- Email: [email protected]
Carney complex: A clinicopathologic and molecular biological study of a sporadic case, including extracutaneous and cutaneous lesions and a novel mutation of the PRKAR1A gene
DERMATOPATHOLOGY
Carney complex: A clinicopathologic and molecular biological study of a sporadic case, including extracutaneous and cutaneous lesions and a novel mutation of the PRKAR1A gene Denisa Kacerovska, MD, PhD,a Radek Sima, MSc,a Michal Michal, MD,a,e Ondrej Hes, MD, PhD,a Patrik Roucka, MD,b Marta Zarybnicka, MD,b Milan Hora, MD, PhD,c Zdenek Chudacek, MD, PhD,d,f and Dmitry V. Kazakov, MD, PhDa Pilsen and Prague, Czech Republic Background: Carney complex (CNC) is an autosomal dominant disorder associated with multiple neoplasms. Objective: We report a case of a 40-year-old Caucasian man with a sporadic form of CNC. Methods: This is a clinicopathologic description and molecular biological study with an emphasis on histopathologic findings. Results: The patient presented with multiple cutaneous myxomas, cardiac myxomas, and spotty pigmentation at typical sites. Additionally, a blue nevus, a lipoma, multiple calcifications in both testes, and hypoechogenic areas suspected of being adenomas in the thyroid gland were found. Microscopically, the 2 cardiac and 6 cutaneous myxomas studied manifested a typical appearance, being composed of scattered polygonal, stellate, plump and/or spindle cells in a mucinous matrix containing small, sometimes dilated blood vessels. Of the 6 cutaneous myxomas, only in one lesion was there an abnormal epithelial component (tiny basaloid buds and a horn cyst). Molecular biologic study revealed a heterozygous shift mutation c.796dupA in exon 10 of the PRKAR1A gene. Physical examination and genetic testing of family members (both parents and two brothers) for the PRKAR1A mutation were negative, as was analysis of the peripheral blood of 110 randomly selected, unrelated healthy individuals for the above mutation. These findings suggest sporadic disease and a novel mutation in our patient. Limitations: None. Conclusion: Herein we report a case of sporadic CNC in which a novel mutation in PRKAR1A was identified. ( J Am Acad Dermatol 2009;61:80-7.) Key words: blue nevus; cardiac myxomas; Carney complex; chromosome 17q24; cutaneous myxomas; novel mutation; PRKAR1A gene.
From Sikl’s Department of Pathology,a and the Departments of Cardiosurgery,b Urology,c and Radiology,d Charles University, Medical Faculty Hospital, and the Bioptical Laboratory,e Pilsen; and the Department of Radiology, Charles University, First Medical Faculty, Prague.f Funding sources: None. Conflicts of interest: None declared. Reprint requests: Dmitry V. Kazakov, MD, PhD, Sikl’s Department of Pathology, Charles University, Medical Faculty Hospital, Alej Svobody 80, 304 60 Pilsen, Czech Republic. E-mail: kazakov@ medima.cz. 0190-9622/$36.00 ª 2009 by the American Academy of Dermatology, Inc. doi:10.1016/j.jaad.2008.11.015
80
C
arney complex (CNC) is an autosomal dominant disease characterized by multiple myxomas, spotty pigmentation of the skin, and endocrine abnormalities. Although a combination of several components of this inherited condition was described as early as 1973,1 the disease was recognized as a distinct syndrome by Carney et al2 in 1985. The clinical manifestations of CNC include (1) myxomas occurring in various organs such as the skin, superficial soft tissue, heart, and breast; (2) cutaneous and mucocutaneous lentiginous pigmentation; and (3) an endocrinopathy manifesting as primary pigmented nodular adrenocortical disease
Kacerovska et al 81
J AM ACAD DERMATOL VOLUME 61, NUMBER 1
Table I. Primers used for amplification of coding exons of the PRKAR1A gene Exon
Name
Sequence 59/39
3
PRKAR-3F PRKAR-3R PRKAR-4F PRKAR-4R PRKAR-5F PRKAR-5R PRKAR-6F PRKAR-6R PRKAR-7F PRKAR-7R PRKAR-8F PRKAR-8R PRKAR-9F PRKAR-9R PRKAR-10F PRKAR-10R PRKAR-11F PRKAR-11R PRKAR-12F PRKAR-12R
TGCCAGATTGACATTTTGCT CCTCATCATCTCCCCACATT CATGCCGAAGGATCTCATTT AGTGGGTCCCAAAAGCATC CAGGTTGCAAACGTGAAATG TTGGGATCACACCCTTACTTG TTCACGGAAGAGACATGTGAA GCCTCCTCTCCCGTAACAAT TTCTTTCTTTAATTTGGAATATGCTTC TGCTCGGAAGCGATCAATA AAAAAGGTTTGAGGGTTTTTAACAT TTCTAAATCACACTCTCAAACACCA CACGTCTTGGGGATATCACTT CTTTTCCCAAGTCCATCCAA GCAGTTATTTTGATTCTTGTCTTTCA TTAGCCCACTCTTTCCCTCTT CCCTGGGTTTGAGAGTGTGT AACCATGTATTTATTGTGAGGGAAT GGAAATGTTTTTCATAGAAGTTAGCC GAAAAGGGAGGCACAGGAG
4 5 6 7 8 9 10 11 12
causing adrenocorticotropic hormoneeindependent Cushing syndrome and/or growth hormonee producing pituitary adenomas.3 Less common components of this disorder may include large-cell calcifying Sertoli cell tumor of the testis,4 psammomatous melanotic schwannoma,5-7 and epithelioid blue nevus.7,8 In the literature there have also been reported rare cases of osteochondromyxoma,9 thyroid gland abnormalities,10 ovarian lesions,11,12 and tetralogy of Fallot,13,14 although it is not clear at present whether these represent a component of the syndrome or are merely coincidental. CNC is a genetically heterogeneous entity, with at least two known genes responsible for the disease, namely the CNC1 gene located on chromosome 17q22-24 and the CNC2 gene mapped to 2p16.15,16 The CNC1 gene, also known as the PRKAR1A gene, a tumor suppressor gene, encodes the type 1A regulatory subunit of c-AMP-dependent protein kinase A, which is known to be an important effector molecule in many endocrine signaling pathways.17 Inactivating mutations of PRKAR1A have been found in approximately half of all patients with CNC.18 The CNC2 gene is less well characterized but may be involved in regulating genomic stability.19,20 Herein we report a case of sporadic CNC in which a novel mutation in the PRKAR1A gene was identified.
MATERIAL AND METHODS The removed tissue was fixed in 4% formaldehyde and embedded in paraffin. The paraffin blocks were
Fig 1. A, Transthoracic echocardiography of two myxomas located in right ventricular chamber. B, Cardiac myxoma is nonencapsulated and poorly circumscribed. C, Round to polygonal and stellate cells surrounded by abundant loose stroma rich in acid mucopolysaccharides Focally, areas with many siderophages and extravasated erythrocytes are present. (B and C, Hematoxylin-eosin stain.)
cut into 5-m thick sections and stained with hematoxylin and eosin. DNA from the patient’s peripheral blood was extracted by the NucleoSpin Tissue Kit (MachereyNagel, Du¨ren, Germany) according to the manufacturer’s protocol. Ten coding exons (exons 3-12 according to the reference sequence NG 007093) of the PRKAR1A gene were amplified by polymerase chain reaction (PCR) using primers listed in Table I. PCR conditions were as follows: 12.5 L of HotStart Taq PCR Master Mix (QIAgen, Hilden, Germany), 10
82 Kacerovska et al
J AM ACAD DERMATOL JULY 2009
Fig 2. A-C, Spotty pigmentation around eyes and lips with several pigmented dots on lower lip and on palm. D, Two small, pink, sessile myxomas with smooth, nonulcerated surface located on right cheek.
pmol of each primer, 100 ng of template DNA, and distilled water up to 25 L. Amplification program consisted of an initial denaturation at 958C for 15 minutes, then 40 cycles of denaturation at 958C for 1 minute, annealing at 608C for 1 minute, and extension at 728C for 1 minute. Program was finished by a final extension at 728C for 7 minutes. Amplified fragments were purified by Montage PCR Filter Units (Millipore, Billerica, MA) and sequenced using a Big Dye Terminator Sequencing Kit (PE/Applied Biosystems, Foster City, CA) on an automated sequencer ABI Prism 3130xl (PE/Applied Biosystems) at a constant voltage of 11.3 kV for 20 minutes. After identification of an apparently novel mutation (see below), peripheral blood from 110 randomly selected healthy individuals was tested to exclude the possibility that the PRKAR1A abnormality might represent a polymorphism rather than a mutation.
CASE REPORT The patient was a 40-year-old Caucasian man with a medical history of a cardiac myxoma of the right ventricle with penetration into the pulmonary trunk when he was 14 years old. The myxoma was removed
surgically. In addition, he was diagnosed with a cutaneous myxoma involving the external ear canal at the age of 30 years. He was admitted to our hospital because of two newly developed heart masses located in the right ventricular chamber, which on transthoracic echocardiography appeared as sessile or pedunculated masses measuring 1.98 3 1.78 cm and 4.87 3 2.16 cm, respectively (Fig 1, A). Surgical excision of both tumors was performed; histological examination confirmed cardiac myxomas. On physical examination, spotty pigmentation around the eyes and lips and several pigmented lesions on his lower lip were observed (Fig 2, A and B). Additionally, similar lentiginous pigmentation was present on the palms and the palmar side of the fingers (Fig 2, C ). On the right cheek and temple, there were small, pink, sessile papules with smooth, nonulcerated surface (Fig 2, D); similar lesions were noted on the left shoulder, thigh, and back. A subcutaneous nodule measuring 3.0 3 2.5 cm was present on the posterior aspect of the neck (Fig 3, A). A small blue nevus was situated on the back (Fig 3, B). Ultrasonography and computed tomography of the testes revealed bilateral multiple lumpy calcifications (Fig 4); no tumorous mass was detected. Ultrasonography of the thyroid gland disclosed
J AM ACAD DERMATOL
Kacerovska et al 83
VOLUME 61, NUMBER 1
Fig 4. A, Computed tomography: multifocal, dispersed, and bilateral testicular calcifications in slightly atrophic testicles. B, Ultrasonography: discrete hypoechogenicity of testicle with multiple lumpy calcifications.
myxoma from the external ear canal appeared as a polypoid lesion.
Fig 3. A, Subcutaneous nodule on posterior aspect of neck. The lesion proved to be lipoma by microscopy. B, Small blue nevus on back. C, Microscopic appearance of the blue nevus: highly pigmented spindle melanocytes in superficial and reticular dermis. (Hematoxylin-eosin stain.)
several hypoechogenic areas suspected as adenomas. Biopsy of the testes and thyroid gland was not done.
RESULTS Gross features Grossly, both cardiac myxomas were well circumscribed, soft, whitish, lobulated masses. On cut section, the tumors appeared solid, homogeneous, and white with a focus of hemorrhage in the center of the larger lesion. Grossly, the cutaneous myxomas were 2- to 8-mm sessile papules with a gelatinous cut surface. The
Histopathologic findings Available for histopathologic review were two cardiac myxomas, 6 cutaneous myxomas including one myxoma from the external ear canal, one blue nevus, and one lipoma. Microscopically, both cardiac myxomas were nonencapsulated and poorly circumscribed lesions (Fig 1, B). They showed round to polygonal and stellate cells surrounded by abundant loose stroma rich in acid mucopolysaccharides (Fig 1, C ), growing around vessels. Focally, areas with a high number of siderophages and extravasated erythrocytes were present. Mitoses, pleomorphism, and areas of necrosis were absent. All cutaneous myxomas were relatively well-circumscribed nonencapsulated lesions (Fig 5, A and B). Four of them were superficial and located in the upper dermis, one was situated deep in the reticular dermis with extension to the subcutis, and the one from the external ear canal was a polypoid lesion. All were composed of scattered polygonal, stellate, plump, and/or spindle cells with small or inconspicuous nucleoli growing in a copious mucinous matrix containing small, sometimes slightly dilated blood
84 Kacerovska et al
J AM ACAD DERMATOL JULY 2009
Fig 5. A and B, Cutaneous myxomas are relatively well-circumscribed nonencapsulated lesions. C, All of the myxomas are composed of scattered polygonal, stellate, plump, and/or spindle cells with small or inconspicuous nucleoli growing in a copious mucinous matrix containing small, sometimes slightly dilated blood vessels. D, Miniature area of the mucinous stroma with a few mesenchymal cells in direct contact with a hair follicle, apparently replacing the follicular papilla. (A-D, Hematoxylin-eosin stain.)
vessels (Fig 5, C ). Many cells contained pseudonuclear inclusions. The epidermis above all but one myxoma (the exception being the myxoma of the external ear canal) was unremarkable. The overlying epithelium in the external ear canal lesion exhibited tiny buds and interconnected strands of epithelial cells with peripheral palisading (Fig 6). Few lymphocytes or mast cells were observed in the myxoid stroma. In one specimen, in addition to an incipient myxoma in the upper dermis, there was another miniature area of the mucinous stroma with a few mesenchymal cells in direct contact with a hair follicle, apparently replacing the follicular papilla (Fig 5, D). The blue nevus (Fig 3, C ) and the lipoma showed typical appearances. PRKAR1A mutation analysis The whole coding sequence of the PRKAR1A gene, including exon-intron junctions, was amplified, sequenced, and compared with the reference sequence (GenBank accession number NG 007093), which revealed a heterozygous shift mutation c.796dupA
in exon 10 (Fig 7). This mutation leads to a frameshift starting at threonine 266 and creating a new stop codon (UGA) at position 269 (p.Thr266AsnfsX4). In addition, the peripheral blood of both parents of the patient (aged 66 and 68) and his two brothers (aged 45 and 30), none of whom showed clinical features of CNC, was studied for PRKAR1A mutation, but no alteration was found.
DISCUSSION The clinical features of the patient fulfilled the diagnostic criteria of CNC (Table II).21 He had spotty pigmentation of the skin at typical sites, multiple cutaneous myxomas, and cardiac myxomas. Location of the myxomas involving the external auditory canal are very specific for this syndrome. Additionally, multiple testicular calcifications were found. These are included in the criteria for CNC. The calcifications may be found in coexistence with a large-cell calcifying Sertoli cell tumor or they may occur separately in the testes in the absence of this tumor.9,22-25 Testicular microcalcifications set within scarred stromal tissue may also represent remnants of regressed germ cell tumors, especially choriocarcinomas,
Kacerovska et al 85
J AM ACAD DERMATOL VOLUME 61, NUMBER 1
Table II. Diagnostic criteria for CNC according to Stratakis, Kirschner, and Carney21* 1
2 3 4 5
6 7 8
9 10
Spotty skin pigmentation with typical distribution (lips, conjunctiva, and inner or outer canthi, vaginal and penile mucosa) Myxoma (cutaneous and mucosal)y Cardiac myxomay Breast myxomatosisy or fat-suppressed MRI findings suggestive of this diagnosis PPNADy or paradoxical positive response of urinary glucocorticosteroids to dexamethasone administration during Liddle’s test Acromegaly due to GH-producing adenomay LCCSCTy or characteristic calcification on testicular ultrasonography Thyroid carcinomay or multiple, hypoechoic nodules on thyroid ultrasonography, in a young patient Psammomatous melanotic schwannomay Blue nevus, epithelioid blue nevus (multiple)y Breast ductal adenoma (multiple)y Osteochondromyxomay
11 12 Supplemental criteria 1 Affected first-degree relative 2 Inactivating mutation of the PRKAR1A gene
Fig 6. A-C, In external ear canal lesion, overlying epithelium exhibits tiny buds and interconnected strands of epithelial cells with peripheral palisading. (A-C, Hematoxylin-eosin stain.)
which should be taken into consideration when constructing the differential diagnosis.26,27 The histologic picture of all tumors in our patient was typical, including the epithelial proliferations in the lesion that came from the external ear canal.25 An interesting feature was the presence of an incipient myxoma in the vicinity of a hair follicle, with the specific stroma of the follicular papilla seemingly replaced by the myxomatous elements that appeared to be part of the myxoma (see Fig 5, D). Although mucin can occasionally be recognized in otherwise normal follicular papillae, never has this feature had such a prominent presentation. We believe that the association of myxomas and hair follicle differentiation in CNC is not a simple coincidence and the significance of this association maybe under-recognized. Although commonly referred to as ‘‘epithelial components,’’ these epithelial proliferations, on
CNC, Carney complex; GH, growth hormone; LCCSCT, large-cell calcifying Sertoli cell tumor; MRI, magnetic resonance imaging; PPNAD, primary pigmented nodular adrenocortical disease. *To make a diagnosis of CNC, a patient must exhibit either two of the manifestations of the disease listed or one of these manifestations and one of the supplemental criteria. y With histologic confirmation.
scrutiny, often evidence various features that can be interpreted as signs of follicular differentiation toward the follicular germ, trichogenic stroma, including follicular papilla, isthmus, infundibulum, and mantle.19,25,28,29 Application of a rigorous screening protocol for all first-degree relative of patients affected with CNS showed an increase in a number of familial cases. In a recent review, Stratakis, Kirschner, and Carney21 identified 338 patients with CNC reported worldwide, a majority of whom (70%) belonged to 67 affected families, whereas only 88 individuals had no known affected relative. The authors suggested that some familial cases may have gone unrecognized, resulting in an ‘‘increase’’ of ‘‘sporadic’’ cases. The clinical variability of the disease and the small size of affected CNC families because of infertility are thought to contribute to this under-recognition.
86 Kacerovska et al
J AM ACAD DERMATOL JULY 2009
Fig 7. Heterozygous shift mutation c.796dupA in exon 10 of PRKAR1A gene using forward primer.
Mutations in the PRKAR1A gene have been identified in approximately 65% of the CNC patients, in both familial and sporadic cases.18 In our case, we detected a novel heterozygous shift mutation c.796dupA in exon 10 of the PRKAR1A gene. This mutation leads to a frameshift creating a new stop codon. The biologic effect of this mutation is production of a truncated and probably inactive protein. To our knowledge, this mutation has not been described. Neither was this alteration detected in 110 unrelated healthy individuals we investigated. The parents and two brothers of the patient had no clinical features of CNC, and the analysis of their blood for PRKAR1A mutations showed no alteration, thus indicating that our patient had a sporadic form of the disease. In summary, we have described a sporadic case of CNC, with a novel mutation in exon 10 of the PRKAR1A gene, with typical clinical features including cardiac myxomas, cutaneous myxomas, a blue nevus, and multiple testicular calcifications.
REFERENCES 1. Rees JR, Ross FG, Keen G. Lentiginosis and left atrial myxoma. Br Heart J 1973;35:874-6. 2. Carney JA, Gordon H, Carpenter PC, Shenoy BV, Go VL. The complex of myxomas, spotty pigmentation, and endocrine overactivity. Medicine (Baltimore) 1985;64:270-83. 3. Carney DF, Koski CL, Shin ML. Elimination of terminal complement intermediates from the plasma membrane of nucleated cells: the rate of disappearance differs for cells carrying C5b-7 or C5b-8 or a mixture of C5b-8 with a limited number of C5b-9. J Immunol 1985;134:1804-9. 4. Washecka R, Dresner MI, Honda SA. Testicular tumors in Carney’s complex. J Urol 2002;167:1299-302. 5. Carney JA. Psammomatous melanotic schwannoma. A distinctive, heritable tumor with special associations, including cardiac myxoma and the Cushing syndrome. Am J Surg Pathol 1990;14:206-22. 6. Martin-Reay DG, Shattuck MC, Guthrie FW Jr. Psammomatous melanotic schwannoma: an additional component of Carney’s complex. Report of a case. Am J Clin Pathol 1991;95:484-9. 7. Carney JA, Stratakis CA. Epithelioid blue nevus and psammomatous melanotic schwannoma: the unusual pigmented skin tumors of the Carney complex. Semin Diagn Pathol 1998;15: 216-24. 8. Carney JA, Ferreiro JA. The epithelioid blue nevus. A multicentric familial tumor with important associations, including cardiac myxoma and psammomatous melanotic schwannoma. Am J Surg Pathol 1996;20:259-72.
9. Carney JA, Boccon-Gibod L, Jarka DE, Tanaka Y, Swee RG, Unni KK, et al. Osteochondromyxoma of bone: a congenital tumor associated with lentigines and other unusual disorders. Am J Surg Pathol 2001;25:164-76. 10. Stratakis CA, Courcoutsakis NA, Abati A, Filie A, Doppman JL, Carney JA, et al. Thyroid gland abnormalities in patients with the syndrome of spotty skin pigmentation, myxomas, endocrine overactivity, and schwannomas (Carney complex). J Clin Endocrinol Metab 1997;82:2037-43. 11. Cohen C, Turner ML, Stratakis CA. Pigmented lesions of the conjunctiva in Carney’s complex. J Am Acad Dermatol 2000; 42:145. 12. Papageorgiou T, Stratakis CA. Ovarian tumors associated with multiple endocrine neoplasias and related syndromes (Carney complex, Peutz-Jeghers syndrome, von Hippel-Lindau disease, Cowden’s disease). Int J Gynecol Cancer 2002;12:337-47. 13. Akbas H, Kirali K, Daglar B, Kutay V, Isik O, Yakut C. Surgical treatment of left-atrial myxoma in Carney’s complex. Thorac Cardiovasc Surg 1997;45:148-50. 14. Yarman S, Gurbuz L, Tanakol R, Kapran Y, Alagol F. Association of Fallot tetralogy with Carney’s complex. Ir Med J 2001;94: 305-7. 15. Stratakis CA, Carney JA, Lin JP, Papanicolaou DA, Karl M, Kastner DL, et al. Carney complex, a familial multiple neoplasia and lentiginosis syndrome. Analysis of 11 kindreds and linkage to the short arm of chromosome 2. J Clin Invest 1996;97:699-705. 16. Casey M, Mah C, Merliss AD, Kirschner LS, Taymans SE, Denio AE, et al. Identification of a novel genetic locus for familial cardiac myxomas and Carney complex. Circulation 1998;98: 2560-6. 17. Sassone-Corsi P. Coupling gene expression to cAMP signalling: role of CREB and CREM. Int J Biochem Cell Biol 1998;30: 27-38. 18. Kirschner LS, Carney JA, Pack SD, Taymans SE, Giatzakis C, Cho YS, et al. Mutations of the gene encoding the protein kinase A type I-alpha regulatory subunit in patients with the Carney complex. Nat Genet 2000;26:89-92. 19. LeBoit PE, Gu¨nter B, Weedon D, Sarasin A. Pathology & Genetics Skin Tumours. World Health Organization Classification of Tumours. Lyon: IARC Press; 2006. 20. Matyakhina L, Pack S, Kirschner LS, Pak E, Mannan P, Jaikumar J, et al. Chromosome 2 (2p16) abnormalities in Carney complex tumours. J Med Genet 2003;40:268-77. 21. Stratakis CA, Kirschner LS, Carney JA. Clinical and molecular features of the Carney complex: diagnostic criteria and recommendations for patient evaluation. J Clin Endocrinol Metab 2001;86:4041-6. 22. Kennedy RH, Waller RR, Carney JA. Ocular pigmented spots and eyelid myxomas. Am J Ophthalmol 1987;104:533-8. 23. Grossniklaus HE, McLean IW, Gillespie JJ. Bilateral eyelid myxomas in Carney’s complex. Br J Ophthalmol 1991;75: 251-2. 24. Palva T, Saksela E, Ramsay H. Myxoma of the external auditory meatus. J Laryngol Otol 1991;105:364-6. 25. Ferreiro JA, Carney JA. Myxomas of the external ear and their significance. Am J Surg Pathol 1994;18:274-80.
J AM ACAD DERMATOL
Kacerovska et al 87
VOLUME 61, NUMBER 1
26. Azzopardi JG, Mostofi FK, Theiss EA. Lesions of testes observed in certain patients with widespread choriocarcinoma and related tumors. The significance and genesis of hematoxylin-staining bodies in the human testis. Am J Pathol 1961;38: 207-25. 27. Renshaw AA. Testicular calcifications: incidence, histology and proposed pathological criteria for testicular microlithiasis. J Urol 1998;160:1625-8.
28. Carney JA, Headington JT, Su WP. Cutaneous myxomas. A major component of the complex of myxomas, spotty pigmentation, and endocrine overactivity. Arch Dermatol 1986; 122:790-8. 29. Bennett KR, Heath BJ, Creswell LL, Veugelers MA, McDermott DA, Barksdale S, et al. The Carney complex: unusual skin findings and recurrent cardiac myxoma. Arch Dermatol 2005; 141:916-8.
Carney complex: A clinicopathologic and molecular biological study of a sporadic case, including extracutaneous and cutaneous lesions and a novel mutation of the PRKAR1A gene Denisa Kacerovska, MD, PhD,a Radek Sima, MSc,a Michal Michal, MD,a,e Ondrej Hes, MD, PhD,a Patrik Roucka, MD,b Marta Zarybnicka, MD,b Milan Hora, MD, PhD,c Zdenek Chudacek, MD, PhD,d,f and Dmitry V. Kazakov, MD, PhDa Pilsen and Prague, Czech Republic Background: Carney complex (CNC) is an autosomal dominant disorder associated with multiple neoplasms. Objective: We report a case of a 40-year-old Caucasian man with a sporadic form of CNC. Methods: This is a clinicopathologic description and molecular biological study with an emphasis on histopathologic findings. Results: The patient presented with multiple cutaneous myxomas, cardiac myxomas, and spotty pigmentation at typical sites. Additionally, a blue nevus, a lipoma, multiple calcifications in both testes, and hypoechogenic areas suspected of being adenomas in the thyroid gland were found. Microscopically, the 2 cardiac and 6 cutaneous myxomas studied manifested a typical appearance, being composed of scattered polygonal, stellate, plump and/or spindle cells in a mucinous matrix containing small, sometimes dilated blood vessels. Of the 6 cutaneous myxomas, only in one lesion was there an abnormal epithelial component (tiny basaloid buds and a horn cyst). Molecular biologic study revealed a heterozygous shift mutation c.796dupA in exon 10 of the PRKAR1A gene. Physical examination and genetic testing of family members (both parents and two brothers) for the PRKAR1A mutation were negative, as was analysis of the peripheral blood of 110 randomly selected, unrelated healthy individuals for the above mutation. These findings suggest sporadic disease and a novel mutation in our patient. Limitations: None. Conclusion: Herein we report a case of sporadic CNC in which a novel mutation in PRKAR1A was identified. ( J Am Acad Dermatol 2009;61:80-7.) Key words: blue nevus; cardiac myxomas; Carney complex; chromosome 17q24; cutaneous myxomas; novel mutation; PRKAR1A gene.
From Sikl’s Department of Pathology,a and the Departments of Cardiosurgery,b Urology,c and Radiology,d Charles University, Medical Faculty Hospital, and the Bioptical Laboratory,e Pilsen; and the Department of Radiology, Charles University, First Medical Faculty, Prague.f Funding sources: None. Conflicts of interest: None declared. Reprint requests: Dmitry V. Kazakov, MD, PhD, Sikl’s Department of Pathology, Charles University, Medical Faculty Hospital, Alej Svobody 80, 304 60 Pilsen, Czech Republic. E-mail: kazakov@ medima.cz. 0190-9622/$36.00 ª 2009 by the American Academy of Dermatology, Inc. doi:10.1016/j.jaad.2008.11.015
80
C
arney complex (CNC) is an autosomal dominant disease characterized by multiple myxomas, spotty pigmentation of the skin, and endocrine abnormalities. Although a combination of several components of this inherited condition was described as early as 1973,1 the disease was recognized as a distinct syndrome by Carney et al2 in 1985. The clinical manifestations of CNC include (1) myxomas occurring in various organs such as the skin, superficial soft tissue, heart, and breast; (2) cutaneous and mucocutaneous lentiginous pigmentation; and (3) an endocrinopathy manifesting as primary pigmented nodular adrenocortical disease
Kacerovska et al 81
J AM ACAD DERMATOL VOLUME 61, NUMBER 1
Table I. Primers used for amplification of coding exons of the PRKAR1A gene Exon
Name
Sequence 59/39
3
PRKAR-3F PRKAR-3R PRKAR-4F PRKAR-4R PRKAR-5F PRKAR-5R PRKAR-6F PRKAR-6R PRKAR-7F PRKAR-7R PRKAR-8F PRKAR-8R PRKAR-9F PRKAR-9R PRKAR-10F PRKAR-10R PRKAR-11F PRKAR-11R PRKAR-12F PRKAR-12R
TGCCAGATTGACATTTTGCT CCTCATCATCTCCCCACATT CATGCCGAAGGATCTCATTT AGTGGGTCCCAAAAGCATC CAGGTTGCAAACGTGAAATG TTGGGATCACACCCTTACTTG TTCACGGAAGAGACATGTGAA GCCTCCTCTCCCGTAACAAT TTCTTTCTTTAATTTGGAATATGCTTC TGCTCGGAAGCGATCAATA AAAAAGGTTTGAGGGTTTTTAACAT TTCTAAATCACACTCTCAAACACCA CACGTCTTGGGGATATCACTT CTTTTCCCAAGTCCATCCAA GCAGTTATTTTGATTCTTGTCTTTCA TTAGCCCACTCTTTCCCTCTT CCCTGGGTTTGAGAGTGTGT AACCATGTATTTATTGTGAGGGAAT GGAAATGTTTTTCATAGAAGTTAGCC GAAAAGGGAGGCACAGGAG
4 5 6 7 8 9 10 11 12
causing adrenocorticotropic hormoneeindependent Cushing syndrome and/or growth hormonee producing pituitary adenomas.3 Less common components of this disorder may include large-cell calcifying Sertoli cell tumor of the testis,4 psammomatous melanotic schwannoma,5-7 and epithelioid blue nevus.7,8 In the literature there have also been reported rare cases of osteochondromyxoma,9 thyroid gland abnormalities,10 ovarian lesions,11,12 and tetralogy of Fallot,13,14 although it is not clear at present whether these represent a component of the syndrome or are merely coincidental. CNC is a genetically heterogeneous entity, with at least two known genes responsible for the disease, namely the CNC1 gene located on chromosome 17q22-24 and the CNC2 gene mapped to 2p16.15,16 The CNC1 gene, also known as the PRKAR1A gene, a tumor suppressor gene, encodes the type 1A regulatory subunit of c-AMP-dependent protein kinase A, which is known to be an important effector molecule in many endocrine signaling pathways.17 Inactivating mutations of PRKAR1A have been found in approximately half of all patients with CNC.18 The CNC2 gene is less well characterized but may be involved in regulating genomic stability.19,20 Herein we report a case of sporadic CNC in which a novel mutation in the PRKAR1A gene was identified.
MATERIAL AND METHODS The removed tissue was fixed in 4% formaldehyde and embedded in paraffin. The paraffin blocks were
Fig 1. A, Transthoracic echocardiography of two myxomas located in right ventricular chamber. B, Cardiac myxoma is nonencapsulated and poorly circumscribed. C, Round to polygonal and stellate cells surrounded by abundant loose stroma rich in acid mucopolysaccharides Focally, areas with many siderophages and extravasated erythrocytes are present. (B and C, Hematoxylin-eosin stain.)
cut into 5-m thick sections and stained with hematoxylin and eosin. DNA from the patient’s peripheral blood was extracted by the NucleoSpin Tissue Kit (MachereyNagel, Du¨ren, Germany) according to the manufacturer’s protocol. Ten coding exons (exons 3-12 according to the reference sequence NG 007093) of the PRKAR1A gene were amplified by polymerase chain reaction (PCR) using primers listed in Table I. PCR conditions were as follows: 12.5 L of HotStart Taq PCR Master Mix (QIAgen, Hilden, Germany), 10
82 Kacerovska et al
J AM ACAD DERMATOL JULY 2009
Fig 2. A-C, Spotty pigmentation around eyes and lips with several pigmented dots on lower lip and on palm. D, Two small, pink, sessile myxomas with smooth, nonulcerated surface located on right cheek.
pmol of each primer, 100 ng of template DNA, and distilled water up to 25 L. Amplification program consisted of an initial denaturation at 958C for 15 minutes, then 40 cycles of denaturation at 958C for 1 minute, annealing at 608C for 1 minute, and extension at 728C for 1 minute. Program was finished by a final extension at 728C for 7 minutes. Amplified fragments were purified by Montage PCR Filter Units (Millipore, Billerica, MA) and sequenced using a Big Dye Terminator Sequencing Kit (PE/Applied Biosystems, Foster City, CA) on an automated sequencer ABI Prism 3130xl (PE/Applied Biosystems) at a constant voltage of 11.3 kV for 20 minutes. After identification of an apparently novel mutation (see below), peripheral blood from 110 randomly selected healthy individuals was tested to exclude the possibility that the PRKAR1A abnormality might represent a polymorphism rather than a mutation.
CASE REPORT The patient was a 40-year-old Caucasian man with a medical history of a cardiac myxoma of the right ventricle with penetration into the pulmonary trunk when he was 14 years old. The myxoma was removed
surgically. In addition, he was diagnosed with a cutaneous myxoma involving the external ear canal at the age of 30 years. He was admitted to our hospital because of two newly developed heart masses located in the right ventricular chamber, which on transthoracic echocardiography appeared as sessile or pedunculated masses measuring 1.98 3 1.78 cm and 4.87 3 2.16 cm, respectively (Fig 1, A). Surgical excision of both tumors was performed; histological examination confirmed cardiac myxomas. On physical examination, spotty pigmentation around the eyes and lips and several pigmented lesions on his lower lip were observed (Fig 2, A and B). Additionally, similar lentiginous pigmentation was present on the palms and the palmar side of the fingers (Fig 2, C ). On the right cheek and temple, there were small, pink, sessile papules with smooth, nonulcerated surface (Fig 2, D); similar lesions were noted on the left shoulder, thigh, and back. A subcutaneous nodule measuring 3.0 3 2.5 cm was present on the posterior aspect of the neck (Fig 3, A). A small blue nevus was situated on the back (Fig 3, B). Ultrasonography and computed tomography of the testes revealed bilateral multiple lumpy calcifications (Fig 4); no tumorous mass was detected. Ultrasonography of the thyroid gland disclosed
J AM ACAD DERMATOL
Kacerovska et al 83
VOLUME 61, NUMBER 1
Fig 4. A, Computed tomography: multifocal, dispersed, and bilateral testicular calcifications in slightly atrophic testicles. B, Ultrasonography: discrete hypoechogenicity of testicle with multiple lumpy calcifications.
myxoma from the external ear canal appeared as a polypoid lesion.
Fig 3. A, Subcutaneous nodule on posterior aspect of neck. The lesion proved to be lipoma by microscopy. B, Small blue nevus on back. C, Microscopic appearance of the blue nevus: highly pigmented spindle melanocytes in superficial and reticular dermis. (Hematoxylin-eosin stain.)
several hypoechogenic areas suspected as adenomas. Biopsy of the testes and thyroid gland was not done.
RESULTS Gross features Grossly, both cardiac myxomas were well circumscribed, soft, whitish, lobulated masses. On cut section, the tumors appeared solid, homogeneous, and white with a focus of hemorrhage in the center of the larger lesion. Grossly, the cutaneous myxomas were 2- to 8-mm sessile papules with a gelatinous cut surface. The
Histopathologic findings Available for histopathologic review were two cardiac myxomas, 6 cutaneous myxomas including one myxoma from the external ear canal, one blue nevus, and one lipoma. Microscopically, both cardiac myxomas were nonencapsulated and poorly circumscribed lesions (Fig 1, B). They showed round to polygonal and stellate cells surrounded by abundant loose stroma rich in acid mucopolysaccharides (Fig 1, C ), growing around vessels. Focally, areas with a high number of siderophages and extravasated erythrocytes were present. Mitoses, pleomorphism, and areas of necrosis were absent. All cutaneous myxomas were relatively well-circumscribed nonencapsulated lesions (Fig 5, A and B). Four of them were superficial and located in the upper dermis, one was situated deep in the reticular dermis with extension to the subcutis, and the one from the external ear canal was a polypoid lesion. All were composed of scattered polygonal, stellate, plump, and/or spindle cells with small or inconspicuous nucleoli growing in a copious mucinous matrix containing small, sometimes slightly dilated blood
84 Kacerovska et al
J AM ACAD DERMATOL JULY 2009
Fig 5. A and B, Cutaneous myxomas are relatively well-circumscribed nonencapsulated lesions. C, All of the myxomas are composed of scattered polygonal, stellate, plump, and/or spindle cells with small or inconspicuous nucleoli growing in a copious mucinous matrix containing small, sometimes slightly dilated blood vessels. D, Miniature area of the mucinous stroma with a few mesenchymal cells in direct contact with a hair follicle, apparently replacing the follicular papilla. (A-D, Hematoxylin-eosin stain.)
vessels (Fig 5, C ). Many cells contained pseudonuclear inclusions. The epidermis above all but one myxoma (the exception being the myxoma of the external ear canal) was unremarkable. The overlying epithelium in the external ear canal lesion exhibited tiny buds and interconnected strands of epithelial cells with peripheral palisading (Fig 6). Few lymphocytes or mast cells were observed in the myxoid stroma. In one specimen, in addition to an incipient myxoma in the upper dermis, there was another miniature area of the mucinous stroma with a few mesenchymal cells in direct contact with a hair follicle, apparently replacing the follicular papilla (Fig 5, D). The blue nevus (Fig 3, C ) and the lipoma showed typical appearances. PRKAR1A mutation analysis The whole coding sequence of the PRKAR1A gene, including exon-intron junctions, was amplified, sequenced, and compared with the reference sequence (GenBank accession number NG 007093), which revealed a heterozygous shift mutation c.796dupA
in exon 10 (Fig 7). This mutation leads to a frameshift starting at threonine 266 and creating a new stop codon (UGA) at position 269 (p.Thr266AsnfsX4). In addition, the peripheral blood of both parents of the patient (aged 66 and 68) and his two brothers (aged 45 and 30), none of whom showed clinical features of CNC, was studied for PRKAR1A mutation, but no alteration was found.
DISCUSSION The clinical features of the patient fulfilled the diagnostic criteria of CNC (Table II).21 He had spotty pigmentation of the skin at typical sites, multiple cutaneous myxomas, and cardiac myxomas. Location of the myxomas involving the external auditory canal are very specific for this syndrome. Additionally, multiple testicular calcifications were found. These are included in the criteria for CNC. The calcifications may be found in coexistence with a large-cell calcifying Sertoli cell tumor or they may occur separately in the testes in the absence of this tumor.9,22-25 Testicular microcalcifications set within scarred stromal tissue may also represent remnants of regressed germ cell tumors, especially choriocarcinomas,
Kacerovska et al 85
J AM ACAD DERMATOL VOLUME 61, NUMBER 1
Table II. Diagnostic criteria for CNC according to Stratakis, Kirschner, and Carney21* 1
2 3 4 5
6 7 8
9 10
Spotty skin pigmentation with typical distribution (lips, conjunctiva, and inner or outer canthi, vaginal and penile mucosa) Myxoma (cutaneous and mucosal)y Cardiac myxomay Breast myxomatosisy or fat-suppressed MRI findings suggestive of this diagnosis PPNADy or paradoxical positive response of urinary glucocorticosteroids to dexamethasone administration during Liddle’s test Acromegaly due to GH-producing adenomay LCCSCTy or characteristic calcification on testicular ultrasonography Thyroid carcinomay or multiple, hypoechoic nodules on thyroid ultrasonography, in a young patient Psammomatous melanotic schwannomay Blue nevus, epithelioid blue nevus (multiple)y Breast ductal adenoma (multiple)y Osteochondromyxomay
11 12 Supplemental criteria 1 Affected first-degree relative 2 Inactivating mutation of the PRKAR1A gene
Fig 6. A-C, In external ear canal lesion, overlying epithelium exhibits tiny buds and interconnected strands of epithelial cells with peripheral palisading. (A-C, Hematoxylin-eosin stain.)
which should be taken into consideration when constructing the differential diagnosis.26,27 The histologic picture of all tumors in our patient was typical, including the epithelial proliferations in the lesion that came from the external ear canal.25 An interesting feature was the presence of an incipient myxoma in the vicinity of a hair follicle, with the specific stroma of the follicular papilla seemingly replaced by the myxomatous elements that appeared to be part of the myxoma (see Fig 5, D). Although mucin can occasionally be recognized in otherwise normal follicular papillae, never has this feature had such a prominent presentation. We believe that the association of myxomas and hair follicle differentiation in CNC is not a simple coincidence and the significance of this association maybe under-recognized. Although commonly referred to as ‘‘epithelial components,’’ these epithelial proliferations, on
CNC, Carney complex; GH, growth hormone; LCCSCT, large-cell calcifying Sertoli cell tumor; MRI, magnetic resonance imaging; PPNAD, primary pigmented nodular adrenocortical disease. *To make a diagnosis of CNC, a patient must exhibit either two of the manifestations of the disease listed or one of these manifestations and one of the supplemental criteria. y With histologic confirmation.
scrutiny, often evidence various features that can be interpreted as signs of follicular differentiation toward the follicular germ, trichogenic stroma, including follicular papilla, isthmus, infundibulum, and mantle.19,25,28,29 Application of a rigorous screening protocol for all first-degree relative of patients affected with CNS showed an increase in a number of familial cases. In a recent review, Stratakis, Kirschner, and Carney21 identified 338 patients with CNC reported worldwide, a majority of whom (70%) belonged to 67 affected families, whereas only 88 individuals had no known affected relative. The authors suggested that some familial cases may have gone unrecognized, resulting in an ‘‘increase’’ of ‘‘sporadic’’ cases. The clinical variability of the disease and the small size of affected CNC families because of infertility are thought to contribute to this under-recognition.
86 Kacerovska et al
J AM ACAD DERMATOL JULY 2009
Fig 7. Heterozygous shift mutation c.796dupA in exon 10 of PRKAR1A gene using forward primer.
Mutations in the PRKAR1A gene have been identified in approximately 65% of the CNC patients, in both familial and sporadic cases.18 In our case, we detected a novel heterozygous shift mutation c.796dupA in exon 10 of the PRKAR1A gene. This mutation leads to a frameshift creating a new stop codon. The biologic effect of this mutation is production of a truncated and probably inactive protein. To our knowledge, this mutation has not been described. Neither was this alteration detected in 110 unrelated healthy individuals we investigated. The parents and two brothers of the patient had no clinical features of CNC, and the analysis of their blood for PRKAR1A mutations showed no alteration, thus indicating that our patient had a sporadic form of the disease. In summary, we have described a sporadic case of CNC, with a novel mutation in exon 10 of the PRKAR1A gene, with typical clinical features including cardiac myxomas, cutaneous myxomas, a blue nevus, and multiple testicular calcifications.
REFERENCES 1. Rees JR, Ross FG, Keen G. Lentiginosis and left atrial myxoma. Br Heart J 1973;35:874-6. 2. Carney JA, Gordon H, Carpenter PC, Shenoy BV, Go VL. The complex of myxomas, spotty pigmentation, and endocrine overactivity. Medicine (Baltimore) 1985;64:270-83. 3. Carney DF, Koski CL, Shin ML. Elimination of terminal complement intermediates from the plasma membrane of nucleated cells: the rate of disappearance differs for cells carrying C5b-7 or C5b-8 or a mixture of C5b-8 with a limited number of C5b-9. J Immunol 1985;134:1804-9. 4. Washecka R, Dresner MI, Honda SA. Testicular tumors in Carney’s complex. J Urol 2002;167:1299-302. 5. Carney JA. Psammomatous melanotic schwannoma. A distinctive, heritable tumor with special associations, including cardiac myxoma and the Cushing syndrome. Am J Surg Pathol 1990;14:206-22. 6. Martin-Reay DG, Shattuck MC, Guthrie FW Jr. Psammomatous melanotic schwannoma: an additional component of Carney’s complex. Report of a case. Am J Clin Pathol 1991;95:484-9. 7. Carney JA, Stratakis CA. Epithelioid blue nevus and psammomatous melanotic schwannoma: the unusual pigmented skin tumors of the Carney complex. Semin Diagn Pathol 1998;15: 216-24. 8. Carney JA, Ferreiro JA. The epithelioid blue nevus. A multicentric familial tumor with important associations, including cardiac myxoma and psammomatous melanotic schwannoma. Am J Surg Pathol 1996;20:259-72.
9. Carney JA, Boccon-Gibod L, Jarka DE, Tanaka Y, Swee RG, Unni KK, et al. Osteochondromyxoma of bone: a congenital tumor associated with lentigines and other unusual disorders. Am J Surg Pathol 2001;25:164-76. 10. Stratakis CA, Courcoutsakis NA, Abati A, Filie A, Doppman JL, Carney JA, et al. Thyroid gland abnormalities in patients with the syndrome of spotty skin pigmentation, myxomas, endocrine overactivity, and schwannomas (Carney complex). J Clin Endocrinol Metab 1997;82:2037-43. 11. Cohen C, Turner ML, Stratakis CA. Pigmented lesions of the conjunctiva in Carney’s complex. J Am Acad Dermatol 2000; 42:145. 12. Papageorgiou T, Stratakis CA. Ovarian tumors associated with multiple endocrine neoplasias and related syndromes (Carney complex, Peutz-Jeghers syndrome, von Hippel-Lindau disease, Cowden’s disease). Int J Gynecol Cancer 2002;12:337-47. 13. Akbas H, Kirali K, Daglar B, Kutay V, Isik O, Yakut C. Surgical treatment of left-atrial myxoma in Carney’s complex. Thorac Cardiovasc Surg 1997;45:148-50. 14. Yarman S, Gurbuz L, Tanakol R, Kapran Y, Alagol F. Association of Fallot tetralogy with Carney’s complex. Ir Med J 2001;94: 305-7. 15. Stratakis CA, Carney JA, Lin JP, Papanicolaou DA, Karl M, Kastner DL, et al. Carney complex, a familial multiple neoplasia and lentiginosis syndrome. Analysis of 11 kindreds and linkage to the short arm of chromosome 2. J Clin Invest 1996;97:699-705. 16. Casey M, Mah C, Merliss AD, Kirschner LS, Taymans SE, Denio AE, et al. Identification of a novel genetic locus for familial cardiac myxomas and Carney complex. Circulation 1998;98: 2560-6. 17. Sassone-Corsi P. Coupling gene expression to cAMP signalling: role of CREB and CREM. Int J Biochem Cell Biol 1998;30: 27-38. 18. Kirschner LS, Carney JA, Pack SD, Taymans SE, Giatzakis C, Cho YS, et al. Mutations of the gene encoding the protein kinase A type I-alpha regulatory subunit in patients with the Carney complex. Nat Genet 2000;26:89-92. 19. LeBoit PE, Gu¨nter B, Weedon D, Sarasin A. Pathology & Genetics Skin Tumours. World Health Organization Classification of Tumours. Lyon: IARC Press; 2006. 20. Matyakhina L, Pack S, Kirschner LS, Pak E, Mannan P, Jaikumar J, et al. Chromosome 2 (2p16) abnormalities in Carney complex tumours. J Med Genet 2003;40:268-77. 21. Stratakis CA, Kirschner LS, Carney JA. Clinical and molecular features of the Carney complex: diagnostic criteria and recommendations for patient evaluation. J Clin Endocrinol Metab 2001;86:4041-6. 22. Kennedy RH, Waller RR, Carney JA. Ocular pigmented spots and eyelid myxomas. Am J Ophthalmol 1987;104:533-8. 23. Grossniklaus HE, McLean IW, Gillespie JJ. Bilateral eyelid myxomas in Carney’s complex. Br J Ophthalmol 1991;75: 251-2. 24. Palva T, Saksela E, Ramsay H. Myxoma of the external auditory meatus. J Laryngol Otol 1991;105:364-6. 25. Ferreiro JA, Carney JA. Myxomas of the external ear and their significance. Am J Surg Pathol 1994;18:274-80.
J AM ACAD DERMATOL
Kacerovska et al 87
VOLUME 61, NUMBER 1
26. Azzopardi JG, Mostofi FK, Theiss EA. Lesions of testes observed in certain patients with widespread choriocarcinoma and related tumors. The significance and genesis of hematoxylin-staining bodies in the human testis. Am J Pathol 1961;38: 207-25. 27. Renshaw AA. Testicular calcifications: incidence, histology and proposed pathological criteria for testicular microlithiasis. J Urol 1998;160:1625-8.
28. Carney JA, Headington JT, Su WP. Cutaneous myxomas. A major component of the complex of myxomas, spotty pigmentation, and endocrine overactivity. Arch Dermatol 1986; 122:790-8. 29. Bennett KR, Heath BJ, Creswell LL, Veugelers MA, McDermott DA, Barksdale S, et al. The Carney complex: unusual skin findings and recurrent cardiac myxoma. Arch Dermatol 2005; 141:916-8.