Catalytic and redox activity of nucleic acids at mercury electrodes: Roles of nucleobase residues
Journal Pre-proof Catalytic and redox activity of nucleic acids at mercury electrodes: Roles of nucleobase residues
Ludmila Římánková, Stanislav Haso...
Journal Pre-proof Catalytic and redox activity of nucleic acids at mercury electrodes: Roles of nucleobase residues
Ludmila Římánková, Stanislav Hasoň, Aleš Daňhel, Miroslav Fojta, Veronika Ostatná PII:
S1572-6657(19)31080-X
DOI:
https://doi.org/10.1016/j.jelechem.2019.113812
Reference:
JEAC 113812
To appear in:
Journal of Electroanalytical Chemistry
Received date:
7 November 2019
Revised date:
16 December 2019
Accepted date:
27 December 2019
Please cite this article as: L. Římánková, S. Hasoň, A. Daňhel, et al., Catalytic and redox activity of nucleic acids at mercury electrodes: Roles of nucleobase residues, Journal of Electroanalytical Chemistry(2018), https://doi.org/10.1016/j.jelechem.2019.113812
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Abstract Using a series of specifically designed oligonucleotides we have identified adenine and cytosine nucleobases as residues involved in catalytic hydrogen evolution reaction (CHER) of nucleic acids at the hanging mercury drop electrode (HMDE). Due to the CHER, nucleic acids yield catalytic peak HNA allowing their label-free and reagent-less analysis at low concentrations. Additionally, our results suggest that presence of the electroactive bases (adenine and cytosine) facilitates guanine reduction which is for the first time linked to a signal measurable at the HMDE - the peak P. We assume that the peak P is connected with
of
reduction of guanine to 7,8-dihydroguanine, of which reoxidation to guanine is detected at
ro
the electrode by the earlier described anodic peak G. Processes connected with the above mentioned signals were studied using cyclic voltammetry by inspection of dependences on
-p
experimental parameters such as negative vertex potential and pH.
Electrochemical activity of nucleic acids (NAs) was for the first time reported in the late 1950s using the dropping mercury electrode [1] and later it was described on other, solid
Jo ur
electrode materials (e.g. carbon [2, 3] and amalgams [4-6]). In last decades the NAs electrochemistry represents a booming field, which is predominantly aimed at developing NAs sensors and assays applicable in genomics, proteomics or biomedicine [3, 7, 8]. NAs and their interactions with charged mercury-containing surfaces could be studied thanks to faradaic signals (peaks CA and G), tensammetric signals (peaks 1, 2 and 3) [3] or recently discovered highly sensitive catalytic peak HNA [9]. Using these intrinsic signals of unlabeled NAs it is possible to study structural changes and/or damage of NAs, as well as their interactions with proteins and other biomolecules [10]. Up to now, mercury electrodes are often used in label-free analysis of NA due to their exceptional sensitivity [3, 11]. After 60 years of the NAs electrochemistry development, new information can still be obtained on the complex electrochemical processes of NAs at different electrodes [9, 12, 13]. Interactions of negatively charged mercury surface with NAs are complex, as reviewed in [3]. In brief, at neutral pH and low or moderate ionic strengths, NAs are strongly adsorbed on hydrophobic 2
Journal Pre-proof mercury surface around the potential of zero charge (pzc), so called T-region, by combination of electrostatic and hydrophobic interactions connected with the involvement of negatively charged sugar-phosphate backbone and nonpolar nucleobases, respectively. The interactions are thus influenced by NAs secondary structure and accessibility of the nucleobases. For example, in double-stranded DNA, sporadically unpaired bases located in at the ends of the DNA molecules or at the strand breaks contribute to the DNA adsorption at the mercury electrode. Potential shift to negative potentials (within so called U-region) cause repulsion between negatively charged electrode and sugar-phosphate backbone. It induces re-orientation of the adsorbed molecules, unwinding or collapse of possible secondary structures, which is
of
reflected in appearance of tensammetric peaks 1, 2, and 3 between -1.2 to -1.45 V (all potentials in this paper are given against Ag|AgCl|3M KCl) in weakly alkaline media.
ro
Application of more negative potentials (around -1.5 V) in weakly acidic media or in neutral
-p
media in the presence of ammonium ions then leads to irreversible 3 and 4 e− reduction of cytosines and adenines (in random NA sequences yielding a collective peak CA), respectively
re
[3]. At even more negative potentials chemically reversible reduction of guanine takes place. Products of the latter reduction, 7,8-dihydroguanine, provides an oxidation peak G, which
lP
appears during reverse anodic scan in cyclic voltammetry [14]. It has been proposed [15] that the above mentioned reduction process of guanine can involve chemical reduction by
na
hydrogen atoms, as evidenced by effects compounds catalyzing the hydrogen evolution such as cisplatin. Reduction products of the NAs are strongly adsorbed on the mercury surface [3,
Jo ur
16] and their desorption by applying highly negative potentials (about -2 V) or repeated cycling over relevant potential ranges is negligible. Thus, products of the primary electrochemical reductions (and of the following chemical reactions) of the nucleobases may be further reduced, which cannot be observed directly due to high currents of hydrogen evolution at the mercury electrode obscuring the putative electroreduction signals. Nevertheless, our recent studies revealed direct observation of cathodic signals due to electroreduction of guanine, thymine, uracil and 5-methylcytosine in oligodeoxynucleotides (ODNs) [17] or nucleosides [18], as well as signals attributable to oxidation of their reduction product (in analogy to the anodic peak G observed at the mercury electrodes). Regarding effects of external conditions and of different levels of DNA structure, heights of the faradaic peaks are influenced by quantity/number of the nucleobase present in the DNA strands. Our recent studies also revealed strong effects of base composition and lengths of homonucleotide stretches in ODNs [17, 19]. Depending on the external conditions, the homonucleotide stretches exhibit specific behavior at the negatively charged mercury or amalgam electrodes 3
Journal Pre-proof involving adsorption/desorption and/or 2D-condensation processes, which forms their characteristic “fingerprint” featured by the shape of C–E curves [13, 20]. Discrimination of different single-stranded DNA elements via their specific behavior at the negatively charged electrode surfaces provides a new relevant tool for electrochemical studies of DNA structure [13]. Electron yields of the NA faradaic signals are given by the corresponding reduction mechanisms which, for cytosine and adenine, involve 3-4 irreversibly transferred electrons per moiety [3], and by the number of the respective bases. Although the NAs were for a long time considered not to exhibit analytically useful high electron-yield catalytic signals, recent
of
data revealed catalytic hydrogen evolution at the mercury electrode in the presence of the NAs, under certain conditions giving “peak HNA” using constant current chronopotentiomeric
ro
stripping analysis (CPS). The peak HNA represents an extremely sensitive analytical signal for
-p
both DNA and RNA (similarly as earlier introduced catalytic signals of proteins [21] or aminosugars [22]) offering about 2-3 orders of magnitude higher sensitivity of NA detection
re
than provided by the faradaic signals [9, 23]. Using peak HNA it is possible to distinguish between native and denatured chromosomal DNA or to study damage of DNA from human
lP
cancer cell induced by radiation or sonication [9].
In this work we demonstrate, using specifically designed ODNs, the involvement of
na
cytosine and/or adenine residues in the catalytic hydrogen evolution reaction giving rise to the peak HNA. In addition, we present a new faradaic signal yielded by the NAs on the mercury
Jo ur
electrode, denoted as “peak P”. We show that this signal is related to guanine reduction under specifically selected conditions, which differ from conditions previously optimized and routinely applied to measure the peak CA, anodic peak G or the tensammetric peaks 1, 2, and 3.
2. Experimental 2.1. Material DNA and RNA oligonucleotides were synthesized by Generi Biotech (Czech Republic). Their sequences are shown in Table 1. Concentrations of oligonucleotides were calculated from UV-Vis spectra at wavelength 260 nm. All other chemicals were of analytical grade. Aqueous solutions were prepared from tri-destilated water.
Table 1. Sequences of oligonucleotides used in this work. 4
Journal Pre-proof Type[a]
Sequence (5’-3’)
ODNmix
DNA
AAGCCTGCCCGGCTCCTCGGG
ODNmix2
DNA
TGGCAGTGTCTTAGCTGGTTGT
ODNmix3
DNA
TAGTAGACCGTATAGCGTACG
A20
DNA
AAAAAAAAAAAAAAAAAAAA
C20
DNA
CCCCCCCCCCCCCCCCCCCC
T20
DNA
TTTTTTTTTTTTTTTTTTTT
U20
RNA
UUUUUUUUUUUUUUUUUUUU
CA37
DNA
CACACACACACACACACACACACACACACACACACAC
GA37
DNA
GAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAG
GT37
DNA
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTG
G12T10
DNA
GTGTGTGTGTGTGTGTGTGTGG
Oligo
-p
ro
of
(short name)
lP
2.2. Measurement
re
[a] DNA were composed of deoxyribonucleotides and RNA of ribonucleotides.
Electrochemical measurements were carried out using Autolab PGSTAT20
na
potentiostat/galvanostat (Metrohm-Autolab, Netherlands) connected to VA-Stand 663 (Metrohm, Herisau, Switzerland) in a cell comprising three-electrode system. A hanging
Jo ur
mercury drop electrode (HMDE, area 0.4 mm2) was served as working electrode, Ag/AgCl/3 M KCl electrode as reference electrode and platinum wire as counter electrode. In adsorptive transfer (ex situ) experiments, ODNs were adsorbed at the HMDE from a 5 µL drop at an open current potential for accumulation time, tA of 60 s, followed by washing of the electrode and its transfer into a blank background electrolyte (2-times diluted McIlvaine buffer, pH 5.9) for electrochemical measurement. Cyclic voltammograms were recorded from Ei of -0.1 to Ef of -2.03 V (if not stated otherwise) with given scan rate and step of 2 mV. The voltammetric measurements were performed at room temperature
(if not stated
otherwise) and the
electrolyte was purged by argon for 3 minutes before starting the measurement. The capacitance measurements (dependence of the differential capacitance C of the electrode double layer on potential; C–E curves) were performed with the Autolab PGSTAT20 with a frequency-response analyzer module (FRA). The C-E curves were measured at the same frequency of 225 Hz and an amplitude of 10 mV (rms) between potentials E from -0.5 V to -
5
Journal Pre-proof 2.0 V with a 10 s step between the measuring points. All experiments were performed in 2times diluted McIlvain buffer pH 5.9 at 25 ºC.
3. Results and discussion First we measured CV responses of the mixed-sequence 21-mer oligodeoxynucleotide (ODNmix) in 2-times diluted McIlvaine buffer, pH 5.9, i.e. in a similar medium as that used in our previous papers [9, 23]. Three different cathodic peaks at potentials of approximately −1.45 V, −1.68 V and −1.83 V can be observed for 5 µg/mL ODNmix (Fig. 1A, solid curves).
of
At potential -1.34 V the well-known CA peak appears corresponding to reduction of adenine
ro
and cytosine [3, 24]. Peaks at −1.68 V and −1.83 V were described only recently [9, 12]. Peak at -1.83 V was nominated as “peak HNA” due to its catalytic nature [9]. The peak at -1.68 V
-p
was firstly described by Dorcak and Palecek [12], who denominated it as “peak P”. They
re
suggested that peak P is not involved in catalytic hydrogen evolution reaction as peak HNA because its height did not increase with increasing buffer concentration [23]. In dependence
lP
on the scan rate, the heights of peak CA and peak P monotonously increased with increase of scan rate in the range between 20 mV/s and 4 V/s (fluctuations in the peak P height vs. scan
na
rate trend between 500 and 800 mV/s are probably due to interference between partly overlapping peaks P and HNA, see the CV in Fig. 1A). On the contrary, the height of peak HNA
Jo ur
increased with scan rate up to 50 mV/s and with further increasing scan rate it steeply decreased and almost completely disappeared at 800 mV/s [23]. Thus, the peak P becomes dominant at higher scan rates (outgrowing even the catalytic peak HNA), as was shown in [23], what again suggests predominantly redox nature of this signal (Fig. 1B). Behavior of the catalytic peak HNA differed from both peaks CA and P also in dependence on temperature (Fig. 1C). At temperatures higher than 20 °C the peak HNA steeply increased, while the peak CA was nearly constant in whole studied temperature interval (Fig. 1C). The peak P showed an apparent gradual increase at higher temperature which probably involved contribution from the partly overlapping, steeply increasing catalytic peak HNA (at potentials only 20 mV more negative than peak P). Peaks CA, P and HNA were also obtained in other background electrolytes, namely Britton-Robinson and 0.1 M acetate with the same pH as was used for the McIlvaine buffer (not shown).
6
Journal Pre-proof 3.1. Effect of DNA base residues on peak HNA To better understand the catalytic processes of DNA and identify contributions from its particular components, we compared CV responses of 5 µg/mL homo ODNs A20, C20 and T20 at scan rate of 100 mV/s favorable for the catalytic reaction (Fig. 2). Under the given conditions, A20, and C20 displayed well-developed peaks HNA at -1.84 or -1.95 V, respectively (Fig. 2A). Additionally, negative current signals (“negative counter peaks”) appeared in reverse (anodic) scan in the CV which also pointed to the catalytic nature of these peaks (catalytic hydrogen evolution process continuing during the anodic scan). Potentials of these counter peaks were close to potentials of corresponding signals observed in the cathodic scan.
of
Almost the same voltammogram as yielded by A20 was obtained for ODN CA37 containing alternating sequence of cytosine and adenine. Repeated CV scans only little differed from the
ro
first one, suggesting remarkable stability of the (reduced) ODN layer and reversibility of
-p
processes involved in the catalytic hydrogen evolution within the given potential range (Fig. 2B). In contrast to ODNs containing adenine and/or cytosine, T20 yielded no remarkable
re
signal under the same conditions, similarly as its ribonucleic equivalent U20 (Fig. 2C). Practically the same behavior was observed with shorter (e.g., 10-mers) or longer ODNs (e.g.,
lP
40-mers) (not shown). To test catalytic activity of guanine residues, we used alternating sequence d(G12T10) instead of homo ODN G20, which is rather difficult to synthetized due to
na
its formations of G quadruplexes or other higher structures; these phenomena may also affect its electrochemical activity [25]. As shown in Fig. 2C, the ODN G12T10 did not yield well-
Jo ur
developed peak HNA similarly to T20, suggesting no significant contribution of guanine to the ODN catalytic activity. Even at longer accumulation times (tA’s), such as 180 s, and at higher concentration (15 µg/mL), only very small peak HNA appeared in the presence of measured G12T10. Similar behavior was also observed for ODN GT37. CV peak HNA of A20 appeared at potentials by about 110 mV less negative than the peak HNA of C20, implying that A and C residues (or their reduction products) catalyze hydrogen evolution differently (Fig. 2A). The reason for this difference may rely in different structures adopted by the homo ODNs C20 and A20 formed in solution [26, 27] and/or their different interactions with/at the electrode surface. These phenomena may influence accessibility of the respective base residues and their participation of in the catalytic hydrogen evolution reaction.
Fig. 2D shows C-E curves of A20 and C20 suggesting significant differences in their behavior on the negatively charged HMDE surface in a weakly acidic medium. Previously it 7
Journal Pre-proof has been shown [13, 20] that in neutral or weakly alkaline media, pyrimidine homo ODNs, unlike purine ones, undergo 2D condensation at the negatively charged HMDE surface, which was reflected in formation of characteristic capacitance pits on C-E curves. Moreover, (dC)n sequences exhibited the strongest adsorption at the HMDE surface among all homo ODN stretches [13]. However, in acidic media the interfacial behavior of cytosine and adenine homo ODNs was influenced by protonation of the bases. As shown here in Fig. 2D, in the potential range between -0.05 V and -1.0 V, the C20 remains strongly adsorbed at HMDE surface as evidenced by specific capacitance values deep below the values corresponding to background electrolyte. Between ca. -1.0 and -1.5 V the C-E curve of C20 gradually increases
of
to approach that of the background electrolyte at ca. -1.5 V, suggesting slow desorption of the ODN in this potential range. On the other hand, the C-E curve of A20 approaches that of the
ro
background electrolyte close to -1.0 V followed by appearance of a well-defined capacitance
-p
pit centered around potential of -1.12 V with capacitance value 5.75 µF.cm-2. Thus, in the mildly acidic McIlvaine buffer the A20 adsorbed layer underwent transition to form a two-
re
dimensional condensed film [28]. As discussed by Hason et al. in [13], under these condition A20 may have adopted local double helical structures due to creation protonated base-pairs
lP
AH+–H+A (pK, N1 = 4.15) [26, 27]. According to Palecek’s works [24], we suggest that at potentials around -1.2 V, the helical structures of A20 started to unwind and protonated
na
adenine residues could be electrostatically attracted via N1 of adenine to negatively charged Hg surface. Absence of capacitance peak linked with reorientation/desorption of the ODN on
Jo ur
the C-E curve (Fig. 2D) may be due to the involvement of the sugar-phosphate backbone in the corresponding secondary structure [27]. Also cytosine residues of C20 were partially protonated at pH 5.9 (pK cytosine N3 = 4.5), but in contrast to A20, C20 can form fourstranded i-motifs with hemiprotonated base-pairs CH+–C [29]. In the i-motifs, the cytosine moieties are bound together by three hydrogen bonds which may make the secondary structure relatively resistant against unwinding at the negatively charged HMDE surface, which might limit involvement of the cytosines in the catalytic process and shift the latter to more negative potentials. Mechanism of catalytic hydrogen evolution reaction for ODN has not been fully understood yet. We suggested that residues bearing exchangeable proton are responsible for this catalytic reaction similarly as it was proposed for catalytic activity of basic residues in proteins [22]. Reduction products of reducible DNA bases (particularly those of adenine, 8
Journal Pre-proof cytosine) are natural candidates to play this role as Fig. 1 shown, because the catalytic reaction takes place at potential more negative than potentials of adenine and cytosine reduction. Adenine and cytosine in ODNs yielded peak HNA (Fig. 2) and it was previously found that reduction products of these two bases are strongly adsorbed on the surface of HMDE [3, 9]. Catalytic activity of guanine residues has not been given evidence. ODN containing G residues with catalytically inactive T residues did not yield a developed peak HNA. In presence of guanine and other electroactive bases (such as adenine in GA37, Fig. 3A), the peak HNA was observed and was very similar to that of A20 (similarly as in the case of CA37, Fig. 2). ODNs GA37 yielded additionally shoulder at potential about-1.60 V
of
corresponding to peak P. More work should be done to resolve problem of catalytic activity of G. We cannot exclude that there is a mutual link between G reduction and its catalytic activity
ro
due to very close potentials of the both processes and the earlier proposed [15] involvement of
-p
chemical mechanism of the G reduction, facilitated by catalysts of proton reduction.
re
3.2. Peak P We tested various ODNs (Table 1) and we found that only ODN containing G residues
lP
yielded the peak P. The reduction of guanine to 7,8-dihydroguanine on mercury electrode, taking place at negative potentials close to -1.8 V (depending on the medium and other
na
conditions [15, 30]), has been known for a long time [3, 14], although a specific signal corresponding to the G reduction on the mercury electrodes has not been identified yet. Our
Jo ur
observations in this work make the peak P a good candidate for the “missing” guanine reduction signal. Reoxidation of 7,8-dihydroguanine back to guanine occurs in anodic scan to give peak G at about -0.25 V (Fig. 3A, inset). When the negative vertex potential in CV is set up properly (e.g., -1.8 V as in Fig. 3A), both reactions (G reduction and 7,8-dihydroG oxidation) are chemically reversible [3] and, accordingly, both peak P and peak G appear in repeated consecutive CV scans (Fig. 3A, dashed line). Thus, to give evidence for the link between processes related to the peaks P and G, we followed dependence of peak G height on vertex potential (Evertex) at scan rate 2 V/s. No peak G was observed for Evertex less negative than the onset of peak P. For Evertex, potentials set within or behind the peak P (between -1.5 and -1.8 V), the anodic peak G appears and reaches its maximum at Evertex around -1.75 V (just behind the peak P). For Evertex values more negative than -1.82 V, peak G steeply decreases (Fig. 3B). At a lower scan rate of 0.7 V/s (Fig. 3C), increase and maximum of peak G was similar to that observed at 2 V/s, but complete peak G disappearance was reached at less negative Evertex (-1.87 V in comparison to -2.0 V for scan rate 2 V/s). We suggest that the 9
Journal Pre-proof disappearance of peak G could be connected with irreversible reduction of 7,8dihydroguanine to another product at very negative potentials (Fig. 3A red curve) [16]. In agreement with this idea, lower scan rates provide longer time for the deeper G reduction, resulting in the disappearance of the peak G at less negative Evertex (Fig. 3B, C). As it is shown in Fig. 3A, the first and the second cathodic scan of ODNmix differ, indicating that the process of guanine reduction at HMDE is more complex and/or the adsorbed DNA layer is probably unstable during scanning in this potential range as was described earlier [31]. Additionally, we found that ODNs G12T10 and GT37 yield neither peak P (Fig. 4A, red line) nor peak G. On the other hand, the presence of few catalytically active bases (adenine and cytosine) in the
of
DNA chain (like in ODNmix2) resulted in appearance of peak P (Fig. 4A, blue line). These results suggest that reduction of guanine is facilitated in ODNs with the catalytically active
ro
residues through a mechanism involving catalytic hydrogen evolution. Facilitation of the
-p
guanine reduction was previously observed in presence of catalytically active cisplatin or cisplatin-DNA adducts [15, 30]. As the Fig 4A shows, number of guanine residues in the
re
DNA chain does not correlate with the height of peak P, suggesting involvements of a more complex process than simple guanine reduction consuming a defined number of electrons.
lP
We also studied effects of pH on the CV responses for ODN with random sequences containing all four DNA bases (ODNmix) (Fig. 4). We found that peak CA slightly increased
na
with pH shifting from 5.0 to 6.2, followed by its steep decrease between pH 6 and 7 and gradual decrease between pH 7.0 and 8.0. On the contrary, heights of peak P and peak G
Jo ur
decreased almost linearly with increasing pH between 5.0 and 7.0 – 7.5, and completely disappeared at the respective upper values. The very similar courses (slopes) of the pH dependences of both peak heights again imply their mutual linkage. In particular, such parallel behavior accords with the proposed guanine reduction (at potentials coinciding with potentials of the peak P to generate the 7,8-dihydroguanine) being the necessary condition for the anodic peak G to appear. Based on these findings, we suggest that the missing reduction peak P in earlier studies could be due to experimental conditions under which this signal was obscured by background currents. For example, in the presence of ammonium ions the background discharge was shifted to less negative positive values.
Conclusion Regardless of the progress in the development and application of redox DNA labelling techniques [3, 32], label-free electrochemical DNA sensing employing intrinsic DNA signals 10
Journal Pre-proof offer several advantages including simplicity and lack of interferences of the labels with DNA structure and/or interactions. For a long time, intrinsic NAs signals connected to faradaic or tensammetric processes on liquid mercury electrode were used as tools extremely sensitive to changes in NA structure [3]. Recently the portfolio of applicable signals of unlabeled NAs has been extended by a catalytic peak HNA [9, 12]. In this work we contribute to understanding of the catalytic hydrogen evolution in the presence of the NAs by identification of nucleobases responsible for processes giving rise to the peak HNA. Using specifically designed ONs we show that presence of adenine and cytosine, in contrast to thymine, uracil and guanine, is connected with appearance of well-developed catalytic peak HNA. Interestingly, the former
of
two bases share the –N=C–NH2 moiety previously identified as the site of primary reduction of the bases. It should be noted that the ultimate catalysts are reduction products of the bases
ro
rather than adenine and/or cytosine themselves, because their reduction (reflected in the
-p
appearance of peak CA) takes place at potentials less negative than the catalytic process ODNs containing guanine have been found to yield, in weakly acidic pH’s, another
re
peak in a close vicinity of the peak HNA. Our data suggests that this peak, denominated as peak P, is probably of faradaic nature and appears due to reduction of guanine. Its presence
lP
correlates with the presence of the anodic peak G in the anodic scans and the latter peak appears only when the peak P is scanned-through in the cathodic branch of the CV,
na
suggesting reduction of guanine to 7,8-dihydroguanine to be connected with the peak P. In contrast to the peak HNA, well-developed peak P was observed at higher polarization rates.
Jo ur
However, the appearance of well-developed peak P (and peak G) is dependent on the presence of the catalytically active nucleobases. The link between peak P and the catalytic process makes the peak P different from peak CA and G showing characteristics of simple faradaic processes. Our results demonstrate that a suitable combination of experimental conditions could provide new information on the behavior of nucleic acids on charged surfaces, as well as to extend application potential of electrochemical methods in the biomolecule research.
Acknowledgement Authors wish to acknowledge support from the projects of Czech Science Foundation 1708971S and the SYMBIT project reg. no. CZ.02.1.01/0.0/0.0/15_003/0000477 financed from the ERDF.
References
11
Journal Pre-proof
Jo ur
na
lP
re
-p
ro
of
[1] E. Paleček, Oscillographic polarography of highly polymerized Deoxyribonucleic acid, Nature 188 (1960) 656-657. [2] V. Brabec, J. Koudelka, Oxidation of deoxyribonucleic acid at carbon electrodes. The effect of the quality of the deoxyribonucleic acid sample, J. Electroanal. Chem. Interf. Electrochem. 116 (1980) 793-805. [3] E. Palecek, M. Bartosik, Electrochemistry of nucleic acids, Chem. Rev. 112 (2012) 34273481. [4] S. Hason, S.P. Simonaho, R. Silvennoinen, V. Vetterl, Detection of phase transients in two-dimensional adlayers of adenosine at the solid amalgam electrode surfaces, J. Electroanal. Chem. 568(1-2) (2004) 65-77. [5] K. Kucharikova, L. Novotny, B. Yosypchuk, M. Fojta, Detecting DNA damage with a silver solid amalgam electrode, Electroanalysis 16(5) (2004) 410-414. [6] B. Yosypchuk, M. Heyrovsky, E. Palecek, L. Novotny, Use of solid amalgam electrodes in nucleic acid analysis, Electroanalysis 14(21) (2002) 1488-1493. [7] E. Ferapontova, DNA electrochemistry and electrochemical sensors for nucleic acids, Annu. Rev. Anal. Chem. 11 (2018) 197-218. [8] M. Freitas, H.P.A. Nouws, C. Delerue-Matos, Electrochemical biosensing in cancer diagnostics and follow-up, Electroanalysis 30 (2018) 1576-1595. [9] E. Palecek, M. Bartosik, Intrinsic electrocatalysis in DNA, ChemElectroChem 5 (2018) 936-942. [10] M. Fojta, A. Danhel, L. Havran, V. Vyskocil, Recent progress in electrochemical sensors and assays for DNA damage and repair, TrAC, Trends Anal. Chem. 79 (2016) 160-167. [11] V. Vyskocil, J. Barek, Mercury electrodes-possibilities and limitations in environmental electroanalysis, Crit. Rev. Anal. Chem. 39(3) (2009) 173-188. [12] V. Dorčák, E. Paleček, Catalytic deuterium evolution and H/D exchange in DNA ChemElectroChem 6(4) (2019) 1032-1039. [13] S. Hason, H. Pivonkova, M. Fojta, Influence of the lengths of thymine, cytosine, and adenine stretches on the two-dimensional condensation of oligodeoxynucleotides at mercury and silver amalgam electrode surfaces, J. Electroanal. Chem. 849 (2019) 113364. [14] L. Trnková, M. Studničková, E. Paleček, Electrochemical behaviour of guanine and its derivatives. I. Fast cyclic voltammetry of guanosine and calf thymus DNA, J. Electroanal. Chem. Interf. Electrochem. 116 (1980) 643-658. [15] A. Danhel, L. Havran, L. Trnkova, M. Fojta, Hydrogen evolution facilitates reduction of DNA guanine residues at the hanging mercury drop electrode: Evidence for a chemical mechanism, Electroanalysis 28 (2016) 2785-2790. [16] G. Dryhurst, Electrochemistry of biological molecules, Academic Press, New York, 1977. [17] J. Spacek, A. Danhel, S. Hason, M. Fojta, Label-free detection of canonical DNA bases, uracil and 5-methylcytosine in DNA oligonucleotides using linear sweep voltammetry at a pyrolytic graphite electrode, Electrochem. Commun. 82 (2017) 34-38. [18] J. Spacek, M. Fojta, J. Wang, Electrochemical reduction and oxidation of six natural 2 'deoxynucleosides at a pyrolytic graphite electrode in the presence or absence of ambient oxygen, Electroanalysis 31(10) (2019) 2057–2066. [19] A. Bonanni, C.K. Chua, G.J. Zhao, Z. Sofer, M. Pumera, Inherently electroactive graphene oxide nanoplatelets as labels for single nucleotide polymorphism detection, Acs Nano 6(10) (2012) 8546-8551. [20] S. Hason, V. Vetterl, M. Fojta, Two-dimensional condensation of pyrimidine oligonucleotides during their self-assemblies at mercury based surfaces, Electrochim. Acta 53(6) (2008) 2818-2824.
12
Journal Pre-proof
Jo ur
na
lP
re
-p
ro
of
[21] V. Ostatna, B. Dogan, B. Uslu, S. Ozkan, E. Palecek, Native and denatured bovine serum albumin. D.c. polarography, stripping voltammetry and constant current chronopotentiometry., J. Electroanal. Chem. 593 (2006) 172-178. [22] E. Palecek, J. Tkac, M. Bartosik, T. Bertok, V. Ostata, J. Palecek, Electrochemistry of nonconjugated proteins and glycoproteins. Toward sensors for biomedicine and glycomics, Chem. Rev. 115(5) (2015) 2045-2108. [23] L. Římanková, V. Ostatná, M. Bartošík, Intrinsic electrocatalysis of RNA as a label-free and reagent-less tool for detection of microRNAs, Electroanalysis 31(10) (2019) 1895-1901. [24] E. Palecek, M. Bartosik, V. Ostatna, M. Trefulka, Electrocatalysis in proteins, nucleic acids and carbohydrates, Chem. Rec. 12(1) (2012) 27-45. [25] P. Vidlakova, H. Pivonkova, I. Kejnovska, L. Trnkova, M. Vorlickova, M. Fojta, L. Havran, G-quadruplex-based structural transitions in 15-mer DNA oligonucleotides varying in lengths of internal oligo(dG) stretches detected by voltammetric techniques, Anal. Bioanal. Chem. 407(19) (2015) 5817-5826. [26] S. Chakraborty, S. Sharma, P.K. Maiti, Y. Krishnan, The poly dA helix: a new structural motif for high performance DNA-based molecular switches, Nucleic Acids Res. 37(9) (2009) 2810-2817. [27] A. Plumridge, S.P. Meisburger, K. Andresen, L. Pollack, The impact of base stacking on the conformations and electrostatics of single-stranded DNA, Nucleic Acids Res. 45(7) (2017) 3932-3943. [28] R. Delevie, The dynamic double-layer - two-dimensional condensation at the mercury water interface, Chem. Rev. 88(4) (1988) 599-609. [29] A.M. Fleming, Y. Ding, R.A. Rogers, J. Zhu, J. Zhu, A.D. Burton, C.B. Carlisle, C.J. Burrows, 4n-1 is a "sweet spot" in DNA i-motif folding of 2 '-deoxycytidine homopolymers, J. Am. Chem. Soc. 139(13) (2017) 4682-4689. [30] P. Horakova, L. Tesnohlidkova, L. Havran, P. Vidlakova, H. Pivonkova, M. Fojta, Determination of the level of DNA modification with cisplatin by catalytic hydrogen evolution at mercury-based electrodes, Anal. Chem. 82(7) (2010) 2969-2976. [31] F. Jelen, E. Palecek, Chemically reversible electroreduction of guanine in a polynucleotide chain, Biophys. Chem. 24(3) (1986) 285-290. [32] M. Hocek, M. Fojta, Nucleobase modification as redox DNA labelling for electrochemical detection, Chem. Soc. Rev. 40(12) (2011) 5802-5814.
13
Journal Pre-proof Figure legends Figure 1 A. Adsorptive transfer cyclic voltammogram of 5 µg/mL oligonucleotides ODNmix in 2x diluted McIlvaine buffer, pH 5.9 (blank electrolyte, dashed lines) at scan rate 0.1 V/s (black) and 4 V/s (red) for accumulation time (tA) 60 s. B. C. Dependence of peak P (blue), CA (red) and HNA (black) heights B. on scan rates at room temperature and C. on temperature in electroanalytical cell at 0.5 V/s.
of
Figure 2. A. Cyclic voltammogram of 5 µg/mL catalytically active A20, C20 and CA37 and GA37. B. The first five CV scans of CA37. C. Cyclic voltammogram of 5 µg/mL of catalytically inactive T20, U20 and G12T10. D. C-E curves of C20 and A20 in background electrolyte 2-times diluted McIlvaine buffer, pH 5.9 (dashed line). CV: scan rate 100 mV/s and accumulation time (tA) 60 s.
lP
re
-p
ro
Figure 3 A. The 1st (tick line) and 2nd (thin line) scan of cyclic voltammogram of 5 µg/mL of d(GA)37 in 2-times diluted McIvaine buffer, pH 5.9 at scan rate of 2 V/s vertex potential (Evertex) of -1.85. Inset: Enlarged anodic peak G of the 1st (tick line) and 2nd (thin line) CV scan. B. Forward CV scan (black solid line) of 5 µg/mL ODNmix and dependence of anodic peak G heights on Evertex at scan rate of 2 V/s (red dash line). C. Dependence of anodic peak G heights (red) and peak P (black) current value in Evertex (empty black squares) in 2nd scan on Evertex at scan rate of 0.7 V/s (red). The current values were determined for Evertex not reaching potential of peak P.
Jo ur
na
Figure 4 A. Cyclic voltammogram of 5 µg/mL ODNs G12T10 (red), CA37 (green), GA37 (cyan), ODNmix (black), ODNmix2 (blue) and ODNmix3 (magenta) B. Dependence of peaks CA (red, left axis), P (blue, left axis) and G (black, right axis) of ODNmix on pH of 2-times diluted McIlvain, measured by CV with scan rates of 2 V/s.
14
Journal Pre-proof
of
Figures
Jo ur
na
lP
re
-p
ro
Figure 1
Figure 2
15
Journal Pre-proof
Jo ur
na
lP
re
-p
ro
of
Figure 3
Figure 4
16
Journal Pre-proof Author Contribution Statement Investigation: Lída Římánková, Stanislav Hasoň Conceptualization, supervision: Veronika Ostatná Writing - Original Draft: Veronika Ostatná, Stanislav Hasoň, Aleš Daňhel Writing - Review & Editing: Miroslav Fojta, Veronika Ostatná
Jo ur
na
lP
re
-p
ro
of
Funding acquisition: Veronika Ostatná, Miroslav Fojta
17
Journal Pre-proof
Jo ur
na
lP
re
-p
ro
of
Graphical Abstract
18
Journal Pre-proof Highlights Adenine and cytosine are involved in catalytic hydrogen evolution reaction (CHER).
This CHER gives rise to a voltammetric peak HNA on mercury electrodes.
New faradaic peak P was attributed to guanine reduction.
The peak P appeared only in the presence the catalytically active bases.
