Calcium is involved in exogenous NO-induced enhancement of photosynthesis in cucumber (Cucumis sativus L.) seedlings under low temperature

Scientia Horticulturae xxx (xxxx) xxxx

Contents lists available at ScienceDirect

Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti

Calcium is involved in exogenous NO-induced enhancement of photosynthesis in cucumber (Cucumis sativus L.) seedlings under low temperature Zhengwei Zhanga,b,1, Pei Wua,b,1, Wenbo Zhanga,b,1, Zhifeng Yanga,b, Huiying Liua,b, Golam Jalal Ahammedc, Jinxia Cuia,b,* a

Department of Horticulture, Agricultural College, Shihezi University, Shihezi 832000, Xinjiang, PR China Key Laboratory of Special Fruits and vegetables Cultivation Physiology and Germplasm Resources Utilization of Xinjiang Production and Construction Crops, Shihezi 832000, Xinjiang, PR China c College of Forestry, Henan University of Science and Technology, Luoyang, 471023, PR China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Cucumis sativus Low temperature Nitric oxide Calcium Photosynthesis

The present study explored the role of calcium ion (Ca2+) in nitric oxide (NO)-induced tolerance to low temperature in cucumber (Cucumis sativus L.) seedlings. Low temperature (11 °C/7 °C) induced a raise in NO accumulation and caused significant damages to photosynthetic processes in cucumber leaves, as evidenced by the decreased net photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr), chlorophyll content, maximal photochemical efficiency of photosystem II (PSII) (Fv/Fm), maximal fluorescence (Fm) photochemical quantum yield [Y (II)], relative apparent electron transport rate (ETR), quantum yield of PSII electron transport (Fm/Fo) and latent PSII quantum yield (Fv/F0), and the increased intercellular CO2 concentration (Ci), parameters of quantum yield of regulated energy dissipation [Y (NPQ)], and quantum yield of non-regulated energy dissipation [Y (NO)]. However, exogenous sodium nitroprusside (SNP), a donor of NO, ameliorated the negative effects of low temperature. Furthermore, the content of starch, sucrose, glucose, fructose, soluble sugar and reducing sugar, as well as the transcript levels of subunit of magnesium chelatase (ChlD, ChlI, ChlH), chlorophyll a-b binding protein (Chl), original chlorophyll redox enzymes (POR) and cytochrome b6/f complex (Cytb6f) genes were elevated by the treatment with SNP alone, whereas the inhibition of Ca2+ with EGTA (Ca2+ chelating agent), LaCl3 (Ca2+ channel blocker), TFP and W-7 (calmodulin antagonists) attenuated or almost abolished the aforementioned effects of SNP under low temperature. Taken together, our findings demonstrated that Ca2+ participated in the NO-induced tolerance to low temperature by modulating the leaf gas exchange, processes of PSII, carbohydrate metabolism and expression of chlorophyll synthesis-related genes in cucumber leaves.

1. Introduction Abiotic stress is the first line constraint that obstructs the growth, development, and yield potential of plants. Among various abiotic stresses, low temperature is one of the most important factors limiting

the yield and quality of vegetable crops (Chen et al., 2013; Li et al., 2016; Zhao et al., 2017). Low but non-freezing temperatures (0–15 °C) (Theocharis et al., 2012), affect a range of physiological and biochemical activities in plant system depending on the severity and duration (Karimi and Ershadi, 2015). As a most important physiological

Abbreviations: NO, nitric oxide; SNP, sodium nitroprusside; Ca2+, calcium ion; EGTA, Ca2+ channel blocker; LaCl3, Ca2+ channel blocker; TFP and W-7, calmodulin antagonists; Pn, photosynthetic rate; Gs, stomatal conductance; Tr, transpiration rate; Ci, intercellular CO2 concentration; Fv/Fm, maximal photochemical efficiency of PSII; Fm, maximal fluorescence; Y (II), photochemical quantum yield of PSII; ETR, relative apparent electron transport rate; Fm/Fo, quantum yield of PSII electron transport; Fv/F0, atent PSII quantum yield; Y (NPQ), quantum yield of regulated energy dissipation; Y (NO), quantum yield of non-regulated energy dissipation; Cytb6f, cytochrome b6/f complex gene; Chl, chlorophyll a–b binding protein; ChlD, subunit of magnesium chelatase D; ChlI, subunit of magnesium chelatase I; ChlH, subunit of magnesium chelatase H; POR, original chlorophyll redox enzymes gene; DW, dry weight ⁎ Corresponding author at: Department of Horticulture, Agricultural College, Shihezi University, Shihezi 832000, Xinjiang, PR China. E-mail address: [email protected] (J. Cui). 1 These authors contributed equally to this study. https://doi.org/10.1016/j.scienta.2019.108953 Received 14 May 2019; Received in revised form 17 October 2019; Accepted 18 October 2019 0304-4238/ © 2019 Elsevier B.V. All rights reserved.

Please cite this article as: Zhengwei Zhang, et al., Scientia Horticulturae, https://doi.org/10.1016/j.scienta.2019.108953

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

the production of Ca2+, suggesting that Ca2+ might also function downstream of NO. Likewise, González et al. (2012) observed that a rise in [Ca2+]Cyt was NO-specific and not associated with the decomposition products of SNP, as the NO-scavenger, cPTIO significantly inhibited the observed NO-mediated elevation in [Ca2+]cyt. Thus, it is convincing to speculate that a synergistic action of NO and calcium ultimately contributes to the tolerance of plants to biotic and abiotic stresses by activating the defense mechanisms. Although there have been several reports on the effects of individual application of exogenous SNP or Ca on photosynthesis and oxidative stress, the role of Ca2+ in NO-induced photosynthetic recovery processes under low temperature stress is still ambiguous. Our previous study showed that Ca2+ is involved in exogenous NO-induced increased tolerance to chilling-induced oxidative stress by enhancing the antioxidant defense system (Zhang et al., 2018b). In the present study, we aimed to investigate the effect of exogenous NO on photosynthesis and carbohydrate metabolism under low temperature in cucumber seedlings and we also assessed whether and how Ca2+ might participate in these processes. These results advance our current understanding of the NO signal transduction in cucumber under low temperatures and provide evidence for the mechanism of environmental regulation of photosynthesis in plants.

process in plants, photosynthesis is sensitive to abiotic stress, and the primary target of different abiotic stresses, such as chilling, is the reaction center of photosystem II (PSII) (Ahammed et al., 2018). Chilling causes strong impairments of photosynthetic activity, including chlorophyll loss, inhibition of Rubisco activity, and the degradation of membrane proteins in the photosynthetic apparatus (Ruelland et al., 2009). Under cold conditions, PSII is inhibited and thylakoid electron transport is down-regulated, alongside disturbance in carbon fixation, stomatal conductance and chloroplast morphology (Liu et al., 2012; Zhang et al., 2014). Cucumber is of tropical origin and its all tissues and fruits are sensitive to low temperature (Cabrera et al., 1992). When cucumbers are grown in the unheated solar and plastic greenhouse during winter and early spring or the seedlings are transplanted to the field in spring, chilling is a common episode during the vegetative growth phase (Zhou et al., 2007) Therefore, it is of great significance to study the tolerance mechanism of cucumber so as to take effective measures to alleviate the damage from low temperature in cucumber cultivation. Nitric oxide (NO) is involved in many key physiological processes in plants under normal and stress conditions, including photosynthesis (Procházková et al., 2013), germination (Beligni and Lamattina, 2000), mitochondrial (Zottini et al., 2002) and chloroplast functionality (Susana et al., 2007), senescence (Procházková and Wilhelmová, 2011) and plant adaptation to environmental stress. Chloroplast is not only the site of NO biosynthesis either by nitric oxide reductase (NR) or nitric oxide synthase (NOS)-like protein, but also involved in the posttranslational modifications of proteins by NO that affect the assimilatory processes of photosynthesis (Procházková et al., 2013). Different NO donors, such as sodium nitroprusside (SNP), nitrosoglutathione (GSNO) and S-nitroso acetylpenicillamine (SNAP) produce contradictory effects on chlorophyll fluorescence parameters for leaves under non-stress or stressful environmental conditions (Prochazkova et al., 2013). The effect of NO on photosynthesis depends on the species and concentration of the donor and the species of the crop (Ordog et al., 2013). Wodala et al. (2008) suggested that GSNO is the most suitable to study the effect of NO on photosynthetic electron transport, but Ederli et al. (2009) reported that GSNO can act as a substrate/inhibitor for several enzymes utilizing glutathion, and is not an efficient NO generator in leaf tissue, whereas SNAP produces low NO yields and is able to increase free radical generation. Notably, Vladkova et al. (2011) found that NO donor SNP is the only NO donor that stimulates electron transport through PSII in leaves under non-stress conditions, whereas NO derived from SNP decreases the maximum quantum efficiency (Fv/ Fm), indicating an inhibitory effect of SNP on PSII photochemistry (Ederli et al., 2009; Wodala et al., 2008). In contrast, SNP-treated leaves under stress induced by heat, cold, salt and drought conditions exhibit higher Fv/Fm and enhanced photosynthetic rate and protect the stressinduced damage in PSII when compared with the respective stressed control leaves that are not treated with SNP (Liu et al., 2012; Silveira et al., 2016;). Plants possess a highly conserved signal transduction network, in which calcium (Ca2+) has been proven as one of the key secondary messengers involved in the regulation of plant adaptive responses to multiple environmental stresses (Liese and Romeis, 2013; Simeunovic et al., 2016; Valmonte et al., 2014; Zhu, 2016). Klessing et al. (2000) reported that Ca2+ might participate downstream of NO in plant signal transduction pathways. In addition, Kou et al. (2016) reported that 2% calcium chloride coating could inhibit the activities of sucrose-cleaving enzymes, thus slowing the decrease of sugar content and maintaining high fruit quality during cold storage. In all kinds of stress signal transduction in plants, the changes of NO levels can cause the corresponding changes of cytosolic Ca2+ concentrations and regulate Ca2+ concentration balance by inhibiting or activating Ca2+ influx. The production of NO and the activity of NOS can be regulated by Ca2+/ CaM (Khan et al., 2012). Recently, using the Fluo-3AM, a Ca2+- sensitive fluorescent probe, Liu et al. (2018) found that SNP could induce

2. Materials and methods 2.1. Plant materials Cucumber (Cucumis sativus L. cv. Jinyan NO. 4) seeds were soaked for 20 min at 55 °C and 6 h at room temperature, and then incubated on damp filter paper in dark at 28 °C for 24 h. The germinated seeds were sown in plug trays filled with peat and vermiculite (the ratio of peat to vermiculite by volume was 2:1). When the two cotyledons were fully expanded, the seedlings were transplanted into plastic pots (diameter × height, 120 × 110 mm) containing a mixed substrate of peat and vermiculite in a 2:1 (volume: volume) ratio (with one seedling per container) Thereafter, 250 mL of Hoagland’s nutrient solution was irrigated every four days. The seedlings were allowed to grow in a solar greenhouse at Shihezi University, Xinjiang Uygur Autonomous Region, P.R. China (longitude 86° and latitude 44.18 °N). When the second true leaves were fully expanded, the seedlings were transferred to a PERCIVAL E-36 L plant incubator (Percival, USA). The conditions of the artificial climate incubator were set to 26 °C/14 h during the day, 18 °C/ 10 h at night, light intensity 300 μmol m−2 ∙ s -1, and the relative humidity 75%. The seedlings were pre-cultured for one day before they were used for the subsequent experiments. 2.2. Experimental procedures In the present study, exogenous SNP was used to induce endogenous NO accumulation, whereas cucumber leaves were sprayed with the extracellular free Ca2+ chelating agent EGTA (Sigma, USA), plasma membrane Ca2+ channel blocker LaCl3 (Sigma, USA), vacuolar calmodulin antagonists TFP and W-7 (Sigma, USA) to verify the role of Ca2+ in NO-induced enhanced tolerance to low temperature.. The treatments were classified as presented in Table 1. The spraying operation was performed on the cucumber seedlings for two days, and on the third day at 10:00 am, the seedlings were exposed to low temperature, which was defined as low temperature 0 h. The conditions of low temperature were 11 °C/14 h during the day time, 7 °C/10 h at night, light intensity 300 μmol m−2 ∙ s -1, and the relative humidity 75%. The pots were arranged in a completely randomized design with three replicates per treatment. Leaf gas exchange and chlorophyll fluorescence parameters were measured at 0, 24, and 48 h after low temperature, and leaf samples (the second leaves from the bottom) were harvested accordingly for different analyses. 2

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

2.7. Determination of carbohydrates

Table 1 Description of different treatments. Spraying Time

10:00 18:00

The content of carbohydrates was determined based on the method of Buysse and Merckx (Buysse and Merckx, 1993). The carbohydrate was extracted from 200 mg of dried leaf materials with 50 mL of 80% ethanol in an 85 °C water bath for 30 min. After three centrifugations of the residue of the repeated extraction, the supernatant containing carbohydrate was obtained. The activated carbon was used for adsorbing pigments, and the resulting solution was used to determine the content of reducing sugar and soluble sugar, as well as the sucrose, starch, glucose and fructose. The contents of sugar and starch were determined according to the method of Wang (1999). The method for determination of reducing sugar content was based on 3, 5-dinitrosalicylic acid (DNS). Briefly, 2 ml (the plant extract was diluted 5 times) of leaf extract and 1.5 ml of DNS reagent were mixed in a boiling water bath for 5 min, followed by immediate cooling. Then the absorbance of the solution was measured at 540 nm and reducing sugar content was calculated as follows: Reducing sugar content = A/V1*V2*N/M/1000. (A: sugar content obtained from the regression equation (μg); V1: the volume of plant extract used in the measurement (ml); V2: total volume of plant extract (ml); N: dilution multiple; M: sample weight (g, DW)]. The method of anthrone colorimetry was used for determination of soluble sugar content. 5 ml of an anthrone reagent was added to 1 ml (the plant extract was diluted 10 times) of plant extract, and then the absorbance of the mixture was measured at 625 nm. Soluble sugar content = A/V1*V2*N/M/1000. (A: sugar content obtained from the regression equation (μg); V1: the volume of plant extract used in the measurement (ml); V2: total volume of plant extract (ml); N: dilution multiple; M: sample weight (g, DW)]. The method of resorcinol was used to determine the fructose content. Briefly, 2 ml of 30% hydrochloric acid (HCl), 1 ml of 0.1% resorcinol and 1 ml of distilled water were added to 1 ml of plant extract, and then the mixture was allowed to react in a water bath for 10 min. The absorbance of the mixture was measured at 480 nm. Fructose content = A/V1*V2/M/1000. (A: sugar content obtained from the regression equation (μg); V1: the volume of plant extract used in the measurement (ml); V2: total volume of plant extract (ml); M: sample weight (g, DW)]. The method of resorcinol was also used to determine the sucrose content. 0.2 ml of 2 mol/L Sodium hydroxide (NaOH) was added to 0.4 ml of leaf extract, and then boiled in boiling water for 5 min. After cooling the extract, 2.8 ml of 30% HCl, 0.8 ml of 0.1% resorcinol were added in order, and then incubated for 10 min at 80 °C. The absorbance of mixture was measured at 480 nm. Sucrose content = A/V1*V2/M/ 1000. (A: sugar content obtained from the regression equation (μg); V1: the volume of plant extract used in the measurement (ml); V2: total volume of plant extract (ml); M: sample weight (g, DW)]. O-anisidine-HCl was used to measure the content of glucose. 4 ml of o-anisidine-HCl was added to 2 ml of plant extract at 30 °C, and then incubated for 5 min at 30 °C. When the temperature of the mixture was balanced, 8 ml of 10 mol/L sulfuric acid (H2SO4) was added to terminate the reaction. The absorbance of mixture was measured at 460 nm. Glucose content = A/V1*V2/M/1000. (A: sugar content obtained from the regression equation (μg); V1: the volume of plant extract used in the measurement (ml); V2: total volume of plant extract (ml); M: sample weight (g, DW)]. The residue after plant sugar extraction was used for the detection of starch content. Briefly, 25 ml of 2 % HCl was added to 0.5 g residue and then boiled for 3.5 h in a water bath. 5 mol/L of NaOH was used to neutralize the HCl. Then barium hydroxide (Ba (OH) 2) was added until complete precipitation, and a drop of phenolphthalein indicator was added. Then zinc sulfate (ZnSO4) solution was added while stirring to precipitate the barium salt, and the ZnSO4 was dropped until the red color faded, and then the Ba (OH) 2 was added to restore the reddish color to the termination point. The solution was filtered and diluted to

Treatment CK

S

SE

SL

ST

SW

Distilled water Distilled water

Distilled water SNP

EGTA SNP

LaCl3 SNP

TFP SNP

W-7 SNP

Note: SNP, 200 μmol⋅L−1 sodium nitroprusside (NO donor); EGTA, 5 mmol⋅L−1 egtazic acid (Ca2+ chelating agent); LaCl3, 50 μmol⋅L−1 lanthanum chloride (Ca2+ channel blocker), TFP, 100 μmol⋅L−1 trifluoperazine (calmodulin antagonist); W-7, 300 μmol⋅L−1 N-(6-Aminohexyl)-5-chloro-1-naphthalenesulfonamide (calmodulin antagonist).

2.3. Nitric oxide detection and quantification NO was visualized using 4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate (DAF-FM DA), a probe highly specific to NO, essentially as described by Corpas et al. (2004). Cucumber leaf segments (approximately 20 mm2) were incubated in 10 μmol L−1 diaminofluorescein-FM diacetate (DAF-FM DA, prepared in 10 μmol L−1 TrisHCl, pH 7.4) at 25 °C for 1 h in dark and then washed twice with the same buffer for 15 min each. After washing, the leaf sections were placed on a microscopic slide in Tris-HCl for examination with a confocal laser scanning microscope system (ZEISS LSM 510 META, Germany), using standard filters and collection modalities for DAF-FM DA green fluorescence (excitation 495 nm; emission 515 nm). The fluorescence intensity was quantified with the software AimImage Examiner. Values were corrected for background.

2.4. Determination of leaf gas exchange parameters The gas exchange parameters including net photosynthetic rate (Pn), stomatal conductance (Gs), transpiration rate (Tr) and intercellular CO2 concentration (Ci) in cucumber leaves were measured using a portable photosynthetic system CIRAS-3 (PPSYSTEMS CIRAS-3, USA).

2.5. Measurement of chlorophyll content The concentrations of chlorophylls were measured using a colorimetric method. After 48 h of low temperature treatment, freshly harvested cucumber leaves were cut into 1 cm2 segments (0.2 g), and then soaked in 20 mL of extraction reagent (80% acetone, 95% ethanol) for 8 h in the dark. Afterward, the absorbance of leaf extracts at 663 nm and 645 nm was measured and the concentrations of total chlorophyll, chlorophyll a and chlorophyll b were calculated (Lichtenthaler and Wellburn, 1983). 2.6. Measurement of chlorophyll fluorescence parameters A rang of chlorophyll fluorescence parameters were determined using an Imaging-PAM (IMAG-MINI; Walz, Germany). The leaves used for the measurements of gas exchange were also used for the measurements of chlorophyll fluorescence. After 30 min of dark adaption, the leaves were illuminated under a high saturating light pulse with a frequency of 0.05 Hz for 600 s. Maximum photochemical efficiency (Fv/ Fm), actual photochemical efficiency under light [Y (II)], relative electron transport efficiency (ETR), The quantum yield [Y (NO)] of nonregulated energy dissipation and the quantum yield [Y (NPQ)] of regulated energy dissipation were directly measured (Ahammed et al., 2018). In addition, the electron transfer efficiency (Fm/Fo) = Fm/Fo and the potential activity (Fv/Fo) = Fv/Fo were also calculated by Fm and Fo. 3

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

control temperature conditions (0 h), which was attenuated with the imposition of low temperature stress. However, NO accumulation was always greater in SNP treatment than that in CK before (0 h) and after (6 h and 24 h) the low temperature treatments. As shown in Fig. 1B, compared with CK, SNP treatment significantly increased NO accumulation in cucumber leaves at 0 h, 6 h, and 24 h after low temperature treatment. More precisely, exogenous SNP application increased the levels of NO in cucumber leaves by 288%, 95.6%and 13.7% compared to CK at 0 h, 6 h and 24 h after low temperature treatment, respectively. However, EGTA, LaCl3, TFP and W-7 application decreased the SNPinduced accumulation of NO in cucumber leaves at 0 h and 6 h after stress when compared with only SNP-treated plants (Fig. 1B). Although the treatments with EGTA, LaCl3, TFP and W-7 greatly attenuated the effect of SNP on NO accumulation particularly at 0 h and 6 h of low temperature treatment, their effects were abolished at 24 h post treatment except for W-7.

250 ml, then 2 ml was taken for determination of the glucose content, and the starch content was calculated based on the glucose content. Starch content = glucose content * 0.9. 2.8. Total RNA extraction and gene expression analysis Total RNA was extracted from cucumber leaves using Trizol reagent according to the manufacturer’s instruction. The nucleic acid content was detected by Nanodrop 2000 (Susana et al., 2007) and 2% agarose gel electrophoresis was performed to verify RNA integrity. Residual DNA was removed using DNA I Kit (Thermo Fisher Scientific, USA). The cDNA template for real-time PCR was constructed using a ReverTra Ace RT-qPCR first strand cDNA Synthesis Kit (TOYOBO, Japan). The genespecific primers were designed based on the CDS sequences for the corresponding genes: Cytb6f, Forward 5′- GGCGTCTTCCACTCTATCTTC -3′; and reverse 5′- GTTCGGTCTCCAGGTCCAT -3′; Chl, Forward 5′− CCATGAGGAAGACTGCCAGC AAG -3′ and reverse 5′- CACGGTTCTTG GCGAAGGTCTC -3′; ChlD, Forward 5′- GGTTAC AGAGGACAGGCTCA TTGG -3′ and reverse 5′- GAAGACCAGGCTGGAACACAGTC -3′; ChlI, Forward 5′- ACTGAAGGTGTGAAGGCATTCGAG -3′ and reverse 5′AGAGGCAG CCGAATCCAGTAGG -3′; ChlH, Forward 5′- AAGTTCGTC GTGTAGTTCCT -3′ and reverse 5′- GCGGCTGTGAGTGATGAT -3′; POR, Forward 5′- CTCCATTCCAGAAGTTCATCAC -3′ and reverse 5′- CAAC ACAACATCACAGTTACGA -3′; and Actin, Forward 5′- ATGTGCCTG CTATGTATGTTG -3′ and reverse 5′- GCTCCGATGGTGATGACTT -3′. Quantitative real-time PCR was performed using the iCycler iQ Multicoor Real-time PCR Detection System (Bio-Rad, Hercules, CA, USA). The SYBR Green PCR Master Mix (TOYOBO, Japan) was used for PCRs. Each reaction (20 μl) consisted of 10 μl SYBR Green PCR Master Mix, 2 μl of diluted cDNA template, 0.5 μl of forward and reserve primers, and 7 μl of RNase and DNase-free water. The PCR conditions consisted of denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C 10 s, annealing at 55 °C for 30 s and extension at 72 °C for 1 min. The cucumber actin gene was used as an internal control. To minimize sample variations, mRNA expression of a target gene was normalized relative to the expression of the housekeeping gene actin. The quantification of mRNA levels and relevant gene expression were based on the method of Livak and Schmittgen (2001). All experiments were repeated three times using cDNA prepared from three samples of cucumber leaves.

3.2. Calcium is involved in NO-induced changes in gas exchange parameters As shown in Fig. 2, the exposure of cucumber plants to low temperature resulted in the reduction of Pn, Gs and Tr, and an increase of Ci. Notably, before the imposition of low temperature stress (0 h), exogenous SNP alone significantly increased the Pn and Gs by 16.53% and 19.96%, respectively with no significant influence on Ci and Tr when compared with that of CK. However, compared with SNP treatment alone, pre-treatment with EGTA (SE), LaCl3, TFP (ST) and W-7 significantly reduced the Pn and Gs. When the plants were exposed to low temperature for 24 h and 48 h, exogenous SNP alone significantly increased the Pn by 57.14% and 57.63%, Ci by 19.08% and 11.94%, Gs by 30.14% and 96.26%, and Tr by 33.33% and 41.24%, respectively. Meanwhile, SE, SL, ST and SW treatments (Ca2+ channel blocker and inhibitors) significantly attenuated the SNP-induced elevation in Pn, Gs, Tr and Ci. Thus, Ca2+ appears to be involved in NO-induced enhancement in photosynthesis under low temperature stress in cucumber leaves. 3.3. Calcium is involved in NO-induced changes in chlorophyll content Low temperature reduced the content of chlorophyll a, chlorophyll b and total chlorophyll in cucumber leaves at three sampling dates (P < 0.05) (Fig. 3). SNP treatment significantly increased the content of chlorophyll a, chlorophyll b and total chlorophyll compared with CK under the low temperature treatment. In contrast, the content of chlorophyll a, chlorophyll b and total chlorophyll significantly reduced after pretreatment cucumber leaves with EGTA, LaCl3, TFP and W-7 (Fig. 3).

2.9. Statistical analysis All treatments were replicated at least three times. Data were analyzed by one-way analysis of variance (ANOVA) and Duncan multiple comparisons using SPSS version 19.0 (SPSS Inc., Chicago, IL, USA), whereas the Tukey test (HSD) was used for correlation analysis. Difference at P < 0.05 were considered significant. Data were expressed as the mean ± standard deviation (SD) of three replicates.

3.4. Ca2+ is involved in NO-induced stress tolerance To determine whether Ca2+ plays a critical role in NO-induced stress tolerance, we analyzed the effect of EGTA, LaCl3, TFP and W-7 on NO-induced tolerance to low temperature. Low temperature causes photo-oxidative stress, which can be assessed by the damage to photosynthetic apparatus. As shown in Fig. 4B and C, there were no significant differences in Fv/Fm and Fm of each treatment before the imposition of low temperature treatment. However, following the low temperature treatment, both Fv/Fm and Fm showed downward trend throughout the treatment period. Compared with CK, SNP treatment alone significantly increased the value of Fv/Fm after 24 h and 48 h and the values Fm after 48 h of low temperature treatment. However, the pre-treatments with EGTA, LaCl3, TFP or W-7 almost offset the positive effects of SNP on plant tolerance to low temperature stress as evidenced by the reduced Fv/Fm values. In Fig. 4A, Fv/Fm and Fm were shown in false color code-based images. Under low temperature, leaf colors shifted from the blue to green representing a reduction in the Fv/Fm ratio and the value of Fm. The images showed a trend that was

3. Results 3.1. Effects of Ca2+ levels on NO accumulation To understand the role of Ca2+ in NO accumulation and subsequent low temperature tolerance, we pre-treated cucumber leaves with the extracellular free Ca2+ chelating agent EGTA, plasma membrane Ca2+ channel blocker LaCl3, vacuolar calmodulin antagonists TFP and W-7. The NO signal was determined by the cell-permeable fluorescent probe DAF-FM DA coupled with a confocal laser-scanning microscope. As shown in Fig. 1A and B, with the prolongation of low temperature stress, the NO content in the cucumber leaves increased 3-fold (except for SNP treatment), and the NO content in the leaves of cucumber seedlings was basically the same under different treatments at 24 h after the imposition of low temperature. We found that exogenous SNP treatment drastically increased NO accumulation in leaves under 4

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

Fig. 1. NO accumulation in cucumber leaves as influenced by low temperature, NO donor and Ca removal. The seedling were treated with distilled water (CK), 200 μmol L−1 SNP (S), 5 mmol ∙ L−1 EGTA + 200 μmol L−1 SNP (SE), 50 μmol L−1 LaCl3 + 200 μmol L−1 SNP (SL), 100 μmol L−1 TFP + 200 μmol L−1 SNP (ST), 300 μmol L−1 W-7 + 200 μmol ∙ L−1 SNP (SW) for two days as described in Table 1. On the third day at 10:00 am, the seedlings were exposed to low temperature (11 °C/14 h during the day time and 7 °C/10 h at night), which was defined as low temperature 0 h. Leaf segments of the second leaves were loaded with diaminofluorescein-FM diacetate (DAF-FM DA) and NO accumulation was detected by confocal laser scanning microscope system. (A) Fluorescence imaging of DAFFM DA-loaded leaves. (B) Average fluorescence intensity. Means denoted by the same letters did not significantly differ at P < 0.05 according to Duncan’s test.

consistent with the values, suggesting that Ca2+ is necessary for the NO-induced low temperature tolerance.

CK, application of SNP alone exerted positive effects on the content of carbohydrates in cucumber seedlings under low temperature. SNP significantly increased the content of starch by 43.3% and 35.9%, sucrose by 8.4% and 54.1%, glucose by 25.3% and 19.5%, fructose by 35.9% and 55.5%, soluble total sugar by 24.1% and 32.7%, reducing sugar by 34.6% and 25.4% after low temperature treatment 24 h and 48 h, respectively (Fig. 6). However, compared with SNP alone, pre-treatments with EGTA, LaCl3, TFP and W-7 significantly decreased the content of carbohydrates.

3.5. Calcium is involved in NO-induced changes in chlorophyll fluorescence parameters As shown in Fig. 5, there were no significant differences in the parameters of photochemical efficiency and electron transport rate in each treatment before the exposure of cucumber plants to low temperature. Compared with CK, exogenous SNP alone significantly increased Y (II), Y (NPQ), ETR, Fv/Fo, and Fm/Fo, while the value of Y (NO) was significantly reduced when the plants were exposed to low temperature. However, the values of Y (II), Y (NPQ), ETR, Fv/Fo, and Fm/Fo were significantly decreased, and the Y (NO) value was increased significantly by the treatments with SE, SL, ST and SW when compared with SNP treatment alone. The results suggested that NOinduced enhancements in the photosynthetic activity and electron transport were inhibited by the absence of calcium, and that Ca2+ played a vital role in NO-mediated low temperature tolerance in cucumber.

3.7. Ca2+ is involved in NO-induced changes in the transcript levels of photosynthesis-related genes To determine whether Ca2+ is involved in the regulation of photosynthesis-related genes as influenced by SNP treatment under low temperature, we examined the effects of Ca2+ chelating agent (EGTA), calcium channel blocker (LaCl3) or calmodulin antagonist (TFP and W7) on the transcripts of the magnesium chelatase subunit (Fig. 7D–F), chlorophyll a-b binding protein (Fig. 7B) and original chlorophyll redox enzymes (Fig. 7C), and cytochrome b6/f complex gene (Fig. 7A). Compared with the CK, SNP treatment significantly up-regulated the transcript levels of Cytb6f, ChlD, ChlI, ChlH, Chl and POR genes after 24 and 48 h of low temperature treatment (P < 0.05). The highest expression levels of Cytb6f, ChlD, ChlI, ChlH, Chl and POR in cucumber leaves in SNP treatment were 1.65, 1.68, 2.9, 1.64, 3.24, 2.37 fold greater than in the corresponding CK. In contrast, cucumber leaves that were pre-treated with EGTA, LaCl3, TFP and W-7 down-regulated the

3.6. Ca2+ is critical for NO-induced increase in the carbohydrates Carbohydrates are the primary products of photosynthesis, thus the accumulation of carbohydrates is linked to the photosynthesis of a plant. Therefore, we analyzed the effects of Ca2+ on NO-induced accumulation of carbohydrate under low temperature. Compared with 5

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

Fig. 2. Effect of NO and Ca2+ levels on gas exchange parameters under low temperature in cucumber leaves. Value of net photosynthetic rate (Pn, A), intercellular CO2 concentration (Ci, B), transpiration rate (Tr, C), and stomatal conductance (Gs, D) in coldstressed cucumber seedlings as affected by exogenous distilled water (CK), 200 μmol L−1 SNP (S), 5 mmol ∙ L−1 EGTA + 200 μmol L−1 SNP (SE), 50 μmol L−1 LaCl3 + 200 μmol L−1 SNP (SL), 100 μmol L−1 TFP + 200 μmol L−1 SNP (ST), 300 μmol L−1 W-7 + 200 μmol ∙ L−1 SNP (SW). Error bars represent SD value (n = 3). Different letters indicate the significant differences at same sampling data among the treatments (P < 0.05).

transcript levels of Cytb6f, ChlD, ChlI, ChlH, Chl and POR after 24 and 48 h of low temperature treatment (Fig. 7).

of starch and sucrose; whereas the content of fructose was positively correlated with the content of soluble sugar (P < 0.05).

3.8. Relationships between photochemical parameters and carbohydrates

4. Discussion

Correlations between photochemical parameters and carbohydrates in cucumber leaves at 24 h of low temperature were presented in Table 1. Y (II) and ETR were significantly positively correlated with the content of glucose (P < 0.01), sucrose and fructose (P < 0.05), and Y (II) was also positively correlated with ETR (P < 0.05) (Table 1). However, Y (NO) was negatively correlated with the content of sucrose, reducing sugar and the value of Fv/Fo, Y (II) and ETR (P < 0.05). Besides, profound correlations were found between Fv/Fm and Fm, Fv/ Fm and Fm/Fo or Fm and Fm/Fo at P < 0.01. The Fm/Fo was positively correlated with Fv/Fo and sucrose content, whereas the Fv/Fo was correlated with reducing sugar content (P < 0.05). In addition, the content of reducing sugar was positively correlated with the content

NO plays an important role in plant acclimation to abiotic stresses (Fancy et al., 2016), however, the optimal production of NO under cold varies with temperature threshold and plant species (Puyaubert and Baudouin, 2014). Proteomic evidence suggests a cross-talk between cold and NO signaling, in which around 30% of the cold responsive signaling-related proteins are modified post-translationally by NO (Sehrawat et al., 2013). Cold-evoked NO might also cope with the deleterious effects associated with photoinhibition. Recent data also suggest that NO is an important signal for transducing information under low temperatures (Puyaubert and Baudouin, 2014). In the present study, we used the DAF-FM DA, a NO molecular probe, combined with laser confocal microscopy to observe the accumulation of NO in

Fig. 3. Involvement of Ca2+ in NO-induced change in chlorophyll content in cucumber leaves under low temperature. Plants were subjected to different treatments as described in the Material and Methods (Table 1). Data are the means of three replicates ( ± SD). Values denoted by the same letters did not significantly differ at P < 0.05. 6

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

Fig. 4. Ca2+ is involved in NO-induced tolerance to low temperature. (A) Images of the fluorescence parameter Fv/Fm and Fm under different treatments in cucumber leaves. Leaves were pre-treated with distilled water (CK), 200 μmol L−1 SNP (S), 5 mmol ∙ L−1 EGTA + 200 μmol L−1 SNP (SE), 50 μmol L−1 LaCl3 + 200 μmol L−1 SNP (SL), 100 μmol L−1 TFP + 200 μmol L−1 SNP (ST), 300 μmol L−1 W-7 + 200 μmol ∙ L−1 SNP (SW). The chlorophyll fluorescence images were determined with Imaging PAM (IMAG-MINI; Heinz Walz). (B) and (C) showed the average values of Fv/ Fm and Fm, respectively in the partial leaves. Values are means ± SD (n = 3). Means denoted by the same letter did not significantly differ at P < 0.05.

production of NO. In the present study, we found that pre-treatment of cucumber leaves with Ca2+ chelating agent (EGTA), calcium channel blocker (LaCl3) or calmodulin antagonist (TFP and W-7) along with SNP completely blocked the SNP-induced elevation in NO levels under cold (Fig. 1), suggesting that exogenous SNP-induced NO production under low temperature is dependent on Ca2+ levels in cucumber leaves. Photosynthetic activity is strongly impaired at low temperature (Ruelland et al., 2009). A decrease in photosynthesis in plants subjected to a stressful environment, including cold stress, is often associated with a reduction in the photosynthetic capacity (Hu et al., 2014). Previous studies found that high concentrations of NO inhibited net photosynthetic rate in the leaves of Avena sativa and Mediaago sativa (Hill and Bennett, 1970). However, Tan et al. (2008) reported that exogenous SNP could ameliorate the decline in net photosynthetic rate and chlorophyll content under freezing conditions. Cold stress affects the photosynthetic efficiency through both stomatal limitation (Meloni et al., 2003) and non-stomatal limitation (Mittal et al., 2012). When the decreases in Pn and Ci are accompanied by a decrease in Gs, the reduction in Pn can mainly be attributed to the stomatal limitations,

cucumber leaves. The results showed that NO accumulation in cucumber leaves increased with the prolongation of low temperature treatment (Fig. 1). In addition, cucumber leaves pre-treated with SNP showed an increased accumulation of NO both after 6 h and 24 h of low temperature treatment, which was consistent with the study of Dong et al. (2018). Previous studies have shown that NO is involved in the mobilization of intracellular Ca2+, whereas the Ca2+ channel has been suggested as a potential target of NO (Garcia-Mata and Lamattina, 2007). It is possible that NO and Ca2+, as plant signaling regulators, may work together in response to abiotic stresses (Niu et al., 2017; Silveira et al., 2017). A recent study suggests that NO is involved in the elevation of cytosolic Ca2+ in response to cold stress (Lv et al., 2018). In addition, SNP and Ca2+ improve the synthesis of the photosynthetic pigments and suppress the degradation of Chl in tomato under heat stress (Siddiqui et al., 2017). Apart from this, [Ca2+] Cyt induces NO production in plants via calcium-dependent proteins kinase and functions to elevate and/or maintain NO generation (Lv et al., 2018). Therefore, we hypothesized that Ca2+ inhibitor and CaM antagonist could reduce intracellular Ca2+/CaM level, thereby affecting the 7

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

Fig. 5. The values of Y (II) (A), Y (NPQ) (B), Y (NO) (C), ETR (D), Fv/Fo (E), Fm/Fo (F) in low temperature-stressed cucumber seedlings subjected to various treatments. Values are the means ± SD (n = 3). Values with different letters within the same sampling date are significantly different (P < 0.05).

8

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

Fig. 6. Effects of Ca2+ in NO-induced carbohydrates accumulation under low temperature in cucumber leaves. Starch (A), sucrose (B), glucose (C), fructose (D), soluble sugar (E), and reducing sugar (F) content in cold-stressed cucumber seedlings subjected to various treatments. Values are the means ± SD (n = 3). Values with different letters within the same sampling date are significantly different (P < 0.05).

9

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

Fig. 7. Involvement of Ca2+ in NO-induced expression of magnesium chelatase and chlorophyll genes in cucumber leaves under low temperature. Plants were subjected to different treatments as described earlier. Data are the means of three replicates ( ± SD). Values denoted by the same letters did not significantly differ at P < 0.05.

photosynthesis (photochemistry), while excess energy is dissipated as heat (dissipation), and a part of the absorbed light energy is re-emitted as light-chlorophyll fluorescence (non-photochemistry) (Johnson and Maxwell, 2000). In our experiment, exogenous SNP significantly prevented the reduction of gas-exchange parameters (Pn, Ci, Gs, Tr), chlorophyll fluorescence parameters (Fv/Fm, Fm, Y (II), Y (NPQ), ETR, Fv/Fo, Fm/Fo), content of chlorophyll, and the expression levels of photosynthesis-related genes (ChlD, Chl, Chll, ChlH, POR and Cytb6f) and obviously alleviated chlorophyll fluorescence parameter Y (NO) induced by chilling stress in cucumber seedlings. In contrast, pretreatment of EGTA plus SNP, LaCl3 plus SNP, TFP plus SNP and W-7 plus SNP on cucumber seedlings almost completely abolished the positive effects of SNP on plant tolerance to low temperature (Figs. 2–4, 5

whereas in the other circumstances a decrease in Pn can be caused by non-stomatal factors, that is, the decrease in photosynthetic activity of mesophyll cells. As predicted, we found that SNP induced an increase of Pn, Ci and Gs during the whole low temperature treatment (Fig. 2A, B and D). Therefore, stomatal limitation on photosynthesis might occur in our experiment (Fig. 2A, B and D). Photosystem II is often considered as the most cold-sensitive component of the photosynthetic apparatus. Evidently, a chilling-resistant photosystem II would be helpful for enhancing the chilling tolerance in plants (Wang et al., 2016a, b). Chlorophyll fluorescence analysis is one of the most powerful and widespread techniques to study the status of photosynthetic apparatus. Light energy absorbed by chlorophyll molecules in leaves is of three fates, a part of the energy drives 10

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

and 7). Taken together, these findings suggest that Ca2+ participated in the NO-enhanced photosynthesis by alleviating the inhibition of PSII potential active center, photochemical efficiency and photosynthetic electron transfer caused by low temperature and increasing the transcript levels of chlorophyll synthesis-related enzyme genes in cucumber seedlings. In conformity with the earlier studies on other plant species including lily flowers (Zhang et al., 2018a), cucumber (Niu et al., 2017), tobacco (Lamotte et al., 2005), Arabidopsis (Abdul-Awal et al., 2016), grape (Vandelle et al., 2006), tall fescue (Xu et al., 2016), marigold (Liao et al., 2012), tomato (Siddiqui et al., 2017), wheat (Tian et al., 2015), our results suggest an intricate interplay between NO and Ca2+ during cold stress. When plants are exposed to a cold, a number of physiological and metabolic processes are impaired. Previous studies have shown that sugar accumulation is an important strategy utilized by plants for adaptation to cold stress (Karimi and Ershadi, 2015; Theocharis et al., 2012). In plants, sucrose, fructose and glucose are the major soluble sugars that accumulate during cold acclimation (Wanner and Junttila, 1999), and a higher level of fructose and glucose corresponds to an increased chilling tolerance (Shao et al., 2013). These soluble carbohydrates are compatible compounds which play an important role in protecting cell structures under low temperature stress. An earlier study also reported that grape fruits with a high content of reducing sugar (including glucose and fructose) showed an increased chilling tolerance (Purvis and Grierson, 1982). The initial products of photosynthesis in plants are the temporary starch synthesized in chloroplast and the sucrose synthesized in cytoplasmic matrix. Temporary starch can be converted to sucrose at night then transported to storage organs or utilized for biological activities. Our present results showed that the enhancement of chilling tolerance in NO-treated cucumber seedlings was accompanied with increases of starch, sucrose, glucose, fructose, soluble total sugar and reducing sugar under chilling stress (Fig. 6). However, EGTA, LaCl3, TFP and W-7 diminished the positive effect of SNP. These results also suggest that the effect of NO on enhancing chilling tolerance in cucumber seedlings may be attributed to the higher levels of carbohydrates, and Ca2+ potentially participated in this process. In the present study, a close relationship between fluorescence parameters and carbohydrates content was found Table 2. Hajihashemil et al. (2018) demonstrated that the efficiency of PSII was correlated to the carbohydrates in Stevia rebaudiana under chilling stress. Recently, another study reported that exogenous glucose could enhance the level of carbohydrate, chlorophyll content, as well as gas exchange parameters (Sami and Hayat, 2019). As expected, in our study, the higher PSII actual photochemical efficiency Y (II) corresponds to the higher

content of glucose, sucrose and fructose. This is probably because of the increased PSII activity, which provides more reductive power for the production of carbohydrate. Since a close relationship between soluble carbohydrate accumulation and cold tolerance is well established, the higher levels of carbohydrates signify an enhanced tolerance to low temperature in SNP-treated cucumber plants (Table 2). In addition, correlation analysis also revealed that the Y (NO) was negatively correlated with the content of carbohydrates, which attributed to the significantly negative correlation with sucrose and reducing sugar. In conclusion, the role of Ca2+ on NO-induced chilling tolerance in cucumber seedlings was emphasized in this study. Under low temperature, NO enhances the photosynthetic efficiency by increasing the electron transfer efficiency, alleviating the inhibition of PSII potential active center, and increasing the transcription levels of chlorophyllsynthesis-related enzyme genes and chlorophyll content. In addition, when cucumber seedlings were exposed to low temperature, the concentrations of carbohydrates were also increased by the application of exogenous SNP, a donor of NO. However, the effects of SNP on these indexes were largely abolished by EGTA, LaCl3, TFP and W-7. These results strongly suggest that Ca2+ is involved in the NO-induced regulation of photosynthesis and carbohydrate metabolism and the Ca2+ may participate in the downstream of NO under chilling stress in cucumber plants. Therefore, depending on the weather forecast, prior application of SNP can be an effective approach to improve the chilling tolerance of cucumber plants by modulating the endogenous levels of Ca2+. Author’s contributions This work was carried out in collaboration between all the authors. Jinxia Cui and Zhengwei Zhang defined the research theme and designed the experiment. Zhengwei Zhang and Pei Wu worked for the formal data analysis. Wenbo Zhang and Zhifeng Yang co-worked for the formal data analysis. Jinxia Cui and Pei Wu wrote the original draft. Jinxia Cui, Golam Jalal Ahammed and Huiying Liu reviewed and edited the manuscript. All authors have contributed to, seen, and approved the final manuscript. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. The authors declare the following financial interests/personal relationships which may be considered as potential competing interests.

Table 2 Correlation between photochemical parameters and carbohydrates in cucumber leaves at 24 h of low temperature treatment.

Fv/Fm Fm Fm/Fo Fv/Fo Y (II) Y (NPQ) Y (NO) ETR Sta Suc Glu Fru SS RS

Fv/Fm

Fm

Fm/Fo

Fv/Fo

Y (II)

Y (NPQ)

Y (NO)

ETR

Sta

Suc

Glu

Fru

SS

RS

1 0.972** 0.967** 0.806 0.544 −0.363 −0.728 0.530 0.438 0.670 0.207 0.601 0.699 0.754

1 0.991** 0.805 0.491 −0.353 −0.719 0.476 0.290 0.562 0.127 0.568 0.645 0.670

1 0.823* 0.578 −0.282 −0.770 0.566 0.342 0.633 0.233 0.662 0.730 0.728

1 0.558 −0.594 −0.825* 0.561 0.695 0.807 0.330 0.755 0.793 0.889*

1 −0.012 −0.901* 0.999* 0.576 0.786 0.923** 0.918** 0.783 0.783

1 0.373 −0.003 −0.421 −0.251 0.118 −0.76 −0.038 −0.358

1 −0.896* −0.612 −0.806 −0.719 −0.903* −0.790 −0.867*

1 0.593 0.799 0.931 ** 0.928** 0.796 0.791

1 0.912* 0.597 0.708 0.741 0.877*

1 0.704 0.907* 0.941** 0.985**

1 0.828* 0.658 0.648

1 0.943** 0.908*

1 0.933*

1

Sta, Suc, Glu, Fru, SS and RS represent starch, sucrose, glucose, fructose, soluble total sugar and reducing sugar respectively. * Indicates statistical difference significance at P < 0.05 among the treatments by Tukey’s (HSD) multiple range tests. ** Indicates statistical difference significance at P < 0.01 among the treatments by Tukey’s (HSD) multiple range tests. 11

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

Acknowledgment

exogenous application of oxalic acid. Food Chem. 202, 125–132. Liao, W.B., Zhang, M.L., Huang, G.B., Yu, J.H., 2012. Ca2+ and CaM are involved in NOand H2 O2 -induced adventitious root development in Marigold. J. Plant Growth Regul. 31, 253–264. https://doi.org/10.1007/s00344-011-9235-7. Lichtenthaler, H.K., Wellburn, A.R., 1983. Determinations of total carotenoids and chlorophylls a and b of leaf extracts in different solvents. Biochem. Soc. Trans. 11, 591–592. Liese, A., Romeis, T., 2013. Biochemical regulation of in vivo function of plant calciumdependent protein kinases (CDPK). Biochimica et Biophys. Acta-Mol. Basis dis. 1833, 1582–1589. https://doi.org/10.1016/j.bbamcr.2012.10.024. Liu, R., Shi, L., Zhu, T., Yang, T., Ren, A., Zhu, J., Zhao, M.W., 2018. Cross talk between nitric oxide and calcium-calmodulin regulates ganoderic acid biosynthesis in ganoderma lucidum under heat stress. Appl. Environ. Microbiol. 84. https://doi.org/10. 1128/AEM.00043-18. Liu, Y.F., Qi, M.F., Li, T.L., 2012. Photosynthesis, photoinhibition, and antioxidant system in tomato leaves stressed by low night temperature and their subsequent recovery. Plant Sci. 196, 8–17. https://doi.org/10.1016/j.plantsci.2012.07.005. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔT method. Methods 25, 402–408. https://doi. org/10.1006/meth.2001.1262. Lv, X.Z., Li, H.Z., Chen, X.X., Xiang, X., Guo, Z.X., Yu, J., Yu, J.Q., Zhou, Y.H., 2018. The Role of calcium-dependent protein kinase in hydrogen peroxide, nitric oxide and ABA-dependent cold acclimation. J. Exp. Bot. 69, 4127–4139. https://doi.org/10. 1093/jxb/ery212. Meloni, D.A., Oliva, M.A., Martinez, C.A., Cambrain, J., 2003. Photosynthesis and activity of superoxide dismutase, peroxidase and glutathione reductase in cotton under salt stress. Environ. Exp. Bot. 49, 69–76. https://doi.org/10.1016/S0098-8472(02) 00058-8. Mittal, S., Kumari, N., Sharma, V., 2012. Differential response of salt stress on Brassica juncea: photosynthetic performance, pigment, proline, D1 and antioxidant enzymes. Plant Physiol. Biochem. 54, 17–26. https://doi.org/10.1016/j.plaphy.2012.02.003. Niu, L.J., Yu, J., Liao, W.B., Yu, J.H., Zhang, M.L., Dawuda, M.M., 2017. Calcium and calmodulin are involved in nitric oxide-induced adventitious rooting of cucumber under simulated osmotic stress. Front. Plant Sci. 8, 14. https://doi.org/10.3389/fpls. 2017.01684. Ordog, A., Wodala, B., Rozsavolgyi, T., Tari, I., Horvath, F., 2013. Regulation of guard cell photosynthetic electron transport by nitric oxide. J. Exp. Bot. 64, 1357–1366. https://doi.org/10.1093/jxb/ers397. Procházková, D., Haisel, D., Wilhelmová, N., Pavlíková, D., Száková, J., 2013. Effects of exogenous nitric oxide on photosynthesis. Photosynthetica 51, 483–489. https://doi. org/10.1007/s11099-013-0053-y. Procházková, D., Wilhelmová, N.A., 2011. Nitric oxide, reactive nitrogen species and associated enzymes during plant senescence. Nitric Oxide Biol. Chem. 24, 61–65. https://doi.org/10.1016/j.niox.2011.01.005. Purvis, A.C., Grierson, W., 1982. Accumulation of reducing sugar and resistance of grapefruit peel to chilling injury as related to winter temperatures. J. Am. Soc. Horticult. Sci. 107, 139–142. Puyaubert, J., Baudouin, E., 2014. New clues for a cold case: nitric oxide response to low temperature. Plant Cell Environ. 37, 2623–2630. https://doi.org/10.1111/pce. 12329. Ruelland, E., Vaultier, M.-N., Zachowski, A., Hurry, V., 2009. Cold Signalling and cold acclimation in plants. Adv. Bot. Res. 49, 35–150. https://doi.org/10.1016/s00652296(08)00602-2. Sami, F., Hayat, S., 2019. Effect of glucose on the morpho-physiology, photosynthetic efficiency, antioxidant system, and carbohydrate metabolism in Brassica juncea. Protoplasma 256, 213–226. https://doi.org/10.1007/s00709-018-1291-4. Sehrawat, A., Gupta, R., Deswal, R., 2013. Nitric oxide-cold stress signalling cross-talk, evolution of a novel regulatory mechanism. Proteomics 13, 1816–1835. https://doi. org/10.1002/pmic.201200445. Shao, X., Zhu, Y., Cao, S., Wang, H., Song, Y., 2013. Soluble sugar content and metabolism as related to the heat-induced chilling tolerance of loquat fruit during cold storage. Food Bioprocess. Technol. 6, 3490–3498. https://doi.org/10.1007/s11947-0121011-6. Siddiqui, M.H., Alamri, S.A., Al-Khaishany, M.Y.Y., Al-Qutami, M.A., Ali, H.M., Khan, M.N., 2017. Nitric oxide and calcium induced physiobiochemical changes in tomato (Solanum Lycopersicum) plant under heat stress. Fresenius Environ. Bull. 26, 1663–1672. Silveira, N.M., Hancock, J.T., Frungillo, L., Siasou, E., Marcos, F.C.C., Salgado, I., Machado, E.C., Ribeiro, R.V., 2017. Evidence towards the involvement of nitric oxide in drought tolerance of sugarcane. Plant Physiol. Biochem. 115, 354–359. https:// doi.org/10.1016/j.plaphy.2017.04.011. Silveira, N.M., Frungillo, L., Marcos, F.C.C., Pelegrino, M.T., Miranda, M.T., Seabra, A.B., Salgado, I., Machado, E.C., Ribeiro, R.V., 2016. Exogenous nitric oxide improves sugarcane growth and photosynthesis under water deficit. Planta 244, 181–190. https://doi.org/10.1007/s00425-016-2501-y. Simeunovic, A., Mair, A., Wurzinger, B., Teige, M., 2016. Know where your clients are: subcellular localization and targets of calcium-dependent protein kinases. J. Exp. Bot. 67, 3855–3872. https://doi.org/10.1093/jxb/erw157. Susana, P., Sebastián, J., Marcela, S., 2007. Reactive nitrogen species-dependent effects on soybean chloroplasts. Plant Signal. Behav. 2, 96–98. https://doi.org/10.4161/psb. 2.2.3727. Tan, J.F., Zhao, H.J., Hong, J.P., Han, Y.L., Li, H., Zhao, W.C., 2008. Effects of exogenous nitric oxide on photosynthesis, antioxidant capacity and proline accumulation in wheat seedlings subjected to osmotic stress. World J. Agric. Sci. 4, 307–313. Theocharis, A., Clement, C., Barka, E.A., 2012. Physiological and molecular changes in plants at low temperatures. Planta 235, 1091–1105. https://doi.org/10.1007/

We are grateful to the National Natural Science Foundation of China, China (No. 31160404) for providing financial support to our research. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.scienta.2019.108953. References Abdul-Awal, S.M., Hotta, C.T., Davey, M.P., Dodd, A.N., Smith, A.G., Webb, A.A.R., 2016. NO-mediated [Ca2+]cyt increases depend on ADP-ribosyl cyclase activity in Arabidopsis. Plant Physiol. 171, 623–631. https://doi.org/10.1104/pp.15.01965. Ahammed, G.J., Xu, W., Liu, A., Chen, S., 2018. COMT1 silencing aggravates heat stressinduced reduction in photosynthesis by decreasing chlorophyll content, photosystem II activity, and electron transport efficiency in tomato. Front. Plant Sci. 9, 998. https://doi.org/10.3389/fpls.2018.00998. Beligni, M.V., Lamattina, L., 2000. Nitric oxide stimulates seed germination and deetiolation, and inhibits hypocotyl elongation, three light-inducible responses in plants. Planta 210, 215–221. https://doi.org/10.1007/PL00008128. Buysse, J., Merckx, R., 1993. An improved colorimetric method to quantify sugar content of plant tissue. J. Exp. Bot. 44, 1627–1629. https://doi.org/10.1093/jxb/44.10.1627. Cabrera, R.M., Saltveit, M.E., Owens, K., 1992. Cucumber cultivars differ in their response to chilling temperatures. J. Am. Soc. Hortic. Sci. 117, 802–807. Garcia-Mata, C., Lamattina, L., 2007. Abscisic acid (ABA) inhibits light-induced stomatal opening through calcium- and nitric oxide-mediated signaling pathways. Nitric Oxide 17, 143–151. https://doi.org/10.1016/j.niox.2007.08.001. Chen, S., Jin, W., Liu, A., Zhang, S., Liu, D., Wang, F., Lin, X., He, C., 2013. Arbuscular mycorrhizal fungi (AMF) increase growth and secondary metabolism in cucumber subjected to low temperature stress. Sci. Hortic. 160, 222–229. Corpas, F.J., Barroso, J.B., Alfonso, C., Miguel, Q., León, A.M., Romero-Puertas, M.C., Esteban, F.J., Raquel, V., Palma, J.M., Sandalio, L.M., 2004. Cellular and subcellular localization of endogenous nitric oxide in young and senescent pea plants. Plant Physiol. 136, 2722–2733. https://doi.org/10.1104/pp.104.042812. Dong, N., Li, Y., Qi, J., Chen, Y., Hao, Y., 2018. Nitric oxide synthase-dependent nitric oxide production enhances chilling tolerance of walnut shoots in vitro via involvement chlorophyll fluorescence and other physiological parameter levels. Sci. Hortic. 230, 68–77. https://doi.org/10.1016/j.scienta.2017.11.016. Ederli, L., Reale, L., Madeo, L., Ferranti, F., Gehring, C., Fornaciari, M., Romano, B., Pasqualini, S., 2009. NO release by nitric oxide donors in vitro and in planta. Plant Physiol. Biochem. 47, 42–48. https://doi.org/10.1016/j.plaphy.2008.09.008. Fancy, N.N., Bahlmann, A.K., Loake, G.J., 2016. Nitric oxide function in plant abiotic stress. Plant Cell Environ. 40, 462–472. https://doi.org/10.1111/pce.12707. González, A., de los Ángeles Cabrera, M., Josefa Henríquez, M., Contreras, R.A., Morales, B., Moenne, A., 2012. Cross talk among calcium, hydrogen peroxide, and nitric oxide and activation of gene expression involving calmodulins and calcium-dependent protein kinases in Ulva compressa exposed to copper excess. Plant Physiol. 158, 1451–1462. https://doi.org/10.1104/pp.111.191759. Hajihashemil, S., Noedoostl, F., Geuns, J.M.C., Djalovic, L., Siddique, K.H.M., 2018. Effect of cold stress on photosynthetic traits, carbohydrates, morphology, and anatomy in nine cultivars of Stevia rebaudiana. Front. Plant Sci. 12. https://doi.org/10.3389/fpls. 2018.01430. Hill, A.C., Bennett, J.H., 1970. Inhibition of apparent photosynthesis by nitrogen oxides. Atmos. Environ. 4, 341–348. Hu, H.Q., Wang, L.H., Wang, Q.Q., Jiao, L.Y., Hua, W.Q., Zhou, Q., Huang, X.H., 2014. Photosynthesis, chlorophyll fluorescence characteristics, and chlorophyll content of soybean seedlings under combined stress of bisphenol A and cadmium. Environ. Toxicol. Chem. 33, 2455–2462. https://doi.org/10.1002/etc.2720. Johnson, Maxwell, 2000. Siting of energy plants and choice of energy sources: the case of malta. Bank of Valletta Review 22, 44–61. Karimi, R., Ershadi, A., 2015. Role of exogenous abscisic acid in adapting of ‘Sultana’ grapevine to low-temperature stress. Acta Physiol. Plant. 37. https://doi.org/10. 1007/s11738-015-1902-z. Khan, M.N., Siddiqui, M.H., Mohammad, F., Naeem, M., 2012. Interactive role of nitric oxide and calcium chloride in enhancing tolerance to salt stress. Nitric Oxide 27, 210–218. https://doi.org/10.1016/j.niox.2012.07.005. Klessing, D.F., Durner, J., Noad, R., Navarre, D.A., Wendehenne, D., Kumar, D., Zhou, J.M., Shah, J., Zhang, S., Kachroo, P., Trifa, Y., Pontier, D., Lam, E., Silva, H., 2000. Nitric oxide and salicylic acid signaling in plant defense. P.N.A.S. 97, 8849–8855. https://doi.org/10.1073/pnas.97.16.8849. Kou, X.H., Jiang, B.L., Zhang, Y., Wang, J., Xue, Z.H., 2016. The regulation of sugar metabolism in huangguan pears (Pyres pyrifolia Nakai) with edible coatings of calcium or pullulan during cold storage. Korean J. Hortic. Sci. Technol. 34, 898–911. https://doi.org/10.12972/kjhst.20160094. Lamotte, O., Courtois, C., Dobrowolska, G., Besson, A., Pugin, A., Wendehenne, D., 2005. Mechanisms of nitric-oxide-induced increase of free cytosolic Ca2+ concentration in Nicotiana plumbaginifolia cells. Free Radic. Biol. Med. 40, 1369–1376. https://doi. org/10.1016/j.freeradbiomed.2005.12.006. Li, P., Yin, F., Song, L., Zheng, X., 2016. Alleviation of chilling injury in tomato fruit by

12

Scientia Horticulturae xxx (xxxx) xxxx

Z. Zhang, et al.

of nitric oxide in photosynthetic electron transport as studied by chlorophyll fluorescence in pea leaves. Plant Physiol. 146, 1920–1927. https://doi.org/10.1104/pp. 107.110205. Xu, Y.F., Chu, X.T., Fu, J.J., Yang, L.Y., Hu, T.M., 2016. Crosstalk of nitric oxide with calcium induced tolerance of tall fescue leaves to high irradiance. Biol. Plant. 60, 1–9. https://doi.org/10.1007/s10535-016-0597-3. Zhang, G.X., Liu, Y.F., Ni, Y., Meng, Z.J., Lu, T., Li, T.L., 2014. Exogenous calcium alleviates low night temperature stress on the photosynthetic apparatus of tomato leaves. PLoS One 9, 97322. https://doi.org/10.1371/journal.pone.0097322. Zhang, J., Fang, H., Huo, J.Q., Huang, D.J., Wang, B., Liao, W.B., 2018a. Involvement of calcium and calmodulin in nitric oxide-regulated senescence of cut lily flowers. Front. Plant Sci. 9. https://doi.org/10.3389/fpls.2018.01284. Zhang, Z.W., Suo, L.G., Wu, P., Liu, H.Y., Cui, J.X., 2018b. Ca2+ involved in antioxidant enzymes activities of cucumber seedling leaves enhanced by exogenous nitric oxide under low temperature stress. J. Nuclear Agric. Sci. 32, 600–608 (in chinese). Zhao, X., Hui, B., Hu, L., Cheng, Q., Via, B.K., Nadel, R., Starkey, T., Enebak, S., 2017. Potential of near infrared spectroscopy to monitor variations in soluble sugars in Loblolly pine seedlings after cold acclimation. Agric. For. Meteorol. 232, 536–542. Zhou, Y.H., Huang, L.F., Zhang, Y.L., Shi, K., Yu, J.Q., 2007. Chill-induced decrease in capacity of RuBP carboxylation and associated H2O2 accumulation in cucumber leaves are alleviated by grafting onto figleaf gourd. Ann. Bot. 100, 839–848. Zhu, J.K., 2016. Abiotic stress signaling and responses in plants. Cell 167, 313–324. https://doi.org/10.1016/j.cell.2016.08.029. Zottini, M., Formentin, E., Scattolin, M., Carimi, F., Schiavo, F.L., Terzi, M., 2002. Nitric oxide affects plant mitochondrial functionality in vivo. FEBS Lett. 515, 75–78. https://doi.org/10.1016/S0014-5793(02)02438-9.

s00425-012-1641-y. Tian, X., He, M., Wang, Z., Zhang, J., Song, Y., He, Z., Dong, Y., 2015. Application of nitric oxide and calcium nitrate enhances tolerance of wheat seedlings to salt stress. Plant Growth Regul. 77, 343–356. https://doi.org/10.1007/s10725-015-0069-3. Valmonte, G.R., Kieren, A., Higgins, C.M., Macdiarmid, R.M., 2014. Calcium-dependent protein kinases in plants: evolution, expression and function. Plant Cell Physiol. 55, 551–569. https://doi.org/10.1093/pcp/pct200. Vandelle, E., Poinssot, B., Wendehenne, D., Bentejac, M., Alain, P., 2006. Integrated signaling network involving calcium, nitric oxide, and active oxygen species but not mitogen-activated protein kinases in BcPG1-elicited grapevine defenses. Mol. Plantmicrobe Interact. 19, 429–440. https://doi.org/10.1094/mpmi-19-0429. Vladkova, R., Dobrikova, A.G., Singh, R., Misra, A.N., Apostolova, E., 2011. Photoelectron transport ability of chloroplast thylakoid membranes treated with NO donor SNP: changes in flash oxygen evolution and chlorophyll fluorescence. Nitric Oxide-Biol. Chem. 24, 84–90. https://doi.org/10.1016/j.niox.2010.12.003. Wang, L.N., 1999. An Experiment Guide of Modern Plant Physiology. Shanghai institute of plant physiology, Shanghai. Wang, L., Wang, L., Xiang, H., Luo, Y., Li, R., Li, Z., Wang, C., Meng, Y., 2016a. Relationship of photosynthetic efficiency and seed-setting rate in two contrasting rice cultivars under chilling stress. Photosynthetica 54, 581–588. https://doi.org/10. 1007/s11099-016-0648-1. Wang, Z., Cao, J.K., Jiang, W.B., 2016b. Changes in sugar metabolism caused by exogenous oxalic acid related to chilling tolerance of apricot fruit. Postharvest Biol. Technol. 114, 10–16. https://doi.org/10.1016/j.postharvbio.2015.11.015. Wanner, L.A., Junttila, O., 1999. Cold-induced freezing tolerance in Arabidopsis. Physiol. Plant. 120, 391–400. https://doi.org/10.1104/pp.120.2.391. Wodala, B., Deak, Z., Vass, I., Erdei, L., Altorjay, I., Horvath, F., 2008. In vivo target sites

13