine bacterial load in the spleen,
Fig. 5. Complement sensitivity assay. The sensitivity of the strains to complement killing was evaluated using fresh bovine serum. A) S19ΔR showed increase sensitivity to complement killing at 1 h and 2 h post incubation with 50% bovine serum. B) Percentage reduction of cfu post incubation with serum.
4
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
thirty mice were equally distributed in two groups and were inoculated with 1 × 106 cfu of either strains of Brucella as described in previous step. At 30, 60 and 90 days post inoculation, the mice were euthanized and the spleen collected to determine the number of Brucella organisms present in the organ. The whole spleen was homogenised with sterile pestle and mortar and a 10-fold serial dilution of homogenate was made in PBS. Each dilution was plated out on BBA medium to enumerate total colony forming units in the spleen. The cfu obtained were adjusted with dilution factors and expressed as mean log10 cfu/spleen ± SEM.
agglutination pattern similar to rough Brucella colonies, while the wild type S19 being a smooth phenotype did not show agglutination (Fig. 1C). Sedimentation rate of S19ΔR was faster than the parent strain S19 due to auto-agglutination that cause clumping of the bacterial cells (Supplementary Fig. S2). The growth rate of S19 and S19ΔR was also determined. Marked decrease in the growth rate of the mutant was observed as compared to wild type (Fig. 2).
2.8. Protective efficacy Protective efficacy of S19ΔR mutant was evaluated in mice model and compared with the reference vaccine strain, S19 as per protocol described earlier [6]. Five weeks old mice (n = 30) were divided equally in to three groups. The mice were inoculated with 1 × 105 cfu of either Brucella abortus S19 or S19ΔR or PBS through intra-peritoneal route. At 30 days post immunization, the animals were challenged with 2 × 105 cfu of virulent B. abortus S544. The spleens were processed according to protocol described in section 2.8. Ability of immunized mice to clear virulent B. abortus S544 was determined by total cell counts in the spleen of each group of animals. The cell counts were mathematically transformed using formula: y = log (x/logx) according to previously described method [8] to make it statistically fit. Protective Index (PI) was obtained by subtracting y value of PBS log count and y value of test vaccine log count. The observation was expressed as meanlog10 cfu/spleen ± SEM.
Brucella antigen specific humoral immune response was evaluated by indirect ELISA. The relative levels of total systemic IgG and IgG isotypes were ascertained from the serum samples of the mice immunized with the vaccine strains (Fig. 3). Predictably, S19ΔR immunized mice induced lesser antibody level as compared to smooth S19 parent strain. However, significant increase in titre of IgG and its subtypes were clearly visible in immunized animals. Among the subtypes, IgG3 induction was weakest both in parent strain and the mutant. Cytokine response evoked by immunization of Brucella was determined based on sandwich ELISA. Levels of selected cytokines, IL-2 and IL-4 were measured in mice serum samples. The production of IL-2 among mice immunized with S19 depicted a decreasing trend, while mice immunized with S19ΔR showed increasing pattern (Fig. 4A). The IL-2 levels were significantly different at weeks 1 and 4 (P ≤ 0.05). IL-4 secretions in serum of mice immunized with S19 showed increasing trend while the levels in S19ΔR mice samples were rather flat and significantly lower (P ≤ 0.05) than the S19 counterpart (Fig. 4B).
2.9. DIVA capability assessment
3.3. Complement sensitivity assay and residual virulence
Blood samples were collected from S19 or S19ΔR inoculated mice weekly for four weeks. Serum samples were separated and Rose Bengal Plate Agglutination Test (RBPT) was performed. A volume of 30 μL of test serum sample and 30 μL of RBPT test antigen were mixed using a sterile tooth pick on a sterile glass plate and then observed for agglutination. Positive control and negative control were also included in the experiment.
The sensitivity of S19 and S19ΔR strains to complement mediated killing was evaluated. Rough strain S19ΔR showed increase degree of sensitivity as compared to wild type S19 (Fig. 5A). After 1 h incubation, 53.73% and 87.83% complement mediated killing was observed and additional 1 h incubation yielded 94.62% and 100% killing of the strains, S19 and S19ΔR respectively (Fig. 5B). Residual virulence assessment of S19ΔR showed that the mutant was cleared off from the spleens of mock infected mice much earlier than the parental wild type S19 (Table 2). The RT50 of the strains was determined as 6.12 and 11.76 weeks for S19ΔR and S19, respectively (Supplementary Table S3).
3.2. Humoral and cytokine response
2.10. Statistical analysis Statistical analyses were used wherever applicable. Analyses were performed with SPSS 16.0 (SPSS Inc., USA). One-way analysis of variance (ANOVA) and Student's t-tests were used to determine statistically significant differences, with P values of ≤0.05 or ≤0.01 considered significant.
3.4. Mice protection study The efficacy of S19ΔR as a vaccine was assessed by immunization of swiss albino mice (Table 3). At 30 days post challenge, the log challenge bacterial counts recovered from spleen were 5.32 ± 0.192, 2.41 ± 0.0849 and 3.42 ± 0.061 for PBS, S19 and S19ΔR mice groups. The protective indices derived were 2.91 and 1.90 for S19 and S19ΔR, respectively.
3. Results 3.1. Brucella S19ΔR mutant confirmation and characterization S19ΔR colonies were sensitive to zeocin and resistant to kanamycin antibiotics. To confirm at genomic level, S19ΔR colonies were subjected to PCR using a set of inner primer targeting rfbD gene. S19ΔR mutant did not show amplification due to deletion of the gene (Fig. 1A). The accuracy of the mutation was further confirmed using DNA sequencing encompassing the rfbD region. The data obtained was then annotated and deposited in NIH genetic sequence database, Genbank (GenBank accession number KR608271.1). Microbiological tests confirmed identical properties of the mutant strain, S19ΔR and its parent strain, S19 (Supplementary Fig. S1). This experiment revealed that no unwanted mutation occur elsewhere in the genome at least related to the panel of test conducted. LPS extracted from S19ΔR showed absence of O-polysaccharide on SDS-PAGE after silver nitrate staining. However, the O-polysaccharide of S19 resolved at approximately ~50 KDa relative of protein molecular weight marker (Fig. 1B). Acriflavine dye agglutination test of S19ΔR revealed
3.5. DIVA capability The DIVA capability of the mutant strain upon vaccination was ascertained by the most commonly used diagnostic test, RBPT. Serum samples of mice immunized with S19ΔR failed to agglutinate RBPT antigen (Fig. 6). This feature would make S19ΔR a DIVA enable vaccine candidate. However, serum of mice immunized with S19 showed strong agglutination reaction which indirectly would interfere with sero-diagnosis of clinical infection. 4. Discussion LPS of Brucella is an important virulence factor and causes inhibition of phagosome-lysosome fusion when engulfed by macrophages [9]. Brucella containing vacuoles (BCV) is the niche where the organism 5
Biologicals xxx (xxxx) xxx–xxx
J. Lalsiamthara, et al.
Declaration of competing interest
replicates by avoiding lysosomal degradation. Disruption of LPS hence result in failure to formation of BCV, thus reduced its persistency [10]. Antibody reaction towards LPS is the main cause of sero-interference. The removal of LPS would thus result in DIVA capability of the vaccine. Brucella abortus S19 is the common vaccine of choice in several countries. It elicits strong immune response and confers high protection. The drawbacks of S19 - its residual virulence and interference to sero-diagnosis were overcome by the developed LPS defective mutant, S19ΔR. The rfbD gene product, O-antigen permease of S19 when subjected to blastp analysis (Protein BLAST [11]), revealed amino acid sequence homology of 98.69% and 97.736% of wzm gene product, ABC transporter of Brucella abortus and Brucella melitensis species, respectively. Like other rough Brucella strains which give clear agglutination with acriflavine dye, the S19ΔR cells also exhibited similar agglutination reaction with the acriflavine dye test. As reported in Brucella melitensis16 M wzm knock-out counterpart, the S19ΔR also exhibited rough phenotype I pattern of rough strains i.e. with complete disruption of OPS but with intact core [12]. In the present study, we observed that the growth kinetics of S19ΔR mutant differs from parent strain, S19. It was evident from total cell count at different time points that S19ΔR grew much slower than S19 and total yield of cell was also less. Increased hydrophobicity of the mutant occurred due to loss of surface exposed hydrophilic OPS component. This might lead to change in the permeability of nutrients and molecules across the more hydrophobic surface of the S19 [6]. The S19ΔR mutant was highly sensitive to complement mediated killing. The increase in complement killing may well be attributed to its truncated LPS structure. Due to loss of OPS in S19ΔR, the membrane attack complex had more access to the bacterial cell membrane. It can be presumed that S19ΔR mutant would be cleared off from the blood circulation earlier than S19 strain and may also reduce bacterial systemic dissemination. Also, fulminant bacteraemia was not observed in S19ΔR infected mice, attempts to isolate the bacteria from blood yield no colonies when tested on blood harvest from IP mocked infected mice at 24 and 48 h post infection (unpublished data). The present findings demonstrated that S19ΔR is suitable as a vaccine candidate particularly on safety perspectives and DIVA capability. However, S19ΔR showed moderate protective efficacy as compared to S19 strain. The lower protection level may be attributed to loss of LPS, which is highly immunogenic component [13]. Several experiments have shown the importance of LPS in protective immunity against wild type challenge [14–16]. Further, the minimal colonization of S19ΔR in the mice may also attribute to the reduction in protection levels. This persistency and protection efficacy relationship was also established in other mutants [17]. The present study reported that the RT50 of the S19ΔR was 6.12 weeks as compared to 11.76 weeks in case of S19. At 90 days post infection, 100% of the mice were negative of the S19ΔR. Not surprisingly, the S19 wild type strain outperformed S19ΔR mutant on induction of humoral response (Fig. 3) and expression of cytokines (Fig. 4).
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. Acknowledgement We are thankful to the Director, IVRI, Izatnagar for providing necessary support to carry out this study. We are also thankful to DBT, New Delhi for funding under Brucellosis Network Program. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.biologicals.2019.11.005. References [1] Adone R, Pasquali P. Epidemiosurveillance of brucellosis. In: Plumb GE, Olsen SC, Pappas G, editors. Brucell. Recent Dev. Towar. One heal., rev. Sci. Tech. Off. Int. Epiz. 2013. p. 199–205. [2] Nicoletti P. Vaccination against Brucella. Adv Biotechnol Process 1990;13:147–68. [3] Schurig GG, Sriranganathan N, Corbel MJ. Brucellosis vaccines: past, present and future. Vet Microbiol 2002;90:479–96. [4] Monreal D, Grillo MJ, Gonzalez D, Marin CM, De Miguel MJ, Lopez-Goni I, et al. Characterization of Brucella abortus O-polysaccharide and core lipopolysaccharide mutants and demonstration that a complete core is required for rough vaccines to be efficient against Brucella abortus and Brucella ovis in the mouse model. Infect Immun 2003;71:3261–71. https://doi.org/10.1128/iai.71.6.3261-3271.2003. [5] Ugalde JE, Comerci DJ, Leguizamón MS, Ugalde RA. Evaluation of Brucella abortus phosphoglucomutase (pgm) mutant as a new live rough-phenotype vaccine. Infect Immun 2003;71:6264–9. https://doi.org/10.1128/IAI.71.11.6264-6269.2003. [6] Lalsiamthara J, Gogia N, Goswami TK, Singh RK, Chaudhuri P. Intermediate rough Brucella abortus S19Δper mutant is DIVA enable, safe to pregnant Guinea pigs and confers protection to mice. Vaccine 2015;33:2577–83. https://doi.org/10.1016/j. vaccine.2015.04.004. [7] Ried J, Collmer A. An nptI-sacB-sacR cartridge for constructing directed unmarked mutations in gram-negative bacteria by marker exchange-eviction mutagenesis. Gene 1987;57:239–46. [8] Bosseray N, Plommet M. Brucella suis S2, brucella melitensis Rev. 1 and Brucella abortus S19 living vaccines: residual virulence and immunity induced against three Brucella species challenge strains in mice. Vaccine 1990;8:462–8. [9] Porte F, Naroeni A, Ouahrani-Bettache S, Liautard J. Role of the Brucella suis lipopolysaccharide O antigen in phagosomal genesis and in inhibition of phagosomelysosome fusion in murine macrophages. Infect Immun 2003;71:1481–90. [10] Celli J, de Chastellier C, Franchini DD-M, Pizarro-Cerda J, Moreno E, Gorvel J-PJ. Brucella evades macrophage killing via VirB-dependent sustained interactions with the endoplasmic reticulum. J Exp Med 2003;198:545–56. https://doi.org/10.1084/ jem.20030088. [11] Protein BLAST N. Protein BLAST: for alignment of amino acid sequences n.d https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins, Accessed date: 18 February 2017. [12] González D, Grilló M-J, De Miguel M-J, Ali T, Arce-Gorvel V, Delrue R-M, et al. Brucellosis vaccines: assessment of Brucella melitensis lipopolysaccharide rough mutants defective in core and O-polysaccharide synthesis and export. PLoS One 2008;3:e2760https://doi.org/10.1371/journal.pone.0002760. [13] Bhattacharjee AK, Izadjoo MJ, Zollinger WD, Nikolich MP, Hoover DL. Comparison of protective efficacy of subcutaneous versus intranasal immunization of mice with a Brucella melitensis lipopolysaccharide subunit vaccine. Infect Immun 2006;74:5820–5. https://doi.org/10.1128/IAI.00331-06. [14] Jacques I, Cloeckaert A, Limet JN, Dubray G. Protection conferred on mice by combinations of monoclonal antibodies directed against outer-membrane proteins or smooth lipopolysaccharide of Brucella. J Med Microbiol 1992;37:100–3. https:// doi.org/10.1099/00222615-37-2-100. [15] Montaraz JA, Winter AJ, Hunter DM, Sowa BA, Wu AM, Adams LG. Protection against Brucella abortus in mice with O-polysaccharide-specific monoclonal antibodies. Infect Immun 1986;51:961–3. [16] Plommet M, Plommet AM. Immune serum-mediated effects on brucellosis evolution in mice. Infect Immun 1983;41:97–105. [17] Yang X, Skyberg JA, Cao L, Clapp B, Thornburg T, Pascual DW. Progress in Brucella vaccine development. Front Biol 2013;8:60–77. https://doi.org/10.1007/s11515012-1196-0. [18] Bovine Brucellosis OIE. OIE Terr Man 2009;2009:1–35. [19] Bricker BJ, Halling SM. Enhancement of the Brucella AMOS PCR assay for differentiation of Brucella abortus vaccine strains S19 and RB51. J Clin Microbiol 1995;33:1640–2.
5. Conclusion Development of a safer Brucella vaccine using strain 19 as platform is pragmatic due to its genetic stability and superior immunogenic properties. Additionally, vaccine developed on S19 backbone would overcome stringent regulatory hurdles as the vaccine is in use worldwide since decades with proven records. In this study we demonstrated that the rfbD gene knock-out mutant of S19 is highly attenuated and DIVA compatible. This attributes of S19ΔR would pave stride for developing an alternate Brucella vaccine keeping safety as priority requisite. Nonetheless, protective efficacy of S19ΔR could be improved through incorporation of suitable adjuvant in the vaccine preparation and new vaccination regimen with booster immunization or even the adult vaccination for control of brucellosis in animals.
6