- Email: [email protected]
Calcium-dependent kinases in the brain have site-specific associations with locomotion and rearing impairments in rats with bile duct ligation
Behavioural Brain Research 372 (2019) 112009
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Calcium-dependent kinases in the brain have site-specific associations with locomotion and rearing impairments in rats with bile duct ligation
T
Shamseddin Ahmadi , Saeed Faridi1, Soma Tahmasebi1 ⁎
Department of Biological Science, Faculty of Science, University of Kurdistan, Sanandaj, Iran
ARTICLE INFO
ABSTRACT
Keywords: Bile duct ligation Locomotion Rearing PKCγ CamKIIα Gene expression
We study the impairment of locomotion and rearing behavior in rats with a common bile duct ligation (BDL), and the possible involvement of the PKCγ and CamKIIα gene expression in the brain. Male Wistar rats undergo either sham operation or BDL to induce a rat model of cirrhotic hepatic encephalopathy (HE). Six groups of the animals were divided into three sets of sham-operated and BDL groups. In the first set, locomotion and rearing behavior were assessed on days 1, 7, 14, 21 and 28 of BDL. On day 28 of BDL, blood samples were collected from the second set of the animals for biochemical analysis, and the rats in the third set were used to extract the PFC, the hippocampus, and the cerebellar cortex for examining the Pkcγ and CamKIIα gene expression. The results showed that locomotion and rearing were decreased during 28 days of BDL with the most significant change on the 28th day. Biochemical analysis of the blood revealed hyperammonemia, increases in liver enzymes, and a decrease in albumin indicating liver damage and induction of cirrhotic HE. The results also showed that both of the Pkcγ and CamKIIα gene expressions were increased in the PFC but decreased in the hippocampus. However, the Pkcγ gene expression was decreased but the CamKIIα gene expression was increased in the cerebellar cortex. It can be concluded that the Ca2+-dependent kinases in different brain areas have a site-specific association with the impairment of locomotion and rearing behavior in the cirrhotic HE model rats.
1. Introduction According to health reports, there are many people with fatty liver disease worldwide [1–4]. Fatty and other chronic liver diseases gradually lead to liver cirrhosis, which is the main cause of liver failure [5]. The liver failure is followed by hyperammonemia that in turn induces brain dysfunctions, which is referred to as cirrhotic hepatic encephalopathy (HE). As a complex disorder, cirrhotic HE is characterized by neuroinflammation, alterations in the normal brain functioning and morphological and physiological changes in astrocytes and neurons [6–8]. Neural impacts of HE vary from impairment of locomotion to cognitive dysfunctions [5,6]. Some investigators have reported possible mechanisms for the neural dysfunctions in the animal model of HE. In particular, it has been reported that the hyperammonemia in HE is associated with neurotransmission alterations, especially glutamate and GABA [6,9]. In support of these reports, it has been shown that new therapeutic approaches acting either on N-Methyl-D-Aspartate (NMDA) subtype of the glutamate receptors or GABAA receptors improve cognitive and motor dysfunctions in the animal models of HE [6,10–12].
The action of glutamate on neurons increases intracellular Ca2+ levels [13], resulting in activation of Ca2+ dependent kinases such as protein kinase C (PKC) and calcium/calmodulin-dependent protein kinase II (CamKII), which in turn initiate subsequent signaling cascades in neurons [14,15]. Considering the increase in the glutamate level in HE and the subsequent increases in the influx of Ca2+ into the neurons, it is possible that changes in PKC and CamKII molecules be involved in the pathogenesis of HE. It has been shown that gamma isotype of PKC (PKCγ) is expressed solely in the central nervous system (CNS), where its localization is restricted to the neurons [15]. CaMKII is also a Ca2+dependent kinase with different isoforms, which the alpha isoform (CaMKIIα) is prevalent in the brain [14,16]. The role of PKCγ and CamKIIα in cognitive functions and locomotor activity have been reported elsewhere [17,18]. In particular, involvement of PKC in the hyperlocomotion in bipolar disorder has been confirmed [19,20]. Kadivar and colleagues [21] have also shown a relationship between locomotion and the increased CamKIIα mRNA, as well as the enzyme activity in rat hippocampus after morphine-sensitization. Nevertheless, the association of PKCγ and CamKIIα, especially at the gene expression level, with the pathogenesis of HE remains to be investigated.
Corresponding author. E-mail address: [email protected] (S. Ahmadi). 1 The second and third authors contributed equally to this work. ⁎
https://doi.org/10.1016/j.bbr.2019.112009 Received 4 March 2019; Received in revised form 15 May 2019; Accepted 3 June 2019 Available online 05 June 2019 0166-4328/ © 2019 Elsevier B.V. All rights reserved.
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
Some brain areas including the prefrontal cortex, hippocampus, and cerebellum are involved in cognition, locomotion, place, and balance [22]. In addition, interconnected pathways between these areas especially the hippocampus and PFC in the process of coding novelty in rat have been reported [23]. It has been also suggested that hippocampal inter-neuronal microcircuits are preferentially active during either movement or immobility periods [24]. In this study, first, we examine locomotor activity and rearing behavior (as a behavior needing locomotion, novelty-seeking, and balance) in rats with BDL as an animal model of HE. Then, we examine the possible changes in the Pkcγ and CamKIIα gene expression in the PFC, hippocampus, and cerebellar cortex. We aim to explore a possible relationship between the Ca2+dependent kinases at mRNA level in the PFC, hippocampus and cerebellum and the impairment of locomotor activity and rearing behavior in the HE model rats.
counted as an index of novelty-seeking behavior and movement coordination. 2.4. Biochemical analysis of plasma and serum On day 28 of BDL, the rats of the second set of the animals were deeply anesthetized and blood samples collected via heart puncture immediately for biochemical analysis. Plasma levels of ammonia were determined using a Biorex Ammonia Assay Kit immediately after the heart puncture according to the manufacturer manual (Biorexfars Diagnostics, Shiraz, Iran). In addition, the plasma levels of urea, total protein, alanine aminotransferase (ALT), asparagine aminotransferase (AST), alkaline phosphatase (ALP), total, direct and indirect bilirubin, albumin, creatinine and fasting blood sugar (FBS) were also evaluated with the respective standard kits according to the respected instructions supplied by manufacturer (Darmankav, Esfahan, Iran).
2. Materials and methods
2.5. Dissection of the PFC, hippocampus and cerebellar cortex
2.1. Animals
Both sham and HE model rats in the third set of the animals (n = 4, in each group) were used to examine the Pkcγ and CamkIIα gene expression in the PFC, hippocampus and cerebellar cortex. On day 28 of BDL, each rat was decapitated, the whole brain quickly removed from the skull and the PFC, hippocampus and cerebellar cortex were immediately dissected on an ice-chilled sterile surface [25,27,28]. Then, each tissue was immediately submerged in an RNAlater RNA Stabilization Reagent (Qiagen, USA), and incubated overnight at 4 °C. After 24 h, the RNAlater solution was aspirated and the tissues were stored at −80 °C until further analysis.
Male Wistar rats were used and kept in an animal house with constant temperature (22 ± 2 °C) and a 12 h light/dark cycle (lighting 7:00 – 19:00). The animals had free access to food and water except during the experiments. Behavioral tests were carried out during the light phase between 9:00 and 12:00 (a.m.). Forty rats (weighing 300–350 g) in three sets were used. Each set of the animals included a group of sham control and a group with BDL as a model of cirrhotic HE. In the first set of the animals, a total number of 16 rats in two groups of sham and HE model (n = 8, in each group) were used to examine locomotion and rearing behavior weekly during a period of 28 days of BDL. In the second set including 16 rats (n = 8 per group), biochemical analysis of serum or plasma was assessed on day 28 of BDL. In the third set of the animals, including the sham and HE model groups (n = 4, in each group) the Pkcγ and CamkIIα gene expressions in the PFC, hippocampus and cerebellar cortex were evaluated. All procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals (2011) prepared by the National Academy of Sciences’ Institute for Laboratory Animal Research.
2.6. Reverse transcription-quantitative polymerase chain reaction (RTqPCR) The RNeasy Mini Kit (Qiagen, USA) was used for the total RNA extraction from 25 mg of each tissue according to the kit instruction manual. Qualities of the extracted total RNAs were assessed with 1% agarose gel electrophoresis to visualize both 28 s and 18 s ribosomal RNA. The concentration of the total RNAs was also measured with a spectrophotometry method (Specord210, Analytic Jena, Germany). Reverse transcription of the total RNAs was performed by using Thermo Scientific RevertAid first strand cDNA synthesis kit according to manufacturer manual (Thermo Fisher Scientific, USA). First, real-time quantification for reference genes, including glyceraldehyde-3-phosphate dehydrogenase (Gapdh), beta-actin (Actb) and cyclophilin A (Cycl A) genes, and the Pkcγ and CamKIIα as the genes of interest were performed in independent triplicate reactions (as technical repeats) for each sample in both sham control and HE model groups including four rats in each group as biological repeats (LightCycler 96, Roche, Germany). The best reference gene selection was done and Gapdh was selected as the best reference gene using the NormFinder method in GeneX 6.1 Software. Each reaction volume was 20 μl consisting of 10 μl SYBR Green master mix (Premix Ex Taq, Takara Bio, Otsu, Japan), 5 μl cDNA (4 ng/μl), 2 μl mix of the forward and reverse primers (10 μM) and nuclease-free ddH2O up to 20 μl. Thermal cycling was initiated with a pre-incubation step (95 °C for 30 s), followed by 40 cycles of two-step amplification (95 °C for 5 s and 60 °C for 30 s), melting (95 °C for 5 s, 60 °C for 60 s and 95 °C for 1 s), and finalized by cooling at 50 °C for 30 s. Information about the gene-specific primers has been summarized in the Table 1.
2.2. Surgical laparotomy All rats were food restricted for 12 h prior to the surgery. Both groups of sham control and HE model group underwent general anesthesia induced by intraperitoneal (i.p.) injection of a mixture of ketamine/xylazine (100 and 10 mg/kg, respectively). The sham operation consisted of laparotomy as well as bile duct identification and manipulation, but without ligation and resection. In the HE model group, each rat was subjected to double ligation of the common bile duct with approximately 10 mm apart followed by dissection of the bile duct in the middle of the ligatures. After the closure of the abdominal wound, each rat was received 1 ml saline (i.p.), and moved to a clean box until complete recovery [25,26]. 2.3. Behavioral testing Locomotor activity was measured with an activity meter (Borj Sanat Azma Co, Tehran, Iran). On day one of the 28 day period before doing the surgical laparotomy and thereafter weekly on days 7, 14, 21 and 28 of BDL the locomotives of rats was examined. In brief, each rat was placed in a clear Plexiglas container (40 × 40 × 40 cm high), where the floor of the box was divided into four equal size squares (20 × 20 cm). Each animal in the test box was monitored with a video camera connected to a Sony VCR in an adjacent room (Sony, Japan). Total horizontal movements of each rat with all four paws crossing the squares were recorded for 5 min as an index of locomotion. During locomotion testing, the total numbers of rearing behavior of each animal were also
2.7. Statistical analysis The data from the locomotion and rearing behavior’ tests passed normality and equal variance tests, and so they were analyzed by oneor two way repeated measure ANOVA. After a significant F value, post hoc Holm-Sidak’s test was used for the multiple pairwise comparisons. 2
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
Table 1 : The sequences of the specific gene primers and the respective amplicon sizes. Gene
Ref. Seq.
Sequences (5′-3′)
Amplicon size (bp)
Gapdh
NM_017008.4
77
Actb
NM_031144.3
Cycl A
NM_017101.1
Pkcγ
NM_012628
CamkIIα
NM_012920.1
F: AGTGCCAGCCTCGTCTCATA R: GTAACCAGGCGTCCGATAC F: GCAGGAGTACGATGAGTCCG R: ACGCAGCTCAGTAACAGTCC F: GTTCTTCGACATCACGGCT R: CACGAAAGTTTTCTGCTGTCT F: GTATGAGAGAGTGCGGATGG R: AGTCAGAGATATGCAGGCGTC F: GAAGCACCCCAATATCGTC R:GATACAGTGGCTGGCATCAG
74 95 121 148
Gapdh: Glyceraldehyde-3-phosphate Dehydrogenase; Actb: Beta Actin; Cycl A: Cyclophilin A; Pkcγ: Protein kinase c gamma; CamKIIα: Ca2+/Calmodulindependent protein kinase II alpha.
The data for ALT, AST, ALP and different forms of bilirubin failed to pass normality and/or equal variance tests, therefore, they were analyzed by Mann-Whitney’s U test The data for ammonia, urea, total protein, albumin, creatinine, and FBS were normal and therefore were analyzed with Student t-test. The real time-PCR data was analyzed by using the 2−ΔΔCT method, and Student t-test was used for comparing the gene expression results between two experimental groups. The data from the gene expression study had also normal distribution and was analyzed with the Student t-test. Normal data is represented as mean and standard deviation (SD) but non-normal data is represented as median and interquartile range. The values of partial eta squared or Cohen’s d was used to show the effect sizes with 95% confidence intervals. The effect size results were interpreted according to Cohen’s (1988) criterion [29]. P < 0.05 was considered as statistically significant level throughout.
Fig. 1. Line chart showing the locomotor activity on days 1, 7, 14, 21 and 28 of BDL. Two groups of sham and BDL rats were used and examined for locomotor activity on days 1, 7, 14, 21 and 28. Each point and the superimposed error bar represent mean and SD for the locomotion counts/ 5 min on the specified day. The white squares represent the data obtained for the sham control group and the black squares represent the locomotion data in the HE model group. ** P < 0.01 and *** P < 0.01 compared to the data of the sham control group on the same day.
Pairwise comparisons reveal that the rearing behavior of rats with BDL significantly decreases on days 7 (P < 0.01), 14 (P < 0.01), 21 (P < 0.01) and 28 (P < 0.001) compared to the rearing behavior of the sham control group on the same day (Fig. 2). 3.3. Biochemical analysis of plasma and serum revealed significant disturbances in the liver functions
3. Results 3.1. Locomotor activity was decreased during 28 days of BDL
The results of biochemical analysis of serum reveals dysfunction of the liver in rats with BDL. The results of Mann–Whitney U test reveal
A two-way repeated measure ANOVA (one-factor repetition) was conducted to assess the impact of the intervention with two levels (sham or BDL) on the locomotor activity across five days of a 28 day period (including days 1, 7, 14, 21 and 28 as the repetition factor). The results show a significant interaction between the two factors on the locomotor activity [F (4, 56) = 5.1, P < 0.01, partial eta squared = 0.4]. This result suggests that there is a significant change in the locomotor activity across the five testing days in the HE model rats (with BDL) compared to the sham control group. The effect size provided as partial eta squared (0.4) reveals that the actual difference in the mean values for the locomotor activity between the experimental groups can be classified as a large difference according to Cohen’s (1988) criterion. Post hoc testing reveals that the locomotor activity of rats in the HE model group is significantly decreased on days 7 (P < 0.01), 14 (P < 0.01), 21 (P < 0.01) and 28 (P < 0.001) compared to the sham control group on the same day (Fig. 1). 3.2. Rearing behavior was decreased during 28 days of BDL According to the results of a two-way repeated measure ANOVA, a significant interaction between BDL and days of testing (days 1, 7, 14, 21 and 28) was also observed for the rearing behavior [F (4, 56) = 2.8, P < 0.05, partial eta squared = 0.5]. Similar to the locomotor activity, this result suggests that there is a significant change in the rearing behavior between the HE model and sham control groups across the five different days of the testing. The effect size provided as partial eta squared (0.5) reveals a large difference in the mean values for the rearing behavior between rats with BDL and sham control group.
Fig. 2. Line chart showing the rearing behavior on days 1, 7, 14, 21 and 28 of BDL. Two groups of sham and BDL rats were used, and their rearing behavior was assessed on days 1, 7, 14, 21 and 28 of BDL (the rearing data were recorded in the same rats that were examined for the locomotion). Each point and the superimposed error bar represent mean and SD for the rearing behavior counts/ 5 min on the specified day. The white squares represent the data obtained for the sham control group and the black squares represent the rearing data in the HE model group. ** P < 0.01 and *** P < 0.01 compared to the data of the sham group on the same day. 3
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
Table 2 Biochemical analysis of the plasma and serum in the sham control and the cirrhotic HE model groups on day 28 of BDL. Parameter
Sham
BDL
ALT (U/L) AST (U/L) ALP (U/L) Total Bilirubin (mg/dL) Direct Bilirubin (mg/dL) Indirect Bilirubin (mg/dL) Ammonia (μg/dL) Urea (mg/dL) Total protein (g/dL) Albumin (g/dL) Creatinine (mg/dL) FBS (mg/dL)
77 (69–86) 80 (78–86) 184 (157–197) 0.36 (0.26–0.51) 0.12 (0.11–0.14) 0.24 (0.13–0.4) 63 (17) 51 (5) 6.5 (0.2) 3.3 (0.07) 0.6 (0.01) 165 (12)
273 (255–323) ***↑ 283 (226–324) ***↑ 615 (562–745) ***↑ 11 (8–12) ***↑ 6 (4.4–7.5) ***↑ 4 (3.3–5) ***↑ 302 (36) ***↑ 73 (13) ***↑ 7.5 (0.2) ***↑ 3.16 (0.06) ** ↓ 0.4 (0.06) ***↓ 91 (5) ***↓
Data are either median (interquartile range) or mean (SD). **P < 0.01 and ***P < 0.001 compared to the respective data of the sham control group. ↑ and ↓ represent an increase or a decrease in the respected parameter compared to the respective data of the sham control group. ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; ALP: Alkaline phosphatase; FBS: Fasting blood sugar.
increases in the serum levels of ALT, AST, ALP, as well as all types of bilirubin in the HE model group compared to the sham control group: for ALT [U (14) = 36, P < 0.001, partial eta squared = 0.8], for AST [U (14) = 36, P < 0.001, partial eta squared = 0.8], for ALP [U (14) = 36, P < 0.001, partial eta squared = 0.8], for direct bilirubin [U (14) = 36, P < 0.001, partial eta squared = 0.8], for indirect bilirubin [U (14) = 36, P < 0.001, partial eta squared = 0.8], and for total bilirubin [U (14) = 36, P < 0.001, partial eta squared = 0.8]. As revealed by the effect size value (partial eta squared = 0.8), large differences in the median values of two experimental groups were observed for all of the analyzed parameters (Table 2). The results also showed that the plasma level of ammonia significantly increases in rats with BDL on day 28 of BDL compared to the sham control group [t (14) = -17.1, P < 0.001, Cohen’s d = 8.6]. In addition, the results also indicate significant increases in the serum levels of urea [t (14) = -4.5, P < 0.001, Cohen’s d = 2.3], total protein [t (14) = -11.8, P < 0.001, Cohen’s d = 5.9] in the HE model group compared to the sham control group. The results also indicate significant decreases in the serum levels of albumin [t (14) = 4.2, P < 0.001, Cohen’s d = 2.1], creatinine [t (14) = 7.5, P < 0.001, Cohen’s d = 3.8], as well as FBS [t (14) = 15.5, P < 0.001, Cohen’s d = 7.8] in the HE model group compared to the sham control group. The effect size values show that the magnitude of the differences in the means of all parameters was very large between sham control and BDL groups.
Fig. 3. The Pkcγ and CamkIIα gene expression in the PFC on day 28 of BDL. Each bar represents mean (SD) for the Pkcγ or CamkIIα gene expression data of the specified groups. ++ P < 0.01, * P < 0.05 compared to the respective sham control group.
3.4. The Pkcγ and CamkIIα gene expression was site-specifically changed in the PFC, hippocampus and cerebellar cortex after 28 days of BDL Analysis of the gene expression results in the PFC with independent t-test revealed that the Pkcγ and CamkIIα mRNA levels were increased after 28 days of BDL; for Pkcγ [t (6) = - 3.9, P < 0.01, Cohen’s d = 2.8], and for CamKIIα [t (6) = - 3.9, P < 0.01, Cohen’s d = 2.8] (Fig. 3). Analysis of the gene expression data in the hippocampus with independent t-test showed significant decreases for the Pkcγ and the CamKIIα mRNA level after 28 days of BDL; for Pkcγ [t (6) = 3.1, P < 0.05, Cohen’s d = 2.2], and for CamKIIα [t (6) = 3.8, P < 0.01, Cohen’s d = 2.7] (Fig. 4). In addition, the Pkcγ gene expression was decreased in the cerebellar cortex [t (6) = 4.4, P < 0.01, Cohen’s d = 3.1], but the CamKIIα gene expression was increased [t (6) = -2.8, P < 0.05, Cohen’s d = 2] (Fig. 5). Considering the effect size values presented as Cohen’s d, it is clear that the magnitude of the differences in the means of the gene expression data between the BDL and sham control groups was very large.
Fig. 4. The Pkcγ and CamkIIα gene expression in the hippocampus on day 28 of BDL. Each bar represents mean (SD) for the Pkcγ or CamkIIα gene expressions data of each experimental group. + P < 0.05 and ** P < 0.01 compared to the respective sham control group.
4. Discussion Common bile duct ligation (BDL) in rats and mice has been previously accepted as an intervention to induce a model of chronic liver failure [30,31]. The liver failure and the subsequent hyperammonemia are the main cause of cirrhotic HE [6]. The behavioral results in the present study reveal that the locomotor activity and rearing behavior are significantly impaired from day seven and continue to worsen till day 28 of BDL. In support of the present results, it has been reported 4
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
by liver cirrhosis is a main cause of the inflammation in the brain, which in turn affects the brain normal functioning [36,37]. It has been also reported that chronic liver failure induces hyperammonemia, which is the main factor for inducing HE [10,31,38]. Therefore, considering the induction of liver dysfunction and hyperammonemia in rats with BDL in the present experiments, a neuroinflammation state in the brain of rats after 28 days of BDL will be confirmed. Changes in glutamatergic and GABAergic neural circuits have been implicated in the motor and cognitive impairments in HE patients [6,9,39,40]. In addition, different signaling molecules, especially protein kinases located downstream to the glutamate receptors, may also be affected in HE patients [6,41]. In particular, it has been shown that hyperammonemia decreases PKC-dependent phosphorylation of microtubule-associated proteins [42]. It has been also reported that protein kinase G is involved in ammonia-induced swelling of astrocytes [43]. However, there is no information on gene expression and mRNA levels of different protein kinases in different brain areas of the HE model animals and/or HE patients. The results of the gene expression evaluation in the present study reveal that the Pkcγ and CamKIIα gene expression is increased in the PFC but decreased in the hippocampus of the bile duct ligated rats on day 28 of BDL. To discuss the present results, one may propose that the alteration in the Pkcγ and CamKIIα gene expression can be a consequence of site-specific changes of the glutamate receptor signaling after the increased levels of glutamate in the PFC and hippocampus of the cirrhotic HE model rats. In addition, the present results revealed that the Pkcγ gene expression was decreased, but the CamKIIα gene expression was increased in the cerebellar cortex. A limitation of the present study is the lack of the measurement of protein levels for PKCγ and CaMKIIα. However, according to some previous reports, it has been shown that the gene expression of Pkcγ [44,45] and CamKIIα [18] is in line with their protein levels. There are different reports that PKC and CamKII are involved in cognition and locomotion [18,21,45,46]. Birnbaum and coworkers [46] have reported that excessive PKC activation, as seen during stress exposure, can disrupt prefrontal cortical regulation of behavior and cognition. It has been also reported that the administration of a specific PKC inhibitor completely blocks the ouabain-induced hyperlocomotion [19]. In the present study, the increased level of the Pkcγ gene expression in the PFC may reflect an increase in its production and activation, and as a result, it may have an impairing effect on locomotion and rearing behavior in HE model rats. In addition, a relationship between an increased level and activity of CamKIIα in the hippocampus with hyperlocomotion in morphine-sensitized rats has been reported [21], which support this idea that the decrease in the CamKIIα gene expression in the hippocampus may be associated with the decrease in the locomotion and rearing behavior in the HE model animals. Chronic hyperammonemia has been also shown to increase tonic activation of NMDA receptors in the cerebellum, leading to the activation of CamKII [32]. The results of the gene expression in the cerebellum for Pkcγ was similar to the expression of this gene in the hippocampus but the result for CamKIIα was similar to the PFC. It is possible to hypothesize that glutamate levels due to hyperammonemia do not have similar effects on different areas of the brain, and therefore the subsequent changes in the downstream signaling molecules (such as the Pkcγ and CamKIIα) are site specific. Other investigators have also shown that the NMDA subtype of glutamate receptors and their downstream signaling pathways are necessary for cognitive functions like avoidance learning [47]. In the light of the present results, it can be suggested that molecular changes in Pkcγ and CamKIIα may underlie the cognitive and locomotion impairments observed in the HE model rats. Considering the present results, the memory impairment that has been reported in other studies for HE animal models or patients [6,36,37], may also be a consequence of the changes in the activity of glutamate receptors and the subsequent changes in their downstream signaling molecules such as PKCγ and CamKIIα in the hippocampus.
Fig. 5. The Pkcγ and CamkIIα gene expression in the cerebellar cortex on day 28 of BDL. Each bar represents mean (SD) for the Pkcγ or CamkIIα gene expression data of the specified groups. ++ P < 0.01 and * P < 0.05 compared to the respective sham control group.
that decreases in locomotor activity and impairment of motor coordination are common symptoms of HE [9]. However, the exact mechanisms underlying these disturbances are not well understood. Some investigators propose that hyperammonemia and inflammation have synergistic roles in inducing the neurological alterations in HE [6,32]. It has been also reported that chronic moderate hyperammonemia, similar to that present in the cirrhotic patients, is enough to induce neuroinflammation and neurological alterations in the rats without liver failure [31]. Biochemical analyses in this study also show that the plasma level of ammonia is significantly increased in rats with BDL compared to the sham control group on day 28 of BDL. In addition, the results of the biochemical analyses reveal that in rats with BDL, the serum levels of urea, all types of bilirubin including direct, indirect and total bilirubin, total protein, as well as hepatic enzymes, including ALT, AST, and ALP, are significantly increased compared to the sham control rats on day 28 of BDL. Interestingly, the present results also reveal that the serum levels of albumin, creatinine, and FBS are significantly decreased in rats with BDL on day 28. Taken together, the abnormal increases in the standard laboratory tests of the healthy liver, including the serum level of bilirubin and hepatic enzymes, as well as high plasma level of ammonia in the present study, confirm the liver failure on day 28 of BDL. In addition, the low level of albumin further confirms damage to the normal hepatic functioning. According to the present biochemical results, we suggest that the liver damage leads to the increases in toxins, especially ammonia in the bloodstream, which can also affect the functioning of the other organs especially the brain. The decrease in serum levels of FBS and creatinine may also further support the dysfunctions of the liver, kidney, and muscles on day 28 of BDL. Consistent with the present results, it has been shown that the biochemical changes in the plasma and serum are common results of the BDL [33–35]. The biochemical data of the present experiments confirm the damage to the liver, and subsequently induction of cirrhotic HE on day 28 of BDL. Previously published results from our laboratory also showed that BDL in rats induces hyperammonemia and increases serum level of bilirubin on day 21 of BDL [25]. According to some previous reports, hyperammonemia induced 5
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
It has been shown that neuroinflammation increases GABAergic tone and impairs cognitive and motor function in hyperammonemia conditions, which contributes to cognitive and motor impairment in HE [48]. PKC-mediated phosphorylation can be an important physiological regulator of tonic GABAA receptor-mediated inhibition in the hippocampus. In support of this claim, it has been shown that PKC activation causes downregulation of tonic GABAA receptor-mediated inhibition, while the inhibition of PKC results in an increase in tonic GABAA activity [49]. Therefore, we propose that the decrease in the Pkcγ gene expression in the hippocampus and cerebellar cortex of the HE model rats may be followed by an increased in GABAergic tone. Therefore, it is possible that disturbances in other neurotransmitters such as GABA may counterbalance the increases in glutamate levels in different brain areas in HE model rats. However, the exact mechanisms account for specific changes in the Pkcγ and CamKIIα in different brain areas remain to be understood.
neuronal circuits in hepatic encephalopathy, Metab. Brain Dis. 24 (1) (2009) 69–80. [10] O. Cauli, M.T. Mansouri, A. Agusti, V. Felipo, Hyperammonemia increases GABAergic tone in the cerebellum but decreases it in the rat cortex, Gastroenterology 136 (4) (2009) 1359–1367 e1–2. [11] R. Prakash, K.D. Mullen, Mechanisms, diagnosis and management of hepatic encephalopathy, Nat. Rev. Gastroenterol. Hepatol. 7 (9) (2010) 515–525. [12] A. Agusti, M. Llansola, V. Hernandez-Rabaza, A. Cabrera-Pastor, C. Montoliu, V. Felipo, Modulation of GABAA receptors by neurosteroids. A new concept to improve cognitive and motor alterations in hepatic encephalopathy, J. Steroid Biochem. Mol. Biol. 160 (2016) 88–93. [13] D.J. David, J. Wang, B.A. Samuels, Q. Rainer, I. David, A.M. Gardier, R. Hen, Implications of the functional integration of adult-born hippocampal neurons in anxiety-depression disorders, Neuroscientist 16 (5) (2010) 578–591. [14] D.E. Moorman, M.H. James, E.M. McGlinchey, G. Aston-Jones, Differential roles of medial prefrontal subregions in the regulation of drug seeking, Brain Res. 1628 (Pt A) (2015) 130–146. [15] M.G. Kutlu, D.A. Connor, J.M. Tumolo, C. Cann, B. Garret, T.J. Gould, Nicotine modulates contextual fear extinction through changes in ventral hippocampal GABAergic function, Neuropharmacology 141 (2018) 192–200. [16] J. Lisman, H. Schulman, H. Cline, The molecular basis of CaMKII function in synaptic and behavioural memory, Nat. Rev. Neurosci. 3 (3) (2002) 175–190. [17] M. Amadio, F. Battaini, A. Pascale, The different facets of protein kinases C: old and new players in neuronal signal transduction pathways, Pharmacol. Res. 54 (5) (2006) 317–325. [18] Q. Wang, P. Yin, B. Yu, Z. Zhao, G. Richter-Levin, L. Yu, X. Cao, Down-regulation of dorsal striatal alphaCaMKII causes striatum-related cognitive and synaptic disorders, Exp. Neurol. 298 (Pt A) (2017) 112–121. [19] S.S. Valvassori, G.C. Dal-Pont, W.R. Resende, R.B. Varela, B.R. Peterle, F.F. Gava, F.G. Mina, J.H. Cararo, A.F. Carvalho, J. Quevedo, Lithium and tamoxifen modulate behavior and protein kinase C activity in the animal model of mania induced by ouabain, Int. J. Neuropsychopharmacol. 20 (11) (2017) 877–885. [20] C.A. Zarate, H.K. Manji, Protein kinase C inhibitors: rationale for use and potential in the treatment of bipolar disorder, CNS Drugs 23 (7) (2009) 569–582. [21] M. Kadivar, M. Farahmandfar, F.E. Ranjbar, M.R. Zarrindast, Increased calcium/ calmodulin-dependent protein kinase II activity by morphine-sensitization in rat hippocampus, Behav. Brain Res. 267 (2014) 74–82. [22] M.M. Kishiyama, A.P. Yonelinas, R.T. Knight, Novelty enhancements in memory are dependent on lateral prefrontal cortex, J. Neurosci. 29 (25) (2009) 8114–8118. [23] T. Monfil, R.A. Vazquez Roque, I. Camacho-Abrego, H. Tendilla-Beltran, T. Iannitti, I. Meneses-Morales, P. Aguilar-Alonso, G. Flores, J.C. Morales-Medina, Hyper-response to novelty increases c-Fos expression in the Hippocampus and prefrontal cortex in a rat model of schizophrenia, Neurochem. Res. 43 (2) (2018) 441–448. [24] M. Arriaga, E.B. Han, Dedicated hippocampal inhibitory networks for locomotion and immobility, J. Neurosci. 37 (38) (2017) 9222. [25] S. Ahmadi, M. Poureidi, J. Rostamzadeh, Hepatic encephalopathy induces sitespecific changes in gene expression of GluN1 subunit of NMDA receptor in rat brain, Metab. Brain Dis. 30 (4) (2015) 1035–1041. [26] S. Ahmadi, A. Mohammadian Farsani, Z. Karami, F. Khosrobakhsh, J. Rostamzadeh, Increase in nociception threshold and decrease in mu-opioid receptor gene expression in liver of a rat model of hepatic encephalopathy, Shefaye Khatam 3 (1) (2015) 1–10. [27] K. Chiu, W.M. Lau, H.T. Lau, K.F. So, R.C. Chang, Micro-dissection of rat brain for RNA or protein extraction from specific brain region, J. Vis. Exp. 7 (2007) 269. [28] S. Ahmadi, Z. Karami, A. Mohammadian, F. Khosrobakhsh, J. Rostamzadeh, Cholestasis induced antinociception and decreased gene expression of MOR1 in rat brain, Neuroscience 284 (2015) 78–86. [29] J. Cohen, Statistical Power Analysis for the Behavioral Sciences, L. Erlbaum Associates, Hillsdale, N.J, 1988. [30] R.F. Butterworth, M.D. Norenberg, V. Felipo, P. Ferenci, J. Albrecht, A.T. Blei, Experimental models of hepatic encephalopathy: ISHEN guidelines, Liver Int. 29 (6) (2009) 783–788. [31] R. Rodrigo, O. Cauli, U. Gomez-Pinedo, A. Agusti, V. Hernandez-Rabaza, J.M. Garcia-Verdugo, V. Felipo, Hyperammonemia induces neuroinflammation that contributes to cognitive impairment in rats with hepatic encephalopathy, Gastroenterology 139 (2) (2010) 675–684. [32] N. El-Mlili, R. Rodrigo, B. Naghizadeh, O. Cauli, V. Felipo, Chronic hyperammonemia reduces the activity of neuronal nitric oxide synthase in cerebellum by altering its localization and increasing its phosphorylation by calcium-calmodulin kinase II, J. Neurochem. 106 (3) (2008) 1440–1449. [33] R.D. Adler, F.J. Wannagat, R.K. Ockner, Bile secretion in selective biliary obstruction. Adaptation of taurocholate transport maximum to increased secretory load in the rat, Gastroenterology 73 (1) (1977) 129–136. [34] L. Maillette de Buy Wenniger, U. Beuers, Bile salts and cholestasis, Dig. Liver Dis. 42 (6) (2010) 409–418. [35] E.A. Rodriguez-Garay, Cholestasis: human disease and experimental animal models, Ann. Hepatol. 2 (4) (2003) 150–158. [36] O. Cauli, R. Rodrigo, B. Piedrafita, J. Boix, V. Felipo, Inflammation and hepatic encephalopathy: ibuprofen restores learning ability in rats with portacaval shunts, Hepatology 46 (2) (2007) 514–519. [37] P. Monfort, O. Cauli, C. Montoliu, R. Rodrigo, M. Llansola, B. Piedrafita, N. El Mlili, J. Boix, A. Agusti, V. Felipo, Mechanisms of cognitive alterations in hyperammonemia and hepatic encephalopathy: therapeutical implications, Neurochem. Int. 55 (1-3) (2009) 106–112. [38] V. Felipo, R.F. Butterworth, Neurobiology of ammonia, Prog. Neurobiol. 67 (4) (2002) 259–279. [39] T.F. Almeida, S. Roizenblatt, S. Tufik, Afferent pain pathways: a neuroanatomical
5. Conclusion According to the biochemical results of the present study, the bile duct ligation induces liver damage in rats followed by hyperammonemia and possibly neuroinflammation after 28 days. In addition, rats with BDL during a period of 28 days showed continual decreases in locomotor activity and rearing behavior, which reflects neurological and cognitive dysfunctions in rats. The results of the Pkcγ and CamKIIα gene expression in the PFC, hippocampus and cerebellar cortex indicate site-specific disturbances in the gene expression of downstream signaling molecular cascades including the Ca2+-dependent kinases in different brain areas associated with locomotion and cognition. It can be concluded that the Ca2+-dependent kinases have the potential to be the target molecules in controlling neurological disorders in HE. Funding This work was supported by a grant from the Vice-Chancellorship of Research and Technology, University of Kurdistan, Sanandaj, Iran (No. 1395/2016). Ethical approval All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. Conflict of interest The authors declare that they have no conflict of interest. References [1] M.E. Rinella, Nonalcoholic fatty liver disease: a systematic review, JAMA 313 (22) (2015) 2263–2273. [2] A. Adibi, S. Maleki, P. Adibi, R. Etminani, S. Hovsepian, Prevalence of nonalcoholic fatty liver disease and its related metabolic risk factors in Isfahan, Iran, Adv. Biomed. Res. 6 (2017) 47. [3] E.M. Brunt, V.W. Wong, V. Nobili, C.P. Day, S. Sookoian, J.J. Maher, E. Bugianesi, C.B. Sirlin, B.A. Neuschwander-Tetri, M.E. Rinella, Nonalcoholic fatty liver disease, Nat. Rev. Dis. Primers 1 (2015) 15080. [4] M. Naderian, H. Ebrahimi, A.A. Sohrabpour, Prevalence of nonalcoholic fatty liver disease in the middle eastern area: What is the exact estimation? Hepatology 64 (4) (2016) 1390–1391. [5] R.F. Butterworth, The liver-brain axis in liver failure: neuroinflammation and encephalopathy, Nat. Rev. Gastroenterol. Hepatol. 10 (9) (2013) 522–528. [6] V. Felipo, Hepatic encephalopathy: effects of liver failure on brain function, Nat. Rev. Neurosci. 14 (12) (2013) 851–858. [7] S.S.F. Kenston, X. Song, Z. Li, J. Zhao, Mechanistic insight, diagnosis and treatment of ammonia induced hepatic encephalopathy, J. Gastroenterol. Hepatol. 34 (1) (2018) 31–39. [8] C. Acharya, J.S. Bajaj, Current management of hepatic encephalopathy, Am. J. Gastroenterol. 113 (11) (2018) 1600–1612. [9] O. Cauli, R. Rodrigo, M. Llansola, C. Montoliu, P. Monfort, B. Piedrafita, N. El Mlili, J. Boix, A. Agusti, V. Felipo, Glutamatergic and gabaergic neurotransmission and
6
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al. review, Brain Res. 1000 (1-2) (2004) 40–56. [40] L.T. Huang, C.S. Hsieh, M.H. Chou, J.H. Chuang, C.W. Liou, M.M. Tiao, M.C. Lai, Obstructive jaundice in rats: cause of spatial memory deficits with recovery after biliary decompression, World J. Surg. 28 (3) (2004) 283–287. [41] P. Hollos, F. Marchisella, E.T. Coffey, JNK regulation of depression and anxiety, Brain Plast. 3 (2) (2018) 145–155. [42] V. Felipo, E. Grau, M.D. Minana, S. Grisolia, Hyperammonemia decreases proteinkinase-C-dependent phosphorylation of microtubule-associated protein 2 and increases its binding to tubulin, Eur. J. Biochem. 214 (1) (1993) 243–249. [43] H. Mohammad, F. Marchisella, S. Ortega-Martinez, P. Hollos, K. Eerola, E. Komulainen, N. Kulesskaya, E. Freemantle, V. Fagerholm, E. Savontous, H. Rauvala, B.D. Peterson, H. van Praag, E.T. Coffey, JNK1 controls adult hippocampal neurogenesis and imposes cell-autonomous control of anxiety behaviour from the neurogenic niche, Mol. Psychiatry 23 (2) (2018) 362–374. [44] E. Shimobayashi, J.P. Kapfhammer, Increased biological activity of protein Kinase C gamma is not required in Spinocerebellar ataxia 14, Mol. Brain 10 (1) (2017) 34. [45] B. Wu, S. Wang, G. Qin, J. Xie, G. Tan, J. Zhou, L. Chen, Protein kinase C gamma contributes to central sensitization in a rat model of chronic migraine, J. Mol.
Neurosci. 63 (2) (2017) 131–141. [46] S.G. Birnbaum, P.X. Yuan, M. Wang, S. Vijayraghavan, A.K. Bloom, D.J. Davis, K.T. Gobeske, J.D. Sweatt, H.K. Manji, A.F. Arnsten, Protein kinase C overactivity impairs prefrontal cortical regulation of working memory, Science 306 (5697) (2004) 882–884. [47] D.M. Barros, L.A. Izquierdo, T. Mello e Souza, P.G. Ardenghi, P. Pereira, J.H. Medina, I. Izquierdo, Molecular signalling pathways in the cerebral cortex are required for retrieval of one-trial avoidance learning in rats, Behav. Brain Res. 114 (1-2) (2000) 183–192. [48] V. Hernandez-Rabaza, A. Cabrera-Pastor, L. Taoro-Gonzalez, A. Gonzalez-Usano, A. Agusti, T. Balzano, M. Llansola, V. Felipo, Neuroinflammation increases GABAergic tone and impairs cognitive and motor function in hyperammonemia by increasing GAT-3 membrane expression. Reversal by sulforaphane by promoting M2 polarization of microglia, J. Neuroinflammation 13 (1) (2016) 83. [49] D.P. Bright, T.G. Smart, Protein kinase C regulates tonic GABA(A) receptor-mediated inhibition in the hippocampus and thalamus, Eur. J. Neurosci. 38 (10) (2013) 3408–3423.
7
Contents lists available at ScienceDirect
Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr
Calcium-dependent kinases in the brain have site-specific associations with locomotion and rearing impairments in rats with bile duct ligation
T
Shamseddin Ahmadi , Saeed Faridi1, Soma Tahmasebi1 ⁎
Department of Biological Science, Faculty of Science, University of Kurdistan, Sanandaj, Iran
ARTICLE INFO
ABSTRACT
Keywords: Bile duct ligation Locomotion Rearing PKCγ CamKIIα Gene expression
We study the impairment of locomotion and rearing behavior in rats with a common bile duct ligation (BDL), and the possible involvement of the PKCγ and CamKIIα gene expression in the brain. Male Wistar rats undergo either sham operation or BDL to induce a rat model of cirrhotic hepatic encephalopathy (HE). Six groups of the animals were divided into three sets of sham-operated and BDL groups. In the first set, locomotion and rearing behavior were assessed on days 1, 7, 14, 21 and 28 of BDL. On day 28 of BDL, blood samples were collected from the second set of the animals for biochemical analysis, and the rats in the third set were used to extract the PFC, the hippocampus, and the cerebellar cortex for examining the Pkcγ and CamKIIα gene expression. The results showed that locomotion and rearing were decreased during 28 days of BDL with the most significant change on the 28th day. Biochemical analysis of the blood revealed hyperammonemia, increases in liver enzymes, and a decrease in albumin indicating liver damage and induction of cirrhotic HE. The results also showed that both of the Pkcγ and CamKIIα gene expressions were increased in the PFC but decreased in the hippocampus. However, the Pkcγ gene expression was decreased but the CamKIIα gene expression was increased in the cerebellar cortex. It can be concluded that the Ca2+-dependent kinases in different brain areas have a site-specific association with the impairment of locomotion and rearing behavior in the cirrhotic HE model rats.
1. Introduction According to health reports, there are many people with fatty liver disease worldwide [1–4]. Fatty and other chronic liver diseases gradually lead to liver cirrhosis, which is the main cause of liver failure [5]. The liver failure is followed by hyperammonemia that in turn induces brain dysfunctions, which is referred to as cirrhotic hepatic encephalopathy (HE). As a complex disorder, cirrhotic HE is characterized by neuroinflammation, alterations in the normal brain functioning and morphological and physiological changes in astrocytes and neurons [6–8]. Neural impacts of HE vary from impairment of locomotion to cognitive dysfunctions [5,6]. Some investigators have reported possible mechanisms for the neural dysfunctions in the animal model of HE. In particular, it has been reported that the hyperammonemia in HE is associated with neurotransmission alterations, especially glutamate and GABA [6,9]. In support of these reports, it has been shown that new therapeutic approaches acting either on N-Methyl-D-Aspartate (NMDA) subtype of the glutamate receptors or GABAA receptors improve cognitive and motor dysfunctions in the animal models of HE [6,10–12].
The action of glutamate on neurons increases intracellular Ca2+ levels [13], resulting in activation of Ca2+ dependent kinases such as protein kinase C (PKC) and calcium/calmodulin-dependent protein kinase II (CamKII), which in turn initiate subsequent signaling cascades in neurons [14,15]. Considering the increase in the glutamate level in HE and the subsequent increases in the influx of Ca2+ into the neurons, it is possible that changes in PKC and CamKII molecules be involved in the pathogenesis of HE. It has been shown that gamma isotype of PKC (PKCγ) is expressed solely in the central nervous system (CNS), where its localization is restricted to the neurons [15]. CaMKII is also a Ca2+dependent kinase with different isoforms, which the alpha isoform (CaMKIIα) is prevalent in the brain [14,16]. The role of PKCγ and CamKIIα in cognitive functions and locomotor activity have been reported elsewhere [17,18]. In particular, involvement of PKC in the hyperlocomotion in bipolar disorder has been confirmed [19,20]. Kadivar and colleagues [21] have also shown a relationship between locomotion and the increased CamKIIα mRNA, as well as the enzyme activity in rat hippocampus after morphine-sensitization. Nevertheless, the association of PKCγ and CamKIIα, especially at the gene expression level, with the pathogenesis of HE remains to be investigated.
Corresponding author. E-mail address: [email protected] (S. Ahmadi). 1 The second and third authors contributed equally to this work. ⁎
https://doi.org/10.1016/j.bbr.2019.112009 Received 4 March 2019; Received in revised form 15 May 2019; Accepted 3 June 2019 Available online 05 June 2019 0166-4328/ © 2019 Elsevier B.V. All rights reserved.
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
Some brain areas including the prefrontal cortex, hippocampus, and cerebellum are involved in cognition, locomotion, place, and balance [22]. In addition, interconnected pathways between these areas especially the hippocampus and PFC in the process of coding novelty in rat have been reported [23]. It has been also suggested that hippocampal inter-neuronal microcircuits are preferentially active during either movement or immobility periods [24]. In this study, first, we examine locomotor activity and rearing behavior (as a behavior needing locomotion, novelty-seeking, and balance) in rats with BDL as an animal model of HE. Then, we examine the possible changes in the Pkcγ and CamKIIα gene expression in the PFC, hippocampus, and cerebellar cortex. We aim to explore a possible relationship between the Ca2+dependent kinases at mRNA level in the PFC, hippocampus and cerebellum and the impairment of locomotor activity and rearing behavior in the HE model rats.
counted as an index of novelty-seeking behavior and movement coordination. 2.4. Biochemical analysis of plasma and serum On day 28 of BDL, the rats of the second set of the animals were deeply anesthetized and blood samples collected via heart puncture immediately for biochemical analysis. Plasma levels of ammonia were determined using a Biorex Ammonia Assay Kit immediately after the heart puncture according to the manufacturer manual (Biorexfars Diagnostics, Shiraz, Iran). In addition, the plasma levels of urea, total protein, alanine aminotransferase (ALT), asparagine aminotransferase (AST), alkaline phosphatase (ALP), total, direct and indirect bilirubin, albumin, creatinine and fasting blood sugar (FBS) were also evaluated with the respective standard kits according to the respected instructions supplied by manufacturer (Darmankav, Esfahan, Iran).
2. Materials and methods
2.5. Dissection of the PFC, hippocampus and cerebellar cortex
2.1. Animals
Both sham and HE model rats in the third set of the animals (n = 4, in each group) were used to examine the Pkcγ and CamkIIα gene expression in the PFC, hippocampus and cerebellar cortex. On day 28 of BDL, each rat was decapitated, the whole brain quickly removed from the skull and the PFC, hippocampus and cerebellar cortex were immediately dissected on an ice-chilled sterile surface [25,27,28]. Then, each tissue was immediately submerged in an RNAlater RNA Stabilization Reagent (Qiagen, USA), and incubated overnight at 4 °C. After 24 h, the RNAlater solution was aspirated and the tissues were stored at −80 °C until further analysis.
Male Wistar rats were used and kept in an animal house with constant temperature (22 ± 2 °C) and a 12 h light/dark cycle (lighting 7:00 – 19:00). The animals had free access to food and water except during the experiments. Behavioral tests were carried out during the light phase between 9:00 and 12:00 (a.m.). Forty rats (weighing 300–350 g) in three sets were used. Each set of the animals included a group of sham control and a group with BDL as a model of cirrhotic HE. In the first set of the animals, a total number of 16 rats in two groups of sham and HE model (n = 8, in each group) were used to examine locomotion and rearing behavior weekly during a period of 28 days of BDL. In the second set including 16 rats (n = 8 per group), biochemical analysis of serum or plasma was assessed on day 28 of BDL. In the third set of the animals, including the sham and HE model groups (n = 4, in each group) the Pkcγ and CamkIIα gene expressions in the PFC, hippocampus and cerebellar cortex were evaluated. All procedures were performed in accordance with the Guide for the Care and Use of Laboratory Animals (2011) prepared by the National Academy of Sciences’ Institute for Laboratory Animal Research.
2.6. Reverse transcription-quantitative polymerase chain reaction (RTqPCR) The RNeasy Mini Kit (Qiagen, USA) was used for the total RNA extraction from 25 mg of each tissue according to the kit instruction manual. Qualities of the extracted total RNAs were assessed with 1% agarose gel electrophoresis to visualize both 28 s and 18 s ribosomal RNA. The concentration of the total RNAs was also measured with a spectrophotometry method (Specord210, Analytic Jena, Germany). Reverse transcription of the total RNAs was performed by using Thermo Scientific RevertAid first strand cDNA synthesis kit according to manufacturer manual (Thermo Fisher Scientific, USA). First, real-time quantification for reference genes, including glyceraldehyde-3-phosphate dehydrogenase (Gapdh), beta-actin (Actb) and cyclophilin A (Cycl A) genes, and the Pkcγ and CamKIIα as the genes of interest were performed in independent triplicate reactions (as technical repeats) for each sample in both sham control and HE model groups including four rats in each group as biological repeats (LightCycler 96, Roche, Germany). The best reference gene selection was done and Gapdh was selected as the best reference gene using the NormFinder method in GeneX 6.1 Software. Each reaction volume was 20 μl consisting of 10 μl SYBR Green master mix (Premix Ex Taq, Takara Bio, Otsu, Japan), 5 μl cDNA (4 ng/μl), 2 μl mix of the forward and reverse primers (10 μM) and nuclease-free ddH2O up to 20 μl. Thermal cycling was initiated with a pre-incubation step (95 °C for 30 s), followed by 40 cycles of two-step amplification (95 °C for 5 s and 60 °C for 30 s), melting (95 °C for 5 s, 60 °C for 60 s and 95 °C for 1 s), and finalized by cooling at 50 °C for 30 s. Information about the gene-specific primers has been summarized in the Table 1.
2.2. Surgical laparotomy All rats were food restricted for 12 h prior to the surgery. Both groups of sham control and HE model group underwent general anesthesia induced by intraperitoneal (i.p.) injection of a mixture of ketamine/xylazine (100 and 10 mg/kg, respectively). The sham operation consisted of laparotomy as well as bile duct identification and manipulation, but without ligation and resection. In the HE model group, each rat was subjected to double ligation of the common bile duct with approximately 10 mm apart followed by dissection of the bile duct in the middle of the ligatures. After the closure of the abdominal wound, each rat was received 1 ml saline (i.p.), and moved to a clean box until complete recovery [25,26]. 2.3. Behavioral testing Locomotor activity was measured with an activity meter (Borj Sanat Azma Co, Tehran, Iran). On day one of the 28 day period before doing the surgical laparotomy and thereafter weekly on days 7, 14, 21 and 28 of BDL the locomotives of rats was examined. In brief, each rat was placed in a clear Plexiglas container (40 × 40 × 40 cm high), where the floor of the box was divided into four equal size squares (20 × 20 cm). Each animal in the test box was monitored with a video camera connected to a Sony VCR in an adjacent room (Sony, Japan). Total horizontal movements of each rat with all four paws crossing the squares were recorded for 5 min as an index of locomotion. During locomotion testing, the total numbers of rearing behavior of each animal were also
2.7. Statistical analysis The data from the locomotion and rearing behavior’ tests passed normality and equal variance tests, and so they were analyzed by oneor two way repeated measure ANOVA. After a significant F value, post hoc Holm-Sidak’s test was used for the multiple pairwise comparisons. 2
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
Table 1 : The sequences of the specific gene primers and the respective amplicon sizes. Gene
Ref. Seq.
Sequences (5′-3′)
Amplicon size (bp)
Gapdh
NM_017008.4
77
Actb
NM_031144.3
Cycl A
NM_017101.1
Pkcγ
NM_012628
CamkIIα
NM_012920.1
F: AGTGCCAGCCTCGTCTCATA R: GTAACCAGGCGTCCGATAC F: GCAGGAGTACGATGAGTCCG R: ACGCAGCTCAGTAACAGTCC F: GTTCTTCGACATCACGGCT R: CACGAAAGTTTTCTGCTGTCT F: GTATGAGAGAGTGCGGATGG R: AGTCAGAGATATGCAGGCGTC F: GAAGCACCCCAATATCGTC R:GATACAGTGGCTGGCATCAG
74 95 121 148
Gapdh: Glyceraldehyde-3-phosphate Dehydrogenase; Actb: Beta Actin; Cycl A: Cyclophilin A; Pkcγ: Protein kinase c gamma; CamKIIα: Ca2+/Calmodulindependent protein kinase II alpha.
The data for ALT, AST, ALP and different forms of bilirubin failed to pass normality and/or equal variance tests, therefore, they were analyzed by Mann-Whitney’s U test The data for ammonia, urea, total protein, albumin, creatinine, and FBS were normal and therefore were analyzed with Student t-test. The real time-PCR data was analyzed by using the 2−ΔΔCT method, and Student t-test was used for comparing the gene expression results between two experimental groups. The data from the gene expression study had also normal distribution and was analyzed with the Student t-test. Normal data is represented as mean and standard deviation (SD) but non-normal data is represented as median and interquartile range. The values of partial eta squared or Cohen’s d was used to show the effect sizes with 95% confidence intervals. The effect size results were interpreted according to Cohen’s (1988) criterion [29]. P < 0.05 was considered as statistically significant level throughout.
Fig. 1. Line chart showing the locomotor activity on days 1, 7, 14, 21 and 28 of BDL. Two groups of sham and BDL rats were used and examined for locomotor activity on days 1, 7, 14, 21 and 28. Each point and the superimposed error bar represent mean and SD for the locomotion counts/ 5 min on the specified day. The white squares represent the data obtained for the sham control group and the black squares represent the locomotion data in the HE model group. ** P < 0.01 and *** P < 0.01 compared to the data of the sham control group on the same day.
Pairwise comparisons reveal that the rearing behavior of rats with BDL significantly decreases on days 7 (P < 0.01), 14 (P < 0.01), 21 (P < 0.01) and 28 (P < 0.001) compared to the rearing behavior of the sham control group on the same day (Fig. 2). 3.3. Biochemical analysis of plasma and serum revealed significant disturbances in the liver functions
3. Results 3.1. Locomotor activity was decreased during 28 days of BDL
The results of biochemical analysis of serum reveals dysfunction of the liver in rats with BDL. The results of Mann–Whitney U test reveal
A two-way repeated measure ANOVA (one-factor repetition) was conducted to assess the impact of the intervention with two levels (sham or BDL) on the locomotor activity across five days of a 28 day period (including days 1, 7, 14, 21 and 28 as the repetition factor). The results show a significant interaction between the two factors on the locomotor activity [F (4, 56) = 5.1, P < 0.01, partial eta squared = 0.4]. This result suggests that there is a significant change in the locomotor activity across the five testing days in the HE model rats (with BDL) compared to the sham control group. The effect size provided as partial eta squared (0.4) reveals that the actual difference in the mean values for the locomotor activity between the experimental groups can be classified as a large difference according to Cohen’s (1988) criterion. Post hoc testing reveals that the locomotor activity of rats in the HE model group is significantly decreased on days 7 (P < 0.01), 14 (P < 0.01), 21 (P < 0.01) and 28 (P < 0.001) compared to the sham control group on the same day (Fig. 1). 3.2. Rearing behavior was decreased during 28 days of BDL According to the results of a two-way repeated measure ANOVA, a significant interaction between BDL and days of testing (days 1, 7, 14, 21 and 28) was also observed for the rearing behavior [F (4, 56) = 2.8, P < 0.05, partial eta squared = 0.5]. Similar to the locomotor activity, this result suggests that there is a significant change in the rearing behavior between the HE model and sham control groups across the five different days of the testing. The effect size provided as partial eta squared (0.5) reveals a large difference in the mean values for the rearing behavior between rats with BDL and sham control group.
Fig. 2. Line chart showing the rearing behavior on days 1, 7, 14, 21 and 28 of BDL. Two groups of sham and BDL rats were used, and their rearing behavior was assessed on days 1, 7, 14, 21 and 28 of BDL (the rearing data were recorded in the same rats that were examined for the locomotion). Each point and the superimposed error bar represent mean and SD for the rearing behavior counts/ 5 min on the specified day. The white squares represent the data obtained for the sham control group and the black squares represent the rearing data in the HE model group. ** P < 0.01 and *** P < 0.01 compared to the data of the sham group on the same day. 3
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
Table 2 Biochemical analysis of the plasma and serum in the sham control and the cirrhotic HE model groups on day 28 of BDL. Parameter
Sham
BDL
ALT (U/L) AST (U/L) ALP (U/L) Total Bilirubin (mg/dL) Direct Bilirubin (mg/dL) Indirect Bilirubin (mg/dL) Ammonia (μg/dL) Urea (mg/dL) Total protein (g/dL) Albumin (g/dL) Creatinine (mg/dL) FBS (mg/dL)
77 (69–86) 80 (78–86) 184 (157–197) 0.36 (0.26–0.51) 0.12 (0.11–0.14) 0.24 (0.13–0.4) 63 (17) 51 (5) 6.5 (0.2) 3.3 (0.07) 0.6 (0.01) 165 (12)
273 (255–323) ***↑ 283 (226–324) ***↑ 615 (562–745) ***↑ 11 (8–12) ***↑ 6 (4.4–7.5) ***↑ 4 (3.3–5) ***↑ 302 (36) ***↑ 73 (13) ***↑ 7.5 (0.2) ***↑ 3.16 (0.06) ** ↓ 0.4 (0.06) ***↓ 91 (5) ***↓
Data are either median (interquartile range) or mean (SD). **P < 0.01 and ***P < 0.001 compared to the respective data of the sham control group. ↑ and ↓ represent an increase or a decrease in the respected parameter compared to the respective data of the sham control group. ALT: Alanine aminotransferase; AST: Aspartate aminotransferase; ALP: Alkaline phosphatase; FBS: Fasting blood sugar.
increases in the serum levels of ALT, AST, ALP, as well as all types of bilirubin in the HE model group compared to the sham control group: for ALT [U (14) = 36, P < 0.001, partial eta squared = 0.8], for AST [U (14) = 36, P < 0.001, partial eta squared = 0.8], for ALP [U (14) = 36, P < 0.001, partial eta squared = 0.8], for direct bilirubin [U (14) = 36, P < 0.001, partial eta squared = 0.8], for indirect bilirubin [U (14) = 36, P < 0.001, partial eta squared = 0.8], and for total bilirubin [U (14) = 36, P < 0.001, partial eta squared = 0.8]. As revealed by the effect size value (partial eta squared = 0.8), large differences in the median values of two experimental groups were observed for all of the analyzed parameters (Table 2). The results also showed that the plasma level of ammonia significantly increases in rats with BDL on day 28 of BDL compared to the sham control group [t (14) = -17.1, P < 0.001, Cohen’s d = 8.6]. In addition, the results also indicate significant increases in the serum levels of urea [t (14) = -4.5, P < 0.001, Cohen’s d = 2.3], total protein [t (14) = -11.8, P < 0.001, Cohen’s d = 5.9] in the HE model group compared to the sham control group. The results also indicate significant decreases in the serum levels of albumin [t (14) = 4.2, P < 0.001, Cohen’s d = 2.1], creatinine [t (14) = 7.5, P < 0.001, Cohen’s d = 3.8], as well as FBS [t (14) = 15.5, P < 0.001, Cohen’s d = 7.8] in the HE model group compared to the sham control group. The effect size values show that the magnitude of the differences in the means of all parameters was very large between sham control and BDL groups.
Fig. 3. The Pkcγ and CamkIIα gene expression in the PFC on day 28 of BDL. Each bar represents mean (SD) for the Pkcγ or CamkIIα gene expression data of the specified groups. ++ P < 0.01, * P < 0.05 compared to the respective sham control group.
3.4. The Pkcγ and CamkIIα gene expression was site-specifically changed in the PFC, hippocampus and cerebellar cortex after 28 days of BDL Analysis of the gene expression results in the PFC with independent t-test revealed that the Pkcγ and CamkIIα mRNA levels were increased after 28 days of BDL; for Pkcγ [t (6) = - 3.9, P < 0.01, Cohen’s d = 2.8], and for CamKIIα [t (6) = - 3.9, P < 0.01, Cohen’s d = 2.8] (Fig. 3). Analysis of the gene expression data in the hippocampus with independent t-test showed significant decreases for the Pkcγ and the CamKIIα mRNA level after 28 days of BDL; for Pkcγ [t (6) = 3.1, P < 0.05, Cohen’s d = 2.2], and for CamKIIα [t (6) = 3.8, P < 0.01, Cohen’s d = 2.7] (Fig. 4). In addition, the Pkcγ gene expression was decreased in the cerebellar cortex [t (6) = 4.4, P < 0.01, Cohen’s d = 3.1], but the CamKIIα gene expression was increased [t (6) = -2.8, P < 0.05, Cohen’s d = 2] (Fig. 5). Considering the effect size values presented as Cohen’s d, it is clear that the magnitude of the differences in the means of the gene expression data between the BDL and sham control groups was very large.
Fig. 4. The Pkcγ and CamkIIα gene expression in the hippocampus on day 28 of BDL. Each bar represents mean (SD) for the Pkcγ or CamkIIα gene expressions data of each experimental group. + P < 0.05 and ** P < 0.01 compared to the respective sham control group.
4. Discussion Common bile duct ligation (BDL) in rats and mice has been previously accepted as an intervention to induce a model of chronic liver failure [30,31]. The liver failure and the subsequent hyperammonemia are the main cause of cirrhotic HE [6]. The behavioral results in the present study reveal that the locomotor activity and rearing behavior are significantly impaired from day seven and continue to worsen till day 28 of BDL. In support of the present results, it has been reported 4
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
by liver cirrhosis is a main cause of the inflammation in the brain, which in turn affects the brain normal functioning [36,37]. It has been also reported that chronic liver failure induces hyperammonemia, which is the main factor for inducing HE [10,31,38]. Therefore, considering the induction of liver dysfunction and hyperammonemia in rats with BDL in the present experiments, a neuroinflammation state in the brain of rats after 28 days of BDL will be confirmed. Changes in glutamatergic and GABAergic neural circuits have been implicated in the motor and cognitive impairments in HE patients [6,9,39,40]. In addition, different signaling molecules, especially protein kinases located downstream to the glutamate receptors, may also be affected in HE patients [6,41]. In particular, it has been shown that hyperammonemia decreases PKC-dependent phosphorylation of microtubule-associated proteins [42]. It has been also reported that protein kinase G is involved in ammonia-induced swelling of astrocytes [43]. However, there is no information on gene expression and mRNA levels of different protein kinases in different brain areas of the HE model animals and/or HE patients. The results of the gene expression evaluation in the present study reveal that the Pkcγ and CamKIIα gene expression is increased in the PFC but decreased in the hippocampus of the bile duct ligated rats on day 28 of BDL. To discuss the present results, one may propose that the alteration in the Pkcγ and CamKIIα gene expression can be a consequence of site-specific changes of the glutamate receptor signaling after the increased levels of glutamate in the PFC and hippocampus of the cirrhotic HE model rats. In addition, the present results revealed that the Pkcγ gene expression was decreased, but the CamKIIα gene expression was increased in the cerebellar cortex. A limitation of the present study is the lack of the measurement of protein levels for PKCγ and CaMKIIα. However, according to some previous reports, it has been shown that the gene expression of Pkcγ [44,45] and CamKIIα [18] is in line with their protein levels. There are different reports that PKC and CamKII are involved in cognition and locomotion [18,21,45,46]. Birnbaum and coworkers [46] have reported that excessive PKC activation, as seen during stress exposure, can disrupt prefrontal cortical regulation of behavior and cognition. It has been also reported that the administration of a specific PKC inhibitor completely blocks the ouabain-induced hyperlocomotion [19]. In the present study, the increased level of the Pkcγ gene expression in the PFC may reflect an increase in its production and activation, and as a result, it may have an impairing effect on locomotion and rearing behavior in HE model rats. In addition, a relationship between an increased level and activity of CamKIIα in the hippocampus with hyperlocomotion in morphine-sensitized rats has been reported [21], which support this idea that the decrease in the CamKIIα gene expression in the hippocampus may be associated with the decrease in the locomotion and rearing behavior in the HE model animals. Chronic hyperammonemia has been also shown to increase tonic activation of NMDA receptors in the cerebellum, leading to the activation of CamKII [32]. The results of the gene expression in the cerebellum for Pkcγ was similar to the expression of this gene in the hippocampus but the result for CamKIIα was similar to the PFC. It is possible to hypothesize that glutamate levels due to hyperammonemia do not have similar effects on different areas of the brain, and therefore the subsequent changes in the downstream signaling molecules (such as the Pkcγ and CamKIIα) are site specific. Other investigators have also shown that the NMDA subtype of glutamate receptors and their downstream signaling pathways are necessary for cognitive functions like avoidance learning [47]. In the light of the present results, it can be suggested that molecular changes in Pkcγ and CamKIIα may underlie the cognitive and locomotion impairments observed in the HE model rats. Considering the present results, the memory impairment that has been reported in other studies for HE animal models or patients [6,36,37], may also be a consequence of the changes in the activity of glutamate receptors and the subsequent changes in their downstream signaling molecules such as PKCγ and CamKIIα in the hippocampus.
Fig. 5. The Pkcγ and CamkIIα gene expression in the cerebellar cortex on day 28 of BDL. Each bar represents mean (SD) for the Pkcγ or CamkIIα gene expression data of the specified groups. ++ P < 0.01 and * P < 0.05 compared to the respective sham control group.
that decreases in locomotor activity and impairment of motor coordination are common symptoms of HE [9]. However, the exact mechanisms underlying these disturbances are not well understood. Some investigators propose that hyperammonemia and inflammation have synergistic roles in inducing the neurological alterations in HE [6,32]. It has been also reported that chronic moderate hyperammonemia, similar to that present in the cirrhotic patients, is enough to induce neuroinflammation and neurological alterations in the rats without liver failure [31]. Biochemical analyses in this study also show that the plasma level of ammonia is significantly increased in rats with BDL compared to the sham control group on day 28 of BDL. In addition, the results of the biochemical analyses reveal that in rats with BDL, the serum levels of urea, all types of bilirubin including direct, indirect and total bilirubin, total protein, as well as hepatic enzymes, including ALT, AST, and ALP, are significantly increased compared to the sham control rats on day 28 of BDL. Interestingly, the present results also reveal that the serum levels of albumin, creatinine, and FBS are significantly decreased in rats with BDL on day 28. Taken together, the abnormal increases in the standard laboratory tests of the healthy liver, including the serum level of bilirubin and hepatic enzymes, as well as high plasma level of ammonia in the present study, confirm the liver failure on day 28 of BDL. In addition, the low level of albumin further confirms damage to the normal hepatic functioning. According to the present biochemical results, we suggest that the liver damage leads to the increases in toxins, especially ammonia in the bloodstream, which can also affect the functioning of the other organs especially the brain. The decrease in serum levels of FBS and creatinine may also further support the dysfunctions of the liver, kidney, and muscles on day 28 of BDL. Consistent with the present results, it has been shown that the biochemical changes in the plasma and serum are common results of the BDL [33–35]. The biochemical data of the present experiments confirm the damage to the liver, and subsequently induction of cirrhotic HE on day 28 of BDL. Previously published results from our laboratory also showed that BDL in rats induces hyperammonemia and increases serum level of bilirubin on day 21 of BDL [25]. According to some previous reports, hyperammonemia induced 5
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al.
It has been shown that neuroinflammation increases GABAergic tone and impairs cognitive and motor function in hyperammonemia conditions, which contributes to cognitive and motor impairment in HE [48]. PKC-mediated phosphorylation can be an important physiological regulator of tonic GABAA receptor-mediated inhibition in the hippocampus. In support of this claim, it has been shown that PKC activation causes downregulation of tonic GABAA receptor-mediated inhibition, while the inhibition of PKC results in an increase in tonic GABAA activity [49]. Therefore, we propose that the decrease in the Pkcγ gene expression in the hippocampus and cerebellar cortex of the HE model rats may be followed by an increased in GABAergic tone. Therefore, it is possible that disturbances in other neurotransmitters such as GABA may counterbalance the increases in glutamate levels in different brain areas in HE model rats. However, the exact mechanisms account for specific changes in the Pkcγ and CamKIIα in different brain areas remain to be understood.
neuronal circuits in hepatic encephalopathy, Metab. Brain Dis. 24 (1) (2009) 69–80. [10] O. Cauli, M.T. Mansouri, A. Agusti, V. Felipo, Hyperammonemia increases GABAergic tone in the cerebellum but decreases it in the rat cortex, Gastroenterology 136 (4) (2009) 1359–1367 e1–2. [11] R. Prakash, K.D. Mullen, Mechanisms, diagnosis and management of hepatic encephalopathy, Nat. Rev. Gastroenterol. Hepatol. 7 (9) (2010) 515–525. [12] A. Agusti, M. Llansola, V. Hernandez-Rabaza, A. Cabrera-Pastor, C. Montoliu, V. Felipo, Modulation of GABAA receptors by neurosteroids. A new concept to improve cognitive and motor alterations in hepatic encephalopathy, J. Steroid Biochem. Mol. Biol. 160 (2016) 88–93. [13] D.J. David, J. Wang, B.A. Samuels, Q. Rainer, I. David, A.M. Gardier, R. Hen, Implications of the functional integration of adult-born hippocampal neurons in anxiety-depression disorders, Neuroscientist 16 (5) (2010) 578–591. [14] D.E. Moorman, M.H. James, E.M. McGlinchey, G. Aston-Jones, Differential roles of medial prefrontal subregions in the regulation of drug seeking, Brain Res. 1628 (Pt A) (2015) 130–146. [15] M.G. Kutlu, D.A. Connor, J.M. Tumolo, C. Cann, B. Garret, T.J. Gould, Nicotine modulates contextual fear extinction through changes in ventral hippocampal GABAergic function, Neuropharmacology 141 (2018) 192–200. [16] J. Lisman, H. Schulman, H. Cline, The molecular basis of CaMKII function in synaptic and behavioural memory, Nat. Rev. Neurosci. 3 (3) (2002) 175–190. [17] M. Amadio, F. Battaini, A. Pascale, The different facets of protein kinases C: old and new players in neuronal signal transduction pathways, Pharmacol. Res. 54 (5) (2006) 317–325. [18] Q. Wang, P. Yin, B. Yu, Z. Zhao, G. Richter-Levin, L. Yu, X. Cao, Down-regulation of dorsal striatal alphaCaMKII causes striatum-related cognitive and synaptic disorders, Exp. Neurol. 298 (Pt A) (2017) 112–121. [19] S.S. Valvassori, G.C. Dal-Pont, W.R. Resende, R.B. Varela, B.R. Peterle, F.F. Gava, F.G. Mina, J.H. Cararo, A.F. Carvalho, J. Quevedo, Lithium and tamoxifen modulate behavior and protein kinase C activity in the animal model of mania induced by ouabain, Int. J. Neuropsychopharmacol. 20 (11) (2017) 877–885. [20] C.A. Zarate, H.K. Manji, Protein kinase C inhibitors: rationale for use and potential in the treatment of bipolar disorder, CNS Drugs 23 (7) (2009) 569–582. [21] M. Kadivar, M. Farahmandfar, F.E. Ranjbar, M.R. Zarrindast, Increased calcium/ calmodulin-dependent protein kinase II activity by morphine-sensitization in rat hippocampus, Behav. Brain Res. 267 (2014) 74–82. [22] M.M. Kishiyama, A.P. Yonelinas, R.T. Knight, Novelty enhancements in memory are dependent on lateral prefrontal cortex, J. Neurosci. 29 (25) (2009) 8114–8118. [23] T. Monfil, R.A. Vazquez Roque, I. Camacho-Abrego, H. Tendilla-Beltran, T. Iannitti, I. Meneses-Morales, P. Aguilar-Alonso, G. Flores, J.C. Morales-Medina, Hyper-response to novelty increases c-Fos expression in the Hippocampus and prefrontal cortex in a rat model of schizophrenia, Neurochem. Res. 43 (2) (2018) 441–448. [24] M. Arriaga, E.B. Han, Dedicated hippocampal inhibitory networks for locomotion and immobility, J. Neurosci. 37 (38) (2017) 9222. [25] S. Ahmadi, M. Poureidi, J. Rostamzadeh, Hepatic encephalopathy induces sitespecific changes in gene expression of GluN1 subunit of NMDA receptor in rat brain, Metab. Brain Dis. 30 (4) (2015) 1035–1041. [26] S. Ahmadi, A. Mohammadian Farsani, Z. Karami, F. Khosrobakhsh, J. Rostamzadeh, Increase in nociception threshold and decrease in mu-opioid receptor gene expression in liver of a rat model of hepatic encephalopathy, Shefaye Khatam 3 (1) (2015) 1–10. [27] K. Chiu, W.M. Lau, H.T. Lau, K.F. So, R.C. Chang, Micro-dissection of rat brain for RNA or protein extraction from specific brain region, J. Vis. Exp. 7 (2007) 269. [28] S. Ahmadi, Z. Karami, A. Mohammadian, F. Khosrobakhsh, J. Rostamzadeh, Cholestasis induced antinociception and decreased gene expression of MOR1 in rat brain, Neuroscience 284 (2015) 78–86. [29] J. Cohen, Statistical Power Analysis for the Behavioral Sciences, L. Erlbaum Associates, Hillsdale, N.J, 1988. [30] R.F. Butterworth, M.D. Norenberg, V. Felipo, P. Ferenci, J. Albrecht, A.T. Blei, Experimental models of hepatic encephalopathy: ISHEN guidelines, Liver Int. 29 (6) (2009) 783–788. [31] R. Rodrigo, O. Cauli, U. Gomez-Pinedo, A. Agusti, V. Hernandez-Rabaza, J.M. Garcia-Verdugo, V. Felipo, Hyperammonemia induces neuroinflammation that contributes to cognitive impairment in rats with hepatic encephalopathy, Gastroenterology 139 (2) (2010) 675–684. [32] N. El-Mlili, R. Rodrigo, B. Naghizadeh, O. Cauli, V. Felipo, Chronic hyperammonemia reduces the activity of neuronal nitric oxide synthase in cerebellum by altering its localization and increasing its phosphorylation by calcium-calmodulin kinase II, J. Neurochem. 106 (3) (2008) 1440–1449. [33] R.D. Adler, F.J. Wannagat, R.K. Ockner, Bile secretion in selective biliary obstruction. Adaptation of taurocholate transport maximum to increased secretory load in the rat, Gastroenterology 73 (1) (1977) 129–136. [34] L. Maillette de Buy Wenniger, U. Beuers, Bile salts and cholestasis, Dig. Liver Dis. 42 (6) (2010) 409–418. [35] E.A. Rodriguez-Garay, Cholestasis: human disease and experimental animal models, Ann. Hepatol. 2 (4) (2003) 150–158. [36] O. Cauli, R. Rodrigo, B. Piedrafita, J. Boix, V. Felipo, Inflammation and hepatic encephalopathy: ibuprofen restores learning ability in rats with portacaval shunts, Hepatology 46 (2) (2007) 514–519. [37] P. Monfort, O. Cauli, C. Montoliu, R. Rodrigo, M. Llansola, B. Piedrafita, N. El Mlili, J. Boix, A. Agusti, V. Felipo, Mechanisms of cognitive alterations in hyperammonemia and hepatic encephalopathy: therapeutical implications, Neurochem. Int. 55 (1-3) (2009) 106–112. [38] V. Felipo, R.F. Butterworth, Neurobiology of ammonia, Prog. Neurobiol. 67 (4) (2002) 259–279. [39] T.F. Almeida, S. Roizenblatt, S. Tufik, Afferent pain pathways: a neuroanatomical
5. Conclusion According to the biochemical results of the present study, the bile duct ligation induces liver damage in rats followed by hyperammonemia and possibly neuroinflammation after 28 days. In addition, rats with BDL during a period of 28 days showed continual decreases in locomotor activity and rearing behavior, which reflects neurological and cognitive dysfunctions in rats. The results of the Pkcγ and CamKIIα gene expression in the PFC, hippocampus and cerebellar cortex indicate site-specific disturbances in the gene expression of downstream signaling molecular cascades including the Ca2+-dependent kinases in different brain areas associated with locomotion and cognition. It can be concluded that the Ca2+-dependent kinases have the potential to be the target molecules in controlling neurological disorders in HE. Funding This work was supported by a grant from the Vice-Chancellorship of Research and Technology, University of Kurdistan, Sanandaj, Iran (No. 1395/2016). Ethical approval All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. Conflict of interest The authors declare that they have no conflict of interest. References [1] M.E. Rinella, Nonalcoholic fatty liver disease: a systematic review, JAMA 313 (22) (2015) 2263–2273. [2] A. Adibi, S. Maleki, P. Adibi, R. Etminani, S. Hovsepian, Prevalence of nonalcoholic fatty liver disease and its related metabolic risk factors in Isfahan, Iran, Adv. Biomed. Res. 6 (2017) 47. [3] E.M. Brunt, V.W. Wong, V. Nobili, C.P. Day, S. Sookoian, J.J. Maher, E. Bugianesi, C.B. Sirlin, B.A. Neuschwander-Tetri, M.E. Rinella, Nonalcoholic fatty liver disease, Nat. Rev. Dis. Primers 1 (2015) 15080. [4] M. Naderian, H. Ebrahimi, A.A. Sohrabpour, Prevalence of nonalcoholic fatty liver disease in the middle eastern area: What is the exact estimation? Hepatology 64 (4) (2016) 1390–1391. [5] R.F. Butterworth, The liver-brain axis in liver failure: neuroinflammation and encephalopathy, Nat. Rev. Gastroenterol. Hepatol. 10 (9) (2013) 522–528. [6] V. Felipo, Hepatic encephalopathy: effects of liver failure on brain function, Nat. Rev. Neurosci. 14 (12) (2013) 851–858. [7] S.S.F. Kenston, X. Song, Z. Li, J. Zhao, Mechanistic insight, diagnosis and treatment of ammonia induced hepatic encephalopathy, J. Gastroenterol. Hepatol. 34 (1) (2018) 31–39. [8] C. Acharya, J.S. Bajaj, Current management of hepatic encephalopathy, Am. J. Gastroenterol. 113 (11) (2018) 1600–1612. [9] O. Cauli, R. Rodrigo, M. Llansola, C. Montoliu, P. Monfort, B. Piedrafita, N. El Mlili, J. Boix, A. Agusti, V. Felipo, Glutamatergic and gabaergic neurotransmission and
6
Behavioural Brain Research 372 (2019) 112009
S. Ahmadi, et al. review, Brain Res. 1000 (1-2) (2004) 40–56. [40] L.T. Huang, C.S. Hsieh, M.H. Chou, J.H. Chuang, C.W. Liou, M.M. Tiao, M.C. Lai, Obstructive jaundice in rats: cause of spatial memory deficits with recovery after biliary decompression, World J. Surg. 28 (3) (2004) 283–287. [41] P. Hollos, F. Marchisella, E.T. Coffey, JNK regulation of depression and anxiety, Brain Plast. 3 (2) (2018) 145–155. [42] V. Felipo, E. Grau, M.D. Minana, S. Grisolia, Hyperammonemia decreases proteinkinase-C-dependent phosphorylation of microtubule-associated protein 2 and increases its binding to tubulin, Eur. J. Biochem. 214 (1) (1993) 243–249. [43] H. Mohammad, F. Marchisella, S. Ortega-Martinez, P. Hollos, K. Eerola, E. Komulainen, N. Kulesskaya, E. Freemantle, V. Fagerholm, E. Savontous, H. Rauvala, B.D. Peterson, H. van Praag, E.T. Coffey, JNK1 controls adult hippocampal neurogenesis and imposes cell-autonomous control of anxiety behaviour from the neurogenic niche, Mol. Psychiatry 23 (2) (2018) 362–374. [44] E. Shimobayashi, J.P. Kapfhammer, Increased biological activity of protein Kinase C gamma is not required in Spinocerebellar ataxia 14, Mol. Brain 10 (1) (2017) 34. [45] B. Wu, S. Wang, G. Qin, J. Xie, G. Tan, J. Zhou, L. Chen, Protein kinase C gamma contributes to central sensitization in a rat model of chronic migraine, J. Mol.
Neurosci. 63 (2) (2017) 131–141. [46] S.G. Birnbaum, P.X. Yuan, M. Wang, S. Vijayraghavan, A.K. Bloom, D.J. Davis, K.T. Gobeske, J.D. Sweatt, H.K. Manji, A.F. Arnsten, Protein kinase C overactivity impairs prefrontal cortical regulation of working memory, Science 306 (5697) (2004) 882–884. [47] D.M. Barros, L.A. Izquierdo, T. Mello e Souza, P.G. Ardenghi, P. Pereira, J.H. Medina, I. Izquierdo, Molecular signalling pathways in the cerebral cortex are required for retrieval of one-trial avoidance learning in rats, Behav. Brain Res. 114 (1-2) (2000) 183–192. [48] V. Hernandez-Rabaza, A. Cabrera-Pastor, L. Taoro-Gonzalez, A. Gonzalez-Usano, A. Agusti, T. Balzano, M. Llansola, V. Felipo, Neuroinflammation increases GABAergic tone and impairs cognitive and motor function in hyperammonemia by increasing GAT-3 membrane expression. Reversal by sulforaphane by promoting M2 polarization of microglia, J. Neuroinflammation 13 (1) (2016) 83. [49] D.P. Bright, T.G. Smart, Protein kinase C regulates tonic GABA(A) receptor-mediated inhibition in the hippocampus and thalamus, Eur. J. Neurosci. 38 (10) (2013) 3408–3423.
7