Case Study : Polymelia in a Holstein calf

The Professional Animal Scientist 33:378–386 https://doi.org/10.15232/pas.2016-01594 ©2017 American Registry of Professional Animal Scientists. All rights reserved.

Case Study: Polymelia in a Holstein calf M. Neupane,* K. D. Moss,* F. Avila,† T. Raudsepp,‡ B. M. Marron,§ J. E. Beever,§ S. Parish,# J. N. Kiser,* B. Cantrell,* and H. L. Neibergs*1 *Department of Animal Sciences, Washington State University, Pullman 99164; †Department of Veterinary Population Medicine, University of Minnesota, Minneapolis 55455; ‡Department of Veterinary Integrative Biosciences, Texas A&M University, College Station 77843; §Department of Animal Sciences, University of Illinois, Champaign 61801; and #Large Animal Internal Medicine, Washington State University, Pullman 99164

ABSTRACT

INTRODUCTION

Polymelia, the manifestation of extra limbs or parts of limbs, occurs when there is a developmental duplication in the novel NHL repeat domain containing protein (NHLRC2) gene in Angus cattle. In Holstein cattle, little is known about the etiology of polymelia. To determine the genetic etiology of polymelia in a Holstein calf, genotyping and sequencing of the Angus developmental duplication locus, karyotyping, and a genome-wide association analysis were performed. The genome-wide association analysis compared the polymelia calf (case) to 2,650 control (normal) Holstein calves using EMMAX-GRM (Efficient Mixed-Model Association eXpedited-Genomic Relationship Matrix) software. In addition, homozygous loci within genes in the case that were never found in a control were also evaluated as putative loci. The polymelia calf had a normal Angus developmental duplication genotype that was confirmed by sequencing. Karyotyping revealed no evidence of chromosomal breakage or gross chromosomal abnormalities in the polymelia calf. The additive genome-wide association analysis identified loci associated with polymelia on BTA13 (P < 1 × 10−281) and BTA10 (P < 2 × 10−110). Seventy-nine candidate genes were identified that contained homozygous genotypes in the case that were never identified in 2,650 controls. Candidate genes include MSH homeobox 2 (MSX2) on BTA20, which has been associated with limb development in mice, and GINS complex subunit 1 (GINS1) on BTA13, which is involved in early embryogenesis in mice. In summary, these results suggest that the etiology of polymelia differs by cattle breed and is the result of genetic variants at more than one locus.

Polymelia is a rare condition that causes an animal to be born with more than the expected number of limbs or parts of limbs. Polymelia has been observed in HolsteinFriesian (Hirsbrunner et al., 2002; Nowacka et al., 2007; Muirhead et al., 2014), Angus (Denholm et al., 2011; Beever, 2013), Hereford (Johnston, 1985), Brahman (Fourie, 1990), Mashona (Murondoti and Busayi, 2001), and Korean native cattle (Kim et al., 2001). It is also often associated with other limb defects such as polydactyly or an absence of digits (Murondoti and Busayi, 2001). The etiology of polymelia in Holsteins has been suggested to be due to spontaneous (de novo) or inherited genetic mutations, partial development of conjoined twins, fetal or maternal exposure to radiation or toxins, or maternal injuries that disrupt fetal development (Rousseaux and Ribble, 1988; Kim et al., 2001). One study in Holstein cattle and one study in Mediterranean Italian buffaloes have reported that high rates of chromosomal damage were present in animals with polymelia, and it was speculated that this damage may have been due to environmental factors, although no genotoxic factor in the animals’ environments were identified (Nowacka et al., 2007; Albarella et al., 2009). In Angus cattle, inherited mutations in the novel NHL repeat domain containing protein (NHLRC2) gene are responsible for polymelia and are referred to as development duplication (DD) to distinguish these variants from other unique phenotypes associated with mutations in NHLRC2 (Denholm et al., 2011; Beever, 2013). The allele frequency of the deleterious DD NHLRC2 allele among United States Angus sires is approximately 3%. Genetic testing for the deleterious allele of NHLRC2 is now available and is recommended by the American Angus Association (Beever, 2013) to reduce the number of calves with polymelia. This case represents a male Holstein calf that was presented to the Washington State University Veterinary Teaching Hospital with bilateral thoracomelia. The objective of the study was to determine whether polymelia in the Holstein calf was due to (1) high rates of chromosomal damage, (2) an inherited mutation in NHLRC2 (the

Key words: polymelia, genetics, Holstein

Corresponding author: [email protected]

1

Polymelia case study

DD mutation seen in Angus cattle or other mutations in NHLRC2), or (3) loci yet to be identified as associated with polymelia.

MATERIALS AND METHODS Study Population All animal care and sample collections were approved and performed in accordance with the Institutional Animal Care and Use Committee at the Washington State University (04110). A 5-mo-old Holstein bull donated to Washington State University in July 2013 was used in this study. The calf presented with bilateral thoracomelia, weighed 90.7 kg, and had a BCS of 2.5/5. It was bright, alert, responsive, eating, and ambulating normally at the time of presentation. It had a heart rate of 80 beats per minute and a respiratory rate of 28 breaths per minute. Cardiac and pulmonary auscultations were normal. There were 2 rumen contractions per minute, and his rectal temperature was 38.7°C. Clinical examination revealed 2 additional functioning limbs originating from the dorsal midline at the level of the scapula. The left additional leg was slightly thicker and more developed with nervous sensation through its entire length, with decreasing sensation in the distal half. The calf also had scoliosis of the spine and a corkscrew tail. The anus was functional but on its dorsal aspect (Figure 1). At 7 mo of age, the supernumerary limbs were sur-

379

gically removed under general anesthesia. The diaphyses of both extra humeri were cut through, and postoperative recovery went well. The calf was euthanized at the age of 15 mo due to an illness. In addition to the Holstein calf with polymelia (the case), 2,650 Holstein calves without polymelia were used as controls. Samples from the control Holstein calves were collected for a study on bovine respiratory disease in preweaned calves as previously described (Neibergs et al., 2014). None of the control calves had any phenotypic characteristics consistent with polymelia.

Sample Collection A 10-mL blood sample was taken from the jugular vein of the polymelia calf and each control calf and collected into vacutainer blood tubes containing EDTA for DNA isolation for genotyping and sequencing. A 5-mL blood sample was additionally collected from the polymelia calf and placed in a blood tube with sodium-heparin for karyotyping to identify whether there were chromosomal abnormalities.

Karyotyping Chromosome preparations for karyotyping were made from short-term phytohemagglutinin stimulated peripheral blood lymphocyte cultures following standardized methods (Raudsepp and Chowdhary, 2008). Chromosomes were

Figure 1. Male Holstein calf with polymelia. (A) Left side of calf showing scoliosis, corkscrew tail, and an additional left front forelimb originating from the left scapula, and the head of an additional right front forelimb originating from the right scapula; (B) left dorsal lateral view of the corkscrew tail; (C) right side of the calf showing an extra forelimb originating from the right scapula; (D) dorsal view of the extra forelimbs originating from both scapulae; (E) a closer view of the anterior left side of the figure in (A). Color version available online.

380

Neupane et al.

stained with 5% Giemsa solution (Sigma Aldrich, St. Louis, MO), and the metaphase chromosomes of 2 cells were photographed using a Zeiss Axioplan2 microscope (Carl Zeiss MicroImaging GmbH, Gottingen, Germany) and arranged into a karyotype according to size and morphology with the Ikaros Karyotyping System software (MetaSystems GmbH, Altlussheim, Germany) photographed. The karyotype of the polymelia calf was compared with reference karyotypes of normal calves.

DNA Isolation Bovine DNA was isolated from 3 mL of whole blood using the Puregene DNA extraction kit, according to the manufacturer’s instructions (Gentra, Minneapolis, MN). The DNA of each animal was quantified and its purity estimated using spectrophotometry (NanoDrop 1000, Thermo Fisher, Wilmington, DE). The DNA samples with 260/280 ratios of 1.8 to 2.0 were diluted to 50 ng/μL, and 250 ng of DNA was genotyped using the Illumina BovineHD BeadChip (San Diego, CA) at Neogen Laboratories (Lincoln, NE). White blood cell pellets were prepared from the remaining blood and stored at −80°C.

Restriction Fragment Length Polymorphism for the DD in Angus The polymelia Holstein calf was tested for the NHLRC2 allele associated with polymelia (DD) in Angus cattle. The PCR-restriction fragment length polymorphism (RFLP) analysis was conducted using an upstream primer (5′-GGTTTTGGTAGAGGCATGATGA-3′) and a downstream primer (5′-GACCTTCCAAAAACTACATCCC-3′) to produce a 435-bp product. A positive control for the Angus DD and normal allele and a negative control (without DNA) were also run with the Holstein sample to determine that the PCR was working properly and that there was no DNA contamination. Thermal cycling conditions consisted of 35 cycles of denaturing at 94°C for 45 s, an annealing temperature of 58°C for 45 s, and extension at 72°C for 45 s in a GeneAmp PCR System 9700, Applied Biosystems (Foster City, CA) thermocycler. Polymerase chain reaction products were subjected to 2 U of MwoI incubated at 60°C for 15 min and were resolved in a 3% agarose gel to identify genotypes after 2 μL of 6× orange tracking dye (ThermoFisher Scientific, Waltham, MA) was added to each sample. The PCR-RFLP products of the polymelia

Table 1. Novel NHL repeat domain containing protein (NHLRC2) gene amplicons that were used for sequencing Primer name1 NHLRC1_1F NHLRC1_1R NHLRC1_2F NHLRC1_2R NHLRC1_3F NHLRC1_3R NHLRC1_4F NHLRC1_4R NHLRC1_5F NHLRC1_5R NHLRC1_6F NHLRC1_6R NHLRC1_7F NHLRC1_7R NHLRC1_8F NHLRC1_8R NHLRC1_9F NHLRC1_9R NHLRC1_10F NHLRC1_10R NHLRC1_11AF NHLRC1_11AR NHLRC1_11BF NHLRC1_11BR NHLRC1_11CF NHLRC1_11CR 1

 

Primer sequence GTTCTGAATGTCCAGGCTCC GAGACGAAGATGCAGGTTCC GATCTTCCTTTCACACACAG AGCCTAGTGACAGTTCCTAA ATGTGACAATCAGTACCAGC GTCAATGTATATTGCCCTTC GTATCTCGGGAAACAGGTTA GGGACAAAGCATCACTTTAC AGGGATATGTGAGTTTGGAT CGAAAACTGCAACTAAGATG TCCTGTATTCTTGAAGCGTG CGTTCATTATGGCAGCATAG TACCTGCCTCTCATCATTTG TTTATCCTTCCTTCCTCTCG CGAGAGGAAGGAAGGATAAA GCTAACTATGCAAAGGCTCA CATAGTGTTTAGCTCTCAGG CTGCTCTGTCTATATGCTTC CCTTGACATTGAACCTCACT AGTCCACCTCGTGATGAACT CAAGATGGCTAGATTAGGGA GCCAAGTAACAGCACAGATT ACCAACGAAGTCACTGACCA GCAACAAGGCGTATTATGCT TTACTGCATGTGACACCACT ATGACTATGGCCTATTCTCC

F = forward; R = reverse.

Amplicon size (bp) 632   798   967   621   909   611   828   824   550   603   949   1,187   881  

381

Polymelia case study

calf were visualized and compared with the exACT Gene 50bp mini DNA Ladder (ThermoFisher Scientific) and the PCR positive and negative controls to determine the genotype of the Holstein calf. A homozygous normal genotype was represented by a 435-bp PCR fragment, a homozygous DD affected genotype was represented by 326- and 109-bp fragments, and a heterozygous DD genotype was represented by 435-, 326-, and 109-bp fragments. Homozygous positive (affected Angus), heterozygous (carrier), and homozygous normal (unaffected Angus) cattle’s DNA for DD were provided by J. Beever to compare with the Holstein calf with polymelia. In addition, the NHLRC2 gene was sequenced to find novel variants associated with polymelia in the affected Holstein calf and included evaluation of all 11 exons, exon/intron boundaries, and the complete 3′ untranslated region. Direct sequencing of PCR amplicons for the NHLRC2 gene (Table 1) were performed using standard Sanger sequencing method. The DNA of the affected Holstein calf was compared with the UMD 3.1 bovine assembly (http://BovineGenome.org) as a reference.

Whole Genome Genotyping All normal (control) calves had been previously genotyped as part of a separate study with the Illumina BovineHD Genotyping BeadChip (Neibergs et al., 2014). The polymelia calf was also genotyped with the BovineHD Genotyping BeadChip, which contained 777,962 SNP, with mean and median intermarker SNP spacing every 3.43 and 2.68 kb across the bovine genome, respectively (http:// res.illumina.com/documents/products/datasheets/datasheet_bovinehd.pdf).

Genome-Wide Association Analyses For the genome-wide association analysis (GWAA), a case–control design was used. The sole case thoracomelia calf was compared with 2,650 Holstein control calves.

Figure 2. The normal karyotype of the polymelia Holstein calf.

An additive model of the Efficient Mixed-Model Association eXpedited-Genomic Relationship Matrix (EMMAXGRM) statistical approach within the SNP and Variation Suite 8.0 (Golden Helix, Bozeman, MT) was used for the GWAA to identify loci associated with polymelia. Prior to the GWAA, SNP were removed that had a minor allele frequency <1%, had a SNP call rate <95%, or failed the Hardy-Weinberg equilibrium test (P < 1 × 10−100). After quality control filtering, 624,460 SNP were included in the final analysis. Because only one case was available for the study, genotype frequencies for the case were either 0 or 100% for each SNP, which skews the statistics and resulted in an apparent difference between genotype frequencies for the cases and controls due to the lack of a normal distribution of genotypic frequencies in the cases. To account for the high possibility of a false positive due to having only one case, the significance threshold for a difference in genotypic frequency in the additive model between cases and controls was made more stringent (P < 1.0 × 10−100) to identify putative loci that differed between the case and controls. Genome-wide genotyping analysis was also conducted to identify whether there were homozygous genotypes in the case that were never found as homozygous genotype in the control calves. This was done to evaluate whether an unidentified homozygous recessive locus associated with polymelia in Holstein calves was detrimental to embryonic fitness as well as resulting in extra limbs.

RESULTS AND DISCUSSION Although earlier case reports suggested chromosomal breakage of 61 to 94% in a karyotype of a polymelia calf (Nowacka et al., 2007), a normal karyotype was observed in this case without evidence of abnormal chromosomal breakage (Figure 2). The PCR-RFLP DD genotype of the polymelia Holstein calf for the NHLRC2 allele associated

382

Neupane et al.

Figure 3. The PCR-restriction fragment length polymorphism (RFLP) products for the developmental duplication (DD) mutation present in the NHLRC2 gene in Angus cattle. Angus DNA samples were used as positive and negative controls for the PCR-RFLP for comparison with the genotype of the Holstein polymelia calf. Lane 1 shows the genotype of an affected homozygous DD Angus animal with a PCR-RFLP fragment size of 326 and 109 bp. Lane 2 shows the genotype of an unaffected homozygous Angus, and lane 4 shows the genotype of the polymelia Holstein calf, which matches the genotype of the unaffected Angus DD genotype. Both lane 2 and lane 4 have a PCR-RFLP fragment at 435 bp. Lane 3 shows an Angus animal that is a carrier for DD (heterozygote) with PCR-RFLP fragments at 435, 326, and 109 bp. The DNA for the affected and unaffected Angus calves, serving as positive and negative controls for the PCR-RFLP, were kindly provided by J. E. Beever.

with polymelia in Angus cattle revealed a normal homozygous Angus genotype (Figure 3). To investigate whether other DNA variants were present in NHLRC2 that might be responsible for the polymelia phenotype, sequencing of the entire gene was conducted, but no deleterious variants were observed.

The GWAA with the additive model revealed 2 loci associated with polymelia on BTA13 (P < 1 × 10−281), and BTA10 (P < 2 × 10−110; Figure 4). The SNP (rs134112317) resides within an intron of the GINS complex subunit 1 (GINS1) gene. This gene, on BTA13, plays an important role in the initiation and progression of DNA replication. This gene has also been shown to play an essential role in early embryogenesis in mice (Ueno et al., 2005). The GINS1 gene is also widely expressed in stem and progenitor cells and implicated in many forms of carcinoma (Nagahama et al., 2010). The nearest genes to the locus on BTA10 are the myocardial zonula adherens protein (MYZAP) and Cingulin-like 1 (CGNL1). These genes have not previously been shown to be involved in limb bud formation or other functions associated with supernumerary limbs. In rare congenital conditions, affected individuals may be the result of a homozygous recessive genotype that may be detrimental to the embryo, resulting in a heightened level of embryonic death in many of the affected animals. In Angus cattle, the DD homozygote was observed in fewer calves than would be expected in Hardy-Weinberg equilibrium, suggesting that the homozygous DD genotype may be detrimental to embryonic survival or it may be a consequence of a lack of random mating within the Angus breed (Beever, 2013). To determine whether an unidentified homozygous recessive locus associated with polymelia in Holstein calves was detrimental to embryonic fitness, homozygous genotypes were sought in the case that were never found in the control Holstein calves. Seventy-nine homozygous genotypes in the affected Holstein calf were never identified as homozygotes in the control Holstein calves (Table 2). The MSH homeobox 2 (MSX2) gene on BTA20 (rs43458208) was particularly interesting because it has been shown to be involved in limb development and digit formation in many species (Koshiba et al., 1998). The MSX2 gene is conserved in human, chimpanzee, rhesus monkey, dog, mouse, rat, chicken, zebrafish, and frogs. In mice, Msx1 and Msx2 double mutants have shorter limbs, an abnormal number of digits, or both (Bensoussan-Trigano et al., 2011). In humans and Drosophila, homeoboxrelated (HOX) genes were also associated with limb formation (Debeer et al., 2002; Goodman, 2002). Although genes such as fibroblast growth factors (FGF8, FGF10)

Figure 4. Loci on BTA10 and BTA13 (P < 1 × 10−100) associated with polymelia in a genome-wide association study (additive Efficient Mixed-Model Association eXpedited-Genomic Relationship Matrix model) of a single Holstein polymelia calf and 2,650 normal Holstein calves. The −log10 P-values are shown on the y-axis, and the bovine chromosomes are displayed on the x-axis. Each dot in the figure represents a SNP. Color version available online.

Polymelia case study

383

Table 2. Genes with SNP that were only homozygous in the polymelia Holstein calf but were never homozygous in normal Holstein calves Chromosome1 Position of SNP2 (bp)  

SNP ID3

1 1 1

3,668,868 157,256,135 129,012,606

rs43217139 rs43284108 rs137330313

2 2 2

566,711 119,371,276 41,389,911

rs135924279 rs137650927 rs42465923

2 2

18,835,776 94,907,784

rs43272344 rs136083992

3 3 3

57,821,484 52,415,820 120,858,058

rs136172634 rs133189178 rs109909944

3

29,695,091

rs133333796

4 4 4

11,738,947 104,924,952 87,619,355

rs715101292 rs135055573 rs136284244

5 5 5 6 7

72,443,833 957,175,587 42,651,311 42,656,382 82,790,426 89,357,658

rs42570401 rs135037914 rs109261646 rs41601399 rs109840573 rs43530695

7 8

26,875,167 24,641,702

rs136151573 rs109962043

8

54,041,116

rs110725344

8

79,663,742

rs110157593

8

61,224,926

rs132911551

8 8

91,918,282 53,941,523

rs135798498 rs41793384

9 9 9 9

68,790,041 75,131,790 51,551,999 51,517,983 51,556,730 12,713,405

rs136942222 rs110536347 rs132634328 rs133356950 rs42407940 rs136766323

9 9 10 10 10 11

64,797,265 15,577,354 89,563,894 93,708,426 4,602,846 95,138,216

rs136987670 rs43587822 rs135403039 rs43651443 rs134629105 rs137305815

 

Gene4 T-cell lymphoma invasion and metastasis 1 (TIAM1) Bos taurus SATB homeobox 1 (SATB1) Bos taurus solute carrier family 25, member 36 (SLC25A36) Oculocutaneous albinism II (OCA2) Bos taurus calcium binding protein 39 (CAB39) Potassium inwardly-rectifying channel, subfamily J, member 3 (KCNJ3) Bos taurus phosphodiesterase 11A (PDE11A) Bos taurus NADH dehydrogenase (ubiquinone) Fe-S protein 1 (NDUFS1) Bos taurus outer dense fiber of sperm tails 2-like (ODF2L) Bos taurus zinc finger protein 644 (ZNF644) Bos taurus protein phosphatase 1, regulatory subunit 7 (PPP1R7) Protein tyrosine phosphatase, non-receptor type 22 (lymphoid) (PTPN22) CAS1 domain containing 1 (CASD1) v-raf murine sarcoma viral oncogene homolog B (BRAF) Bos taurus Ca++-dependent secretion activator 2 (CADPS2) Like-glycosyltransferase (LARGE) Bos taurus phospholipase B domain containing 1 (PLBD1) Bos taurus copine VIII (CPNE8) EPH receptor A5 (EPHA5) RAS p21 protein activator (GTPase activating protein) 1 (RASA1) Fibrillin 2 (FBN2) Solute carrier family 24 (sodium/potassium/calcium exchanger), member 2 (SLC24A2) Bos taurus guanine nucleotide binding protein (G protein), q polypeptide (GNAQ) Bos taurus neurotrophic tyrosine kinase, receptor, type 2 (NTRK2) Bos taurus maternal embryonic leucine zipper kinase (MELK) Bos taurus muscle-related coiled-coil protein (MURC) Bos taurus guanine nucleotide binding protein (G protein), α 14 (GNA14) Bos taurus Rho GTPase activating protein (ARHGAP18) Bos taurus phosphodiesterase 7B (PDE7B) F-box and leucine-rich repeat protein 4 (FBXL4) Potassium voltage-gated channel, KQT-like subfamily, member 5 (KCNQ5) Bos taurus sorting nexin 14 (SNX14) SUMO1/sentrin specific peptidase 6 (SENP6) Protein-O-mannosyltransferase 2 (POMT2) Stonin 2 (STON2) Bos taurus cysteine dioxygenase, type I (CDO1) LIM homeobox 2, 2 splice variants (LHX2) (Continued)

384

Neupane et al.

Table 2 (Continued). Genes with SNP that were only homozygous in the polymelia Holstein calf but were never homozygous in normal Holstein calves Chromosome1 Position of SNP2 (bp)  

SNP ID3

12

87,137,077

rs43113681

12 13

48,896,550 1,195,500

rs134431346 rs42303794

13 13 13

19,986,012 36,970,158 11,736,460

rs29017979 rs109945766 rs108959602

13 13

54,367,283 21,073,519

rs134692327 rs110372588

13

15 15 16 16

6,814,890 6,815,354 4,613,912 67,840,016 68,851,390 62,410,660 36,929,471 36,925,734 64,975,686 36,894,683 44,649,601 44,650,850 85,019,543 65,081,896 79,525,143 74,456,964

rs42279871 rs110769717 rs521094166 rs133070295 rs109086747 rs135351349 rs132674363 rs135027873 rs136568159 rs133528960 rs42824174 rs42824177 rs137587760 rs137149200 rs133034385 rs41256226

16

69,539,999

rs136964332

17 18 19

20 21

73,371,398 44,835,521 28,126,539 28,122,433 28,335,576 28,340,572 28,077,597 28,690,493 21,077,075 6,360,647 31,811,519 31,821,827 59,342,623 57,396,623

rs134911160 rs41571869 rs109978703 rs41910209 rs42882128 rs42882122 rs135020590 rs43331704 rs110319271 rs43458208 rs137709468 rs133318958 rs41953767 rs133959890

22 22

19,301,738 21,645,703

rs109070830 rs110598735

22 22 23 23

47,700,812 61,307,183 50,798,697 768,340

rs109459725 rs133626865 rs42036475 rs719414227

14 14 14 14 14 14 15 15

19 19 19 20 20

 

Gene4 Bos taurus family with sequence similarity 155, member A (FAM155A) Kruppel-like factor 12 (KLF12) Bos taurus phospholipase C, β 1 (phosphoinositidespecific) (PLCB1) Neuropilin 1 (NRP1) Armadillo repeat containing 4 (ARMC4) Calcium/calmodulin-dependent protein kinase ID (CAMK1D) Uridine-cytidine kinase 1-like 1 (UCKL1) MAM and LDL receptor class A domain containing 1 (MALRD1) Serine palmitoyltransferase, long chain base subunit 3 (SPTLC3) Trafficking protein particle complex 9 (TRAPPC9) Bos taurus serine/threonine kinase 3 (STK3) Bos taurus metadherin (MTDH) Dihydropyrimidinase (DPYS) Eyes absent homolog 1 (Drosophila) (EYA1) Grainyhead-like 2 (Drosophila) (GRHL2) SRY (sex determining region Y)-box 6 (SOX6) Bos taurus serine/threonine kinase 33 (STK33) 3-β-Glucuronosyltransferase 1 (B3GAT1) KIAA1549-like (KIAA15) Protein tyrosine phosphatase, receptor type, C (PTPRC) Potassium voltage-gated channel subfamily H member 1 (KCNH1) Bos taurus phospholipase A2, group IVA (cytosolic, calcium-dependent) (PLA2G4A) Calcineurin binding protein 1 (CABIN1) LSM14A, SCD6 homolog A (S. cerevisiae) (LSM14A) Dynein, axonemal, heavy chain 2 (DNAH2) Bos taurus arachidonate 12-lipoxygenase, 12R type (ALOX12B) Bos taurus myosin, heavy chain 10, non-muscle (MYH10) Myosin XVIIIA (MYO18A) Bos taurus msh homeobox 2 (MSX2) Coiled-coil domain containing 152 (CCDC152) Dynein, axonemal, heavy chain 5 (DNAH5) Bos taurus cleavage and polyadenylation specific factor 2 (CPSF2) Bos taurus glutamate receptor, metabotropic 7 (GRM7) Bos taurus inositol 1,4,5-trisphosphate receptor, type 1 (ITPR1) Choline dehydrogenase (CHDH) Plexin A1 (PLXNA1) Myosin light chain kinase family, member 4 (MYLK4) KH domain containing, RNA binding, signal transduction associated 2 (KHDRBS2) (Continued)

385

Polymelia case study

Table 2 (Continued). Genes with SNP that were only homozygous in the polymelia Holstein calf but were never homozygous in normal Holstein calves Chromosome1 Position of SNP2 (bp)  

SNP ID3

28 28

8,997,034 5,903,689

rs133406406 rs134869114

28 29

10,230,625 5,954,708

rs110225546 rs109357403

 

Gene4 ERO1-like β (Saccharomyces cerevisiae) (ERO1LB) Bos taurus nucleoside-triphosphatase, cancer-related (NTPCR) Ryanodine receptor 2 (cardiac) (RYR2) Folate hydrolase (prostate-specific membrane antigen) 1 (FOLH1)

Chromosome location of the gene. Single nucleotide polymorphism location as measured by numbered nucleotides in reference to the UMD 3.1 (http:// BovineGenome.org) genome assembly. 3 The SNP that was homozygous in the polymelia calf but never homozygous in 2,650 control calves as identified by rs number, a reference number assigned to markers submitted to the National Center for Biotechnology Information SNP database. 4 Positional candidate genes are defined as genes that are located within the homozygous SNP. 1 2

and T-box transcription factors (TBX4, TBX5) have been shown to play a role in limb bud formation in humans, none of these genes were identified with polymelia in this study (Talamillo et al., 2005). One of the limitations of this analysis was the presence of a single case. Genome-wide association analyses are not well suited to an experimental design with a single case, because the genotypic frequencies are distributed across only a single individual, accentuating differences between the case and a population distribution of genotypic frequencies in the controls that may not be due to the phenotype. To account for this limitation, and to identify loci that may be associated with polymelia, a more stringent significance threshold was employed and 3 putative loci were identified as associated with polymelia. However, with a single case, it is impossible to determine whether other Holstein calves with polymelia would have similar results in their genetic analyses. It is not known whether the cause of polymelia in this calf is common or rare among Holstein cattle. There was no overlap across the GWAA and the loci identified as homozygous only in the polymelia calf. The examination of further Holstein cattle with polymelia will be needed to determine the importance of the loci on BTA10 and BTA13 in the etiology of polymelia in Holstein cattle in the United States. Because the DD mutation responsible for polymelia in Angus was not shared in this Holstein calf, the mutations associated with polymelia in Holsteins would have had to originate in cattle after the separation of the Holstein and Angus breeds.

IMPLICATIONS This study identifies the loci associated with polymelia in a single Holstein calf. As new cases are identified in Holsteins, the loci identified in this study can be tested to validate or refute the results found in this case report. De-

termination of the genetic basis of polymelia in Holsteins would aid in the selection of animals that were not carriers for the disorder, thus providing a mechanism to decrease its incidence. Identifying the genes involved in polymelia also provides us with an opportunity to begin to have a better understanding of the biological mechanisms responsible for polymelia in cattle and other species.

ACKNOWLEDGMENTS Funding was provided for this study by an anonymous donor.

LITERATURE CITED Albarella, S., F. Ciotola, C. Dario, L. Iannuzzi, V. Barbieri, and V. Peretti. 2009. Chromosome instability in Mediterranean Italian buffaloes affected by limb malformation (transversal hemimelia). Mutagenesis 24:471–474. https://doi.org/10.1093/mutage/gep030. Beever, J. E. 2013. Likely Presence of Genetic Condition in a Line of Angus Cattle. Accessed Aug. 2016. http://www.angus.org/pub/dd/ dd_update08122013.pdf. Bensoussan-Trigano, V., Y. Lallemand, C. Saint Cloment, and B. Robert. 2011. Msx1 and Msx2 in limb mesenchyme modulate digit number and identity. Dev. Dyn. 240:1190–1202. https://doi.org/10.1002/ dvdy.22619. Debeer, P., C. Bacchelli, P. J. Scambler, L. De Smet, J.-P. Fryns, and F. R. Goodman. 2002. Severe digital abnormalities in a patient heterozygous for both a novel missense mutation in HOXD13 and a polyalanine tract expansion in HOXA13. J. Med. Genet. 39:852–856. https://doi.org/10.1136/jmg.39.11.852. Denholm, L., L. Martin, and A. Denman. 2011. Polymelia (supernumerary limbs) in Angus calves. Accessed Oct. 2016. http://www. flockandherd.net.au/cattle/reader/polymelia.html. Fourie, S. L. 1990. Congenital supernumerary ectopic limbs in a Brahman-cross calf. J. S. Afr. Vet. Assoc. 61:68–70. Goodman, F. R. 2002. Limb malformations and the human HOX genes. Am. J. Med. Genet. 112:256–265. https://doi.org/10.1002/ ajmg.10776.

386

Neupane et al.

Hirsbrunner, G., C. Keller, and G. Dolf. 2002. Polymelia in a Holstein Friesian calf. Schweiz. Arch. Tierheilkd. 144:289–291. https:// doi.org/10.1024/0036-7281.144.6.289. Johnston, A. 1985. Polymelia in a Hereford-cross calf. Vet. Rec. 116:585–586. https://doi.org/10.1136/vr.116.22.585.

Neibergs, H. L., C. M. Seabury, A. J. Wojtowicz, Z. Wang, E. Scraggs, J. N. Kiser, M. Neupane, J. E. Womack, A. Van Eenennaam, G. R. Hagevoort, T. W. Lehenbauer, S. Aly, J. Davis, and J. F. Taylor. 2014. Susceptibility loci revealed for bovine respiratory disease complex in pre-weaned Holstein calves. BMC Genomics 15:1164 https:// doi.org/10.1186/1471-2164-15-1164.

Kim, C., S. Yeo, G. Cho, J. Lee, M. Choi, C. Won, J. Kim, and S. Lee. 2001. Polymelia with two extra forelimbs at the right scapular region in a male Korean native calf. J. Vet. Med. Sci. 63:1161–1164. https:// doi.org/10.1292/jvms.63.1161.

Nowacka, J., K. Urbaniak, P. Antosik, J. M. Jaskowski, H. Frackowiak, and M. Switonski. 2007. Polymelia associated with frequent chromosome breaks in a heifer. Vet. Rec. 161:276–277. https://doi. org/10.1136/vr.161.8.276.

Koshiba, K., A. Kuroiwa, H. Yamamoto, K. Tamura, and H. Ide. 1998. Expression of Msx genes in regenerating and developing limbs of axolotl. J. Exp. Zool. 282:703–714.

Raudsepp, T., and B. P. Chowdhary. 2008. Molecular Biology. W. Murphy, ed. pp. 31–49. Humana Press, Totowa, NJ.

Muirhead, T. L., L. Pack, and C. L. Radtke. 2014. Unilateral notomelia in a newborn Holstein calf. Can. Vet. J. 55:659–662. Murondoti, A., and R. M. Busayi. 2001. Perineomelia, polydactyly and other malformations in a Mashona calf. Vet. Rec. 148:512–513. https://doi.org/10.1136/vr.148.16.512. Nagahama, Y., M. Ueno, S. Miyamoto, E. Morii, T. Minami, N. Mochizuki, H. Saya, and N. Takakura. 2010. PSF1, a DNA replication factor expressed widely in stem and progenitor cells, drives tumorigenic and metastatic properties. Cancer Res. 70:1215–1224. https:// doi.org/10.1158/0008-5472.CAN-09-3662.

Rousseaux, C. G., and C. S. Ribble. 1988. Developmental anomalies in farm animals: II. Defining etiology. Can. Vet. J. 29:30–40. Talamillo, A., M. F. Bastida, M. Fernandez-Teran, and M. A. Ros. 2005. The developing limb and the control of the number of digits. Clin. Genet. 67:143–153. https://doi.org/10.1111/j.1399-0004.2005.00404.x. Ueno, M., M. Itoh, L. Kong, K. Sugihara, M. Asano, and N. Takakura. 2005. PSF1 is essential for early embryogenesis in mice. Mol. Cell. Biol. 25:10528–10532. https://doi.org/10.1128/MCB.25.23.1052810532.2005.