- Email: [email protected]
CC chemokine binding protein-2 (CCBP2) in rainbow trout (Oncorhynchus mykiss)
Fish & Shellfish Immunology 44 (2015) 389e398
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Identification and expression analysis of an atypical chemokine receptor-2 (ACKR2)/CC chemokine binding protein-2 (CCBP2) in rainbow trout (Oncorhynchus mykiss) Zhitao Qi a, b, Yousheng Jiang a, c, Jason W. Holland a, Pin Nie d, Christopher J. Secombes a, Tiehui Wang a, * a
Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, UK Key Laboratory of Aquaculture and Ecology of Coastal Pool in Jiangsu Province, Department of Ocean Technology, Yancheng Institute of Technology, Yancheng, Jiangsu, 224051, China c College of Fishery and Life Science, Shanghai Ocean University, Shanghai, 201306, China d State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei, 430072, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 January 2015 Received in revised form 23 February 2015 Accepted 24 February 2015 Available online 3 March 2015
Atypical chemokine receptors (ACKRs) have emerged as key components of the chemokine system, with an essential regulatory function in innate and adaptive immune responses and inflammation. In mammals ACKR2 is a ‘scavenging’ receptor for inflammatory CC chemokines and plays a central role in the resolution of in vivo inflammatory responses. An ACKR2 like gene has been identified and cloned in rainbow trout (Teleostei) in the present study, enabling the further identification of this molecule in another group of ray-finned teleost fish (Holostei), in a lobe-finned fish (Sarcopterygii-coelacanth), and in reptiles. The identity of these ACKR2 molecules is supported by their conserved structure, and by phylogenetic tree and synteny analysis. Trout ACKR2 is highly expressed in spleen and head kidney, suggesting a homeostatic role of this receptor in limiting the availability of its potential ligands. Trout ACKR2 expression can be modulated in vivo by bacterial and parasitic infections, and in vitro by PAMPs (poly I:C and peptidoglycan) and cytokines (IL-6, TNF-a, IFN-g and IL-21) in a time dependent manner. These patterns of expression and modulation suggest that trout ACKR2 is regulated in a complex way and has an important role in control of the chemokine network in fish as in mammals. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Rainbow trout Oncorhynchus mykiss Atypical chemokine receptor-2 (ACKR2) CC chemokine binding protein-2 (CCBP2) Expression Infection
1. Introduction The initiation, maintenance and resolution of immune and inflammatory responses are crucially dependent on proper spatiotemporal positioning of leukocytes and on appropriate functional interactions between leukocytes and other cells in tissue specific contexts. The coordinated movement of leucocytes is mediated primarily by the chemokine system that includes a large number of ligands binding to a smaller number of receptors [1e3]. For example, the human chemokine system consists of 48 ligands and 23 receptors [1,4]. The chemokine ligands have been classified into four groups (CC, CXC, CX3C, and XC) based on the position of the first two cysteine residues [5e7]. On the other hand, the chemokine receptors are classified according to the chemokine group that they
* Corresponding author. Tel.: þ44 1224 272883; fax: þ44 1224 272396. E-mail address: [email protected] (T. Wang). http://dx.doi.org/10.1016/j.fsi.2015.02.038 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
bind. Another classification of chemokines is based on functional criteria that group them into homeostatic and inflammatory chemokines. Homeostatic chemokines are constitutively expressed and regulate the migration of leukocytes and their precursors. The inflammatory chemokines are inducible and regulate leukocyte migration into tissues in response to an inflammatory stimulus, such as tissue damage or infection [1e4,8]. Chemokine receptors are seven transmembrane molecules connected by three intracellular loops (ICL) and three extracellular loops (ECL), and have a conserved DRY amino acid motif within the second ICL, which is involved in coupling to G-proteins [4,8]. The binding of classic chemokine receptors with their ligands results in multiple signal transduction pathways, triggering a cascade of intracellular events from gene transcription to cytoskeleton rearrangement and chemotaxis [9,10]. The chemokine/receptordependent responses can be regulated by a family of atypical chemokine receptors (ACKRs) that structurally resemble conventional chemokine receptors but cannot initiate classical chemokine
390
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
receptor signalling in response to ligand binding [4,11e13]. This family have at least four members in humans, i.e. ACKR1 (Duffy antigen receptor for chemokines, DARC), ACKR2 (D6 and CC chemokine binding protein 2 or CCBP2), ACKR3 (CXC-chemokine receptor 7 or CXCR7, and RDC1) and ACKR4 (CC-chemokine receptorlike 1 or CCRL1, CCXCKR and CCR11). ACKRs serve homeostatic functions by clearing chemokines from the circulation and tissues [1,4,14e16]. ACKR1 binds a large number of CXC and CC inflammatory but not homeostatic chemokines, is abundantly expressed by erythrocytes, and functions as a chemokine sink [1,4]. Human ACKR2 binds at least 12 inflammatory CC chemokines and plays well characterized roles in the regulation of the in vivo inflammatory response [11,12]. It is expressed by a variety of leukocytes, that in humans include dendritic cells and monocytes in PBLs, resident mast cells and intestinal mononuclear cells, and macrophages in inflamed lung tissue [11], whilst in mice it is regarded as highly restricted to innate-like B cells [17]. In addition it is expressed in a number of other cell types such as lymphatic endothelial cells, and in trophoblasts in the placenta [11]. Chemokines that have been bound by ACKR2 at the cell surface can be rapidly internalized, dislodged from the receptor by the low pH in endosomes and then destroyed in lysosomes. The chemokine-free ACKR2 travels back to the cell surface to re-acquire a ligand. Through repeated cycles, ACKR2 can progressively deplete extracellular chemokines [11]. ACKRs influence leukocyte recruitment by 'tuning' the concentrations and gradients of ligands in tissues by diverse means, including binding, storing, scavenging, transporting and trans-presenting chemokines. Thus, ACKRs have emerged as key components of the chemokine system, with an essential regulatory function in innate and adaptive immune responses and inflammation [4]. A large number of chemokines and chemokine receptors have been described in vertebrates from teleosts to mammals. Recent analysis of vertebrate genomes [3,5,18e22] has revealed that both chemokines and their receptors have been evolving rapidly through species-specific gene duplications, although this type of rapid evolution is more characteristic of the chemokines than their receptors. Whilst humans have 48 chemokines, analysis of the genomes of several teleosts, including zebrafish, medaka, stickleback and tetraodon have shown they contain 89, 36, 24 and 20 chemokines, respectively [5]. The orthologues of most of the known 23 human chemokine receptors have also been identified in teleost fish [3e5,18,23,24] together with a few chemokine receptors (eg CXCR3b/ssCXCR8 and drCCR12/ssCCR3) that are not present in humans [18,23e25]. In line with the fish specific (3R) wholegenome duplication (WGD) event, which occurred in ray finned fish species before the divergence of most teleost species [26], 3R fish often possess more than two genes for a single human counterpart, and in salmonids this can be even higher due to a 4R WGD event in this lineage [24]. So far, 40, 31, 24, 48 and 30 chemokine receptor genes have been identified in zebrafish, medaka, tetraodon, Atlantic salmon and pike, respectively [18,24]. The ACKR2 gene is present in birds and mammals, and recently has been identified in teleost fish (Atlantic salmon, zebrafish, pike) [24] and cartilaginous fish (elephant shark - accession. no. XM_007908256) [27], although in the latter case the N-terminal of the predicted translation is relatively large and may include upstream genomic sequence. However, to date little or no functional analysis has been performed in fish. In this communication, we first report the cloning of an ACKR2 gene from rainbow trout Oncorhynchus mykiss. We then identified ACKR2 genes in other fish groups (holostei, sarcopterygii) and in reptiles in the database, and characterized these molecules by phylogenetic tree analysis, synteny analysis and multiple alignment. Finally, the expression of trout ACKR2 was examined in vivo in healthy fish and under bacterial and parasitic infections, and in vitro in response to pathogen
associated molecular patterns (PAMPs) and recombinant trout cytokines. 2. Materials and methods 2.1. Fish Rainbow trout were obtained from the Mill of Elrich Trout Fishery (Aberdeenshire, UK). Fish were maintained in 1 m diameter aerated fibreglass tanks with a re-circulating water system at 14 ± 1 C and fed twice daily with standard commercial pellets (EWOS). Prior to experimentation, fish were acclimated for at least 2 weeks. 2.2. Cloning of trout ACKR2 and sequence analysis Using the human and mouse ACKR2 protein sequence as bait, a candidate trout EST (GenBank No. CA361402) was identified by BLAST [28] search in the National Center for Biotechnology Informatics database (http://www.ncbi.nlm.nih.gov). The EST (667 bp), containing a 5’-untranslated region (UTR) and an incomplete open reading frame (ORF), was again used to BLAST a draft trout genome downloaded from http://www.genoscope.cns.fr/trout-ggb/data/. A scaffold (MMSRT009B_scaff_1696_1, 252.8 kbp) was identified that contained a complete trout ACKR2 ORF. To confirm the predicted cDNA sequence, primers (Table 1) were designed within the 50 -UTR and predicted 30 -UTR for PCR amplification using head kidney (HK) cDNA samples. A single band was obtained, cloned and sequence analysed as described previously [23,29]. The presence of ACKR2 in other species was identified by BLAST [28] search at NCBI and Ensembl (Database release 78) databases. A multiple sequence alignment was produced using ClustalW [30]. Global sequence comparison was conducted using the MatGAT programme (V2.02) [31]. A transmembrane domain was predicted by SMART7 [32]. A phylogenetic tree was constructed by the neighbour-joining method using MEGA 6.0 [33], with 10,000 bootstrap calculations, using ACKR2 molecules and other chemokine receptors (eg CCR, CCRL) present at the human ACKR2 locus (Chr 3). Lastly, gene synteny at the ACKR2 locus was analysed using the Genomicus program [34]. 2.3. Tissue distribution of trout ACKR2 transcripts RNA preparation, cDNA synthesis, and real-time PCR analysis was performed as described previously [23,29]. Six healthy rainbow trout (~120 g) were killed and tail fin, adipose fin, thymus, gills, brain, scales, skin, muscle, liver, spleen, HK, caudal kidney, intestine, heart, blood and peritoneal adipose tissue were collected. The expression level of ACKR2 in different tissues was normalized to the expression of EF-1a. 2.4. Expression of trout ACKR2 during bacterial and parasitic infections Bacterial infection: A pathogenic strain (MT3072) of the Gramnegative salmonid pathogen, Yersinia ruckeri [35] was injected Table 1 Primers used for cloning and expression analysis. Primer
Sequence (50 to 30 )
Application
CCBP2-F1 CCBP2-R1 CCBP2eF CCBP2-R EF-1a-F EF-1a-R
CTTACTTCAGACAAACTGCTTAC TCCACTTAACTTCCCAGGTATAGT TCAGAAACACTTTTTTTCCAGAGATATAC GAGGGTGCAAATGATAATGTAAGAGAC CAAGGATATCCGTCGTGGCA ACAGCGAAACGACCAAGAGG
PCR cloning PCR cloning Real-time PCR Real-time PCR Real-time PCR Real-time PCR
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
intraperitoneally (i.p.) into fish at 1 106 cfu in 0.5 ml PBS, as described previously [36]. A control group of fish was injected with PBS only (0.5 ml/fish). Six fish were killed at 6 h, 24 h, 48 h and 72 h post-infection and head kidney tissue collected. Parasitic infection: Proliferative kidney disease (PKD) is a parasitic disease of salmonid fish caused by the myxozoan parasite Tetracapsuloides bryosalmonae [37]. The parasite infects salmonid fish primarily via the gill epithelia, subsequently gaining access to internal tissues via the vascular system with the kidney being the main target organ. Caudal kidney tissue collection from infected fish and cDNA preparation was as described previously [38]. The severity of clinical pathology was analysed and a kidney swelling grade assigned to each fish according to the kidney swelling index system devised by CliftoneHadley and colleagues [37]. Real-time PCR analysis of gene expression was conducted as described in Section 2.3. 2.5. Expression of trout ACKR2 in HK cells Since kidney tissue was used in the above studies and exhibits one of the highest constitutive levels of ACKR2 expression (see results), HK cells were used to examine whether ACKR2 expression could be modulated by rainbow trout cytokines in vitro. Freshly prepared HK cells were prepared as described previously [29] and stimulated with recombinant (r)IL-2 (200 ng/ml) [39], rIL-6 (100 ng/ml) [40] and rIL-21 (100 ng/ml) [29], since these are molecules that may affect gene expression in lymphocyte populations, including B cells that express ACKR2 in mammals. After 4 h, 8 h and 24 h of stimulation real-time PCR quantification of ACKR2 expression was performed as described above. The concentration chosen for these stimulants was deemed optimal for immune gene expression studies based on our previous studies [29,39,40]. In addition, since ACKR2 can be expressed in mononuclear cells, lung macrophages and monocytes in humans, expression modulation was lastly studied in macrophages. Four day old primary HK macrophages were prepared as described previously [40] and stimulated with a variety of PAMPS and cytokines, including polyinosinic: polycytidylic acid (poly I:C, 50 mg/ml, Sigma), peptidoglycan (PGN, 5 mg/ml, Invivogen), rIL-6 (100 ng/ml) [40], rIFN-g (20 ng/ml) [41], rTNF-a (10 ng/ml) [42], rIL-1b (20 ng/ml) [43], and two rIL-12 isoforms that differ in the p40 chain [44] for 4 h, 8 h and 24 h. As above, the concentration chosen for each stimulant was deemed optimal for immune gene expression experiments based on our previous studies [40e44]. Real-time PCR quantification of expression was as described above and the results were expressed as a fold change relative to the time-matched unstimulated controls. 2.6. Statistical analysis Real-time PCR data were analysed using the SPSS Statistics package 19.0 (SPSS Inc., Chicago, Illinois) as described previously [29,41]. One way-analysis of variance (ANOVA) and the LSD post hoc test were used to analyse expression data derived from the infection studies, with P < 0.05 between treatment and control groups considered significant. Since in vitro experiments consisted of sample sets from individual fish, a Paired-Sample T-test was applied. 3. Results 3.1. Cloning and characterisation of ACKR2 in rainbow trout and sequence analysis of genes from other vertebrate species The amplified trout ACKR2 cDNA (GenBank No. KM516350) was 1343 bp and was predicted to contain a 50 - UTR of 142 bp, an ORF of 1119 bp encoding for 372 aa and a 30 -UTR of 82 bp (Supplementary Fig. S1). The cDNA sequence matched perfectly with the genomic
391
scaffold 1696 that contained a single intron of 108 bp in the 50 -UTR. There is an in-frame upstream stop codon (TAG) in the 50 -UTR before the main ORF of the rainbow trout ACKR2 gene, suggesting the complete ORF had been correctly predicted in this species. A short ORF encoding for 10 aa is also present in the 50 -UTR that may be involved in the regulation of the trout ACKR2 translation [45] (Fig. S1). Further search of databases identified ACKR2 like molecules for the first time in a number of other fish species i.e. the rayfinned fish Mexican tetra Astyanax mexicanus and spotted gar Lepisosteus oculatus, and the lobe-finned fish Latimeria chalumnae (coelacanth) [46], as well as in reptiles (eg. Chinese soft-shelled turtle Pelodiscus sinensis, Western painted turtle Chrysemys picta bellii, green sea turtle Chelonia mydas and alligator Alligator mississippiensis). The newly identified ACKR2 molecules showed top hits to ACKR2, and CCRL and CCR molecules clustered on human chromosome 3 [1,4,20], by BLAST search. Therefore, a neighbour-joining phylogenetic tree was constructed that included these CCR and CCRL molecules that clustered on human chromosome 3. ACKR1 members were also included as an out group. The predicted elephant shark ACKR2 [27] was excluded from the phylogenetic tree analysis because of the uncertainty of its N-terminal sequence. All the ACKR2 molecules were grouped together and separated from other molecules (CCR1-5,8,9, CCRL1-2 and ACKR1) with high bootstrap support (98%) in a neighbour-joining tree. In the ACKR2 group, lineage-specific clades with over 90% bootstrap support (i.e. mammals, birds, reptiles and ray-finned fish) are apparent, with the lobe-finned coelacanth ACKR2 lying outside the ray-finned fish clade as typically seen in phylogenetic tree analysis [23]. This tree (Fig. 1) was also in agreement with homology analysis on fulllength amino acid sequences (Table S1) which showed that the newly identified fish and reptile ACKR2 molecules have higher identities to mammalian and bird ACKR2s than to other CCR and CCRL molecules (e.g. reptile ACKR2 molecules had 45.7e52.1% identities to mammalian and bird ACKR2s compared to only 27.3e39.7% identities to other human CCR and CCRL molecules on chromosome 3 (Table S1)). The ACKR2 molecules from 2R fish (spotted gar and coelacanth) had apparently higher identities to tetrapod ACKR2s than to those from 3R fish (salmonids, zebrafish and tetra), e.g. the coelacanth ACKR2 shared 39.5e51.3% amino acid identities to tetrapod ACKR2s compared to 27.8e40.6% identities between ACKR2 molecules from 3R fish and tetrapods (Table S1). Further support of the newly identified ACKR2 molecules was derived from synteny analysis (Fig. 2). Most of the neighbouring genes (eg CYP8B1, HIGD1A, CCDC13, HHATL, KLHL40 and ZBTB47) of the Chinese soft-shelled turtle ACKR2 are syntenically conserved in humans, chicken, spotted gar and zebrafish. A HIGD1A gene was also found close to trout ACKR2 on scaffold 1696 (Fig. 2). To further characterise the newly identified fish and reptile ACKR2 molecules, a multiple alignment was constructed with selected ACKR2 molecules from mammals (human and mouse), birds (chicken and duck), reptiles (Chinese soft-shelled turtle, green sea turtle and alligator), ray-finned fish (trout, salmon, zebrafish, Mexican tetra and spotted gar), and the lobe-finned coelacanth (Fig. 3). Vertebrate ACKR2 molecules are well conserved in the seven TM domains with sequences all possessing four cysteine residues (one in the N-terminal and three in the ECLs) that form two disulphide bonds, one from the N-terminal to ECL3 and one from ECL1 to ECL2 [47]. Tyrosine-linked sulphation is important for ACKR ligand binding, internalisation and scavenging [48]. There are 3e5 tyrosine residues at the N-termini of these proteins that show a degree of conservation (Fig. 3), with at least three completely conserved in each animal lineage. A potential N-glycosylation site is also conserved in ACKR2 molecules from lobe-finned coelacanth and tetrapods just before the conserved tyrosine motif. A potential
392
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
Fig. 1. An unrooted phylogenetic tree of ACKR2, CCR and CCRL molecules on human chromosome 3 and from selected vertebrates. The tree was constructed using amino acid multiple alignments and the neighbour-joining method within the MEGA6 program. Node values represent percent bootstrap confidence derived from 10,000 replicates. The evolutionary distances were computed using the JTT matrix-based method and pairwise deletion option. The accession number for each sequence is given after the species name and molecular type. The trout ACKR2 is shaded. The bootstrap values at the roots of the ACKR clades from different lineages are highlighted with a circle. The molecular groups are indicated on the right.
N-linked glycosylation site is also present in this region in rainbow trout, Atlantic salmon, spotted gar and Mexican tetra at the N-terminus of ACKR2 but is missing in zebrafish. This site is glycosylated in human ACKR2 [49]. Interestingly, the lobe-finned coelacanth ACKR2 has two potential N-linked glycosylation sites in the alignment, one that is conserved in tetrapod ACKR2 molecules and the other conserved in salmonid ACKR2 homologues. A DRY motif at the boundary of TM3 and ICL2 is well conserved in typical chemokine receptors and critical for ligand induced signalling activity [7,13]. Unlike ACKR2 molecules in higher vertebrates, this DRY motif has been previously described in Atlantic salmon ACKR2 [24] and, from the current study, reported in rainbow trout and coelacanth ACKR2 (Fig. 3). 3.2. Tissue distribution of trout ACKR2 expression To gain an insight into ACKR2 function, we first examined trout ACKR2 expression in seventeen tissues from six healthy fish using real-time PCR. The expression of trout ACKR2 is ubiquitous, with
the highest expression levels found in spleen and HK (no significant difference as indicated by paired samples T test), and the lowest in blood and tail fins (Fig. 4). A relatively high level of ACKR2 expression was also found in muscle, heart, gonad, caudal kidney and adipose fin. 3.3. Expression of trout ACKR2 after bacterial and parasite infections We next investigated ACKR2 transcriptional modulation during bacterial and parasitic infections. Following infection of trout with the common Gram-negative bacterial fish pathogen, Y. ruckeri [35], the expression level of ACKR2 in HK was significantly increased (2.2-fold) at 24 h relative to time matched control fish, but stayed at the same level as the time-matched controls at 6 h, 48 h and 72 h (Fig. 5A). In fish with clinical PKD, ACKR2 expression was significantly decreased in kidneys from fish with a PKD swelling grade of 1e2, but was not modulated in kidneys from fish with a swelling grade of 1, 2 or 3 [37] (Fig. 5B).
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
393
Fig. 2. Diagram to show gene synteny at the ACKR2 loci in vertebrates. The Chinese soft-shelled turtle ACKR2 locus on Chromosome (Chr) JH208041 was used as a reference to compare the conserved synteny between the ACKR2 loci in fish (spotted gar, zebrafish and rainbow trout), birds (chicken) and mammals (human). The gene transcriptional direction is indicated by “þ” or ““.
3.4. Expression of trout ACKR2 in HK primary leukocytes The modulation of kidney ACKR2 expression by infection prompted us to examine its expression in immune cells isolated from this tissue. The HK cells are a mixed population of cell types, including lymphocytes, granulocytes and macrophages amongst others. In response to stimulation with rIL-2, rIL-6 and rIL-21 we found that rIL-2 and rIL-6 had no effect on ACKR2 expression whilst, in contrast, rIL-21 up-regulated ACKR2 expression at 24 h and 48 h but had no impact at earlier time points (Fig. 6). The cytokines were shown to be active by examining the expression of marker genes that are highly responsive to each recombinant cytokine; namely CATH2 for rIL-6 [40] and IFN-g for rIL-2 [39] and rIL-21 [29]. In each case they were highly upregulated in the current study (data not shown). Since ACKR2 can be expressed in monocytes/macrophages in certain situations, we also examined whether ACKR2 could be modulated in stimulated HK primary macrophage cultures. Trout ACKR2 expression was detectable constitutively in HK primary macrophages (Fig. 7). A variety of known macrophage stimulants were used in this study and included PAMPs (Poly I:C and PGN) and recombinant cytokines (rIFN-g, rTNF-a, rIL-1b, rIL-6 and rIL12). Both PAMPs and the inflammatory cytokine rIFN-g downregulated ACKR2 expression at 8 h, but had no effects at 4 h and 24 h (Fig. 7). rIL-6 up-regulated ACKR2 expression at 4 h (1.8 fold) but down-regulated its expression at 8 h, with no effect apparent at 24 h post stimulation. rTNF-a down-regulated ACKR2 expression at 4 h but had no effect at later time points (Fig. 7). ACKR2 expression was refractory to stimulation with rIL-1b [51] and the
two rIL-12 isoforms [52] from 4 h to 24 h in primary HK macrophages (data not shown).
4. Discussion In this report, we first cloned an ACKR2 like gene in rainbow trout and further identified ACKR2 genes in a lobe-finned fish, in two groups of ray-finned fish (holostei, teleostei), and in reptiles. The identity of these newly identified ACKR2 molecules is supported by; (A) their higher identity to mammalian and bird ACKR proteins (Table S1); (B) the phylogenetic tree analysis (Fig. 1) that illustrates that all ACKR2 homologues reported in this study group with mammalian and bird ACKR2 molecules with high bootstrap support (98%); (C) a well conserved gene synteny (Fig. 2) at the ACKR2 loci in reptiles (Chinese soft-shelled turtle), mammals (humans), birds (chicken) and ray-finned fish (zebrafish and spotted gar); and (D) well conserved structural features in the multiple alignment (Fig. 3). ACKRs are emerging as crucial regulatory components of chemokine networks in a wide range of developmental, physiological and pathological contexts in mammals [4,11]. ACKR2 is a ‘scavenging’ receptor for inflammatory CC chemokines and plays a central role in the resolution of inflammatory responses in vivo. However, this receptor has so far only been studied functionally in mammals and birds, with the identification of ACKR2 in other vertebrates unknown until the recent analysis of the salmon genome confirmed its presence in teleost fish. In this report we describe the independent cloning of the rainbow trout ACKR2 gene and greatly expand our knowledge of
Fig. 3. Multiple alignment of fish ACKR2s and selected ACKR2 molecules from mammals, birds and reptiles. The multiple alignment was produced using ClustalW, and conserved amino acids shaded using BOXSHADE (version 3.21) except in the N-terminal domain. The N-terminus, seven transmembrane domains (TM1-7), three extracellular loops (ECL1-3) and intracellular loops (ICL1-3) and the C-terminus are marked above the alignment. The four conserved cysteine residues in each extracellular domain are indicated by black arrows. The potential N-linked glycosylation site at the N terminal is underlined. Conserved tyrosine residues in the N-terminal and the DRY motifs in ICL2 are highlighted below the alignment. The accession numbers for sequences used in this alignment are given in Fig. 1.
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
Fig. 4. Constitutive expression of trout ACKR2 in vivo. The transcript expression level of the trout ACKR2 was determined by real time RT-PCR in 17 tissues from six fish. The transcript level was first calculated using a serial dilution of references and normalized against the expression level of EF-1a. The results represent the average þ SEM of six fish. AT ¼ adipose tissue, AF ¼ adipose fin, CK ¼ caudal kidney, HK ¼ head kidney.
395
Fig. 6. Modulation of ACKR2 expression in HK cells by IL-2, IL-6 and IL-21. Freshly prepared HK leukocytes were stimulated with rIL-2 (200 ng/ml), rIL-6 (100 ng/ml), rIL21 (100 ng/ml) or with medium only as control, for 4 h, 8 h and 24 h. The gene expression was expressed as a fold change that was calculated as the average expression level of stimulated samples divided by that of the time-matched controls. The means þ SEM of cells from four fish is shown. Significant results of a paired sample T test between stimulated samples and their time matched controls is shown above the bars as: *p < 0.05.
this gene in fish and reptiles, and undertake studies of expression modulation in fish for the first time. Of the 28 known human CC chemokines, ACKR2 can bind 14 CC inflammatory chemokines [12]. Global analysis of CC chemokines in teleosts revealed 7 large groups, including CCL19/21/25, CCL20 and CCL27/28 groups, that are highly related to mammalian CC chemokines, and the CCL17/22, MIP and MCP groups, where similarities among species members are obscured by rapid tandem gene duplications that may contribute to immune diversity in different species; and a fish specific group [50]. The human ACKR2 binds exclusively to the CCL17/22, MIP and MCP groups [11,50]. At least 18 CC chemokines (CK1-12 with some CC chemokines existing as duplicates) are present in rainbow trout [51], of which, CK6a/b, CK7a/b and CK5a/b belong to the CCL17/22, MCP and MIP groups, respectively [50]. The expression of these chemokines is inducible in a macrophage-like cell line (RTS-11) in response to TNF-a stimulation [51], and in vivo in HK after DNA vaccination with the G protein of VHSV [52]. Thus, the CCL17/22, MCP and MIP groups (i.e. trout CK6a/b, CK7a/b and CK5a/b, respectively) are candidate inflammatory chemokines that ACKR2 may bind to target them for degradation in fish. To understand the role(s) of ACKR2 in teleost
chemokine regulatory networks, this hypothesis will need be tested in future studies by examining the binding of fish ACKR2 to recombinant fish chemokines. Whole genome duplication (WGD) that happened twice (2R) early in vertebrate evolution, is an important mechanism for the evolution of phenotypic complexity, and is believed to have contributed to the genesis of the adaptive immune system in jawed vertebrates [53]. Teleost fish experienced a third (3R) WGD before their radiation ~350 Mya and the common ancestor of salmonids experienced a fourth (4R) WGD [26]. Thus many immune genes are present as two types, e.g. IL-1b [54], TNF-a [42] and subunits of IL12 [55], etc. in 3R/4R fish. Whilst there are lineage-specific expansions of CC chemokines that ACKR2 may potentially bind to in different vertebrates, ACKR2 is present as a single copy in the genomes of 3R fish, such as zebrafish, as also seen in other 2R vertebrates. Indeed, only a single copy of ACKR2 has been identified in rainbow trout in this report and in Atlantic salmon by Grimholt et al. [23]. However the presence of two ACKR2 paralogues in 4R salmonids cannot be excluded at the present time and will need to
Fig. 5. Modulation of trout ACKR expression by bacterial (A) and parasitic infection (B). (A) Rainbow trout were injected i.p. with Y. ruckeri or PBS as control [35]. HK tissue was collected at varying times post-challenge and real-time PCR analysis performed as described in Fig. 4. The gene expression was expressed as a fold change that was calculated as the average expression level of infected fish divided by that of the timematched controls. Results are presented as means þ SEM of five fish. (B) Kidneys from rainbow trout infected with Tetracapsuloides bryosalmonae or from unexposed (control) fish were collected during a natural infection [38]. The gene expression was expressed as a fold change that was calculated as the average expression level of infected fish divided by that of the controls. Results are presented as means þ SEM. The numbers of fish analysed were 11, 5, 9, 10 and 9 representing control, grade 1, 1e2, 2 and 3, respectively. The significance of LSD post hoc tests after one way-analysis of variance between infected and control fish is shown above the bars. *p 0.05.
Fig. 7. Modulation of ACKR2 expression in HK primary macrophages. Four day old primary HK macrophages were stimulated with poly I:C (50 mg/ml), peptidoglycan (PGN, 5 mg/ml), rIL-6 (100 ng/ml), rIFN-g (20 ng/ml), and rTNF-a 10 ng/ml), for 4 h, 8 h and 24 h. The gene expression was expressed as a fold change as in Fig. 6. The results are presented as the means þ SEM of cells from four fish. Significant results of a paired sample t-test between the stimulated samples and controls at the same time point is shown above the bars as: *p < 0.05.
396
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
be clarified after the completion of a salmonid genome. The deletion of duplicated ACKR2 paralogues in 3R fish and potentially in 4R salmonids might suggest that multiple copies of this gene are not compatible with its function. Expression analysis of ACKR2 in teleost fish has, to date, been undertaken in one individual salmon using an RNAseq transcriptome analysis of different tissues to determine whether the apparent large number of salmon chemokine receptors in the genome are expressed or are potential pseudogenes [24]. Clear expression was found in the HK (>10 reads per kilobase per million mapped reads), with a degree of expression (2e7 reads) also observed in kidney, spleen and gut tissues. In the present study we first investigated the tissue distribution of trout ACKR2 expression in six healthy trout and also found that the central immune organs in fish (HK and spleen) express the highest levels of ACKR2 (Fig. 4). The high level of expression in spleen and HK in healthy rainbow trout suggests a homeostatic role of ACKR2. It is known that the potential trout ACKR2 ligands discussed above (i.e. CK5, CK6 and CK7) are highly expressed in spleen and HK constitutively and can be up-regulated by vaccination [51,52]. Furthermore, the expression of these chemokines in leukocytes, for example from HK tissue, can be highly induced by other inflammatory cytokines such as TNF-a and IL-8 [51,52]. Thus, the high level ACKR2 expression may help to remove the constitutively expressed CC chemokines in spleen and HK and regulate the infiltration of inflammatory cells that express the receptors of these CC chemokines. Since endothelial cells are a primary site of ACKR2 expression, at least in humans [12], it was no surprise that we observed the lowest level of trout ACKR2 expression in blood that contains only red blood cells and leukocytes. Since inflammation is an important response to infection, we examined whether ACKR2 was modulated in two disease models. At 24 h post-infection with a pathogenic strain of Y. ruckeri, the expression of a number of pro-inflammatory cytokines, e.g. IL-1b, IL-6, IL-8, TNF-a and IFN-g, is known to be highly upregulated in immune organs such as the kidney [35,36]. The increased expression of trout ACKR2 in the HK at this time may be indicative of negative regulation of the inflammatory response at this stage of the infection. As the infection progresses, the pathogenic bacteria may overcome the host response leading to the death of the host. It is noteworthy that there is only a 2-fold increase of ACKR2 expression, possibly reflecting an increase in the number of cells that express this molecule. PKD of salmonid fish is a disease characterized by a slow progressive chronic immunopathology primarily caused by lymphocytic hyperplasia, formation of granulomatous lesions, and renal atrophy [38]. The expression of several CC chemokines, including potential ACKR2 ligands, is upregulated during clinical PKD (unpublished data). The downregulation of trout ACKR2 expression at early stages of PKD pathology (grade 1e2) may contribute to the increased infiltration of lymphocytes into the kidney by increasing the availability of proinflammatory CC chemokines. In addition to endothelial cells, human ACKR2 is also expressed in a range of leukocytes, e.g. dendritic cells, monocytes/macrophages and innate B cells [12,17]. Leukocyte expression is regulated by both stimulators and inhibitors of inflammatory responses. Thus, we investigated the modulation of trout ACKR2 expression by a range of PAMPs and cytokines in HK primary cells that contain a mixture of leukocyte types and in HK primary macrophages. Initially HK cells were stimulated with three cytokines rIL-2, rIL-6 and rIL-21. All the three cytokines are known to be active in trout HK cells [26,39,40], with IL-6 and IL-21 stimulating B cells, and IL-6 also active in macrophages. rIL-21 was found to up-regulate ACKR2 expression at a relatively late stage (24e48 h) post-stimulation, whilst ACKR2 expression was refractory to IL-2 and IL-6. This may
reflect a regulatory role of IL-21 with respect to the upregulation of molecules that scavenge secreted proinflammatory CC chemokines in order to limit the inflammatory response. The receptor for IL-2 and IL-21 shares a common signalling chain (g-chain) and hence IL-2 and IL-21 share many functions. For example, both can induce IFN-g expression in rainbow trout HK cells. However, IL-21 is also a strong inducer of the expression of rainbow trout Th17 cytokines, such as IL-17A/F1 and IL-22, and the anti-inflammatory cytokine IL10 [29], and unpublished data]. The late induction of ACKR2 expression by IL-21 may indicate an indirect effect of IL-21 via the upregulation of other cytokines. In primary HK macrophages, PAMPs (poly I:C and PGN) were found to down-regulate ACKR2 expression at 8 h. Under the same conditions, the expression of a number of inflammatory cytokines (e.g. IL-6, TNF-a and IL-1b) is highly upregulated [40,42,56]. The transient down-regulation of the scavenger ACKR2 by PAMPs may enhance the release of chemokines to attract immune cells to a site of infection. The effects of PAMPs on ACKR2 expression may be attributed to their ability to induce the production of inflammatory cytokines, such as IL-6 and TNF-a. However, the role of individual cytokines in the regulation of ACKR2 expression may differ. TNF-a is one of the earliest genes induced by PAMPs [42]. Thus, the transient down-regulation of ACKR2 expression by rTNF-a suggests a potential role for this cytokine in PAMP regulated ACKR2 expression. In contrast, ACKR2 expression was up-regulated by rIL-6 at 4h post stimulation whilst down-regulated at 8 h post stimulation. Trout IL6 is a proinflammatory cytokine that also has an immune regulatory function, and can down-regulate IL-1b and TNF-a expression [40]. Thus, the impact of rIL6 on ACKR2 expression may reflect the known dual role of fish IL-6 as a pro- and anti-inflammatory cytokine. IFN-g is a critical cytokine that is known to be induced in rainbow trout by several cytokines, such as IL-2 [39], IL-15 [57] and IL-21 [29]. IFN-g can modulate the expression of a number of other cytokines and chemokines in fish [58]. The down-regulation of ACKR2 expression by rIFN-g coincides temporally with the down-regulation of ACKR2 observed in the presence of PAMPs. These data imply that complex networks of signals induced by PAMPs and cytokines following immune activation are likely to be involved in the control of ACKR2 expression in fish. In conclusion, ACKRs have emerged as key components of the chemokine system, with an essential regulatory function in innate and adaptive immune responses and inflammation. ACKR2 is a ‘scavenging’ receptor for mammalian inflammatory CC chemokines, which are expanded in different vertebrate lineages by rapid tandem gene duplications that may contribute to immune diversity in different species. The cloning of rainbow trout ACKR2 and further identification of this molecule in Holostei, in lobe-finned fish and in reptiles greatly expands our knowledge of this gene during vertebrate evolution. Trout ACKR2 is highly expressed in central immune organs (i.e. spleen and head kidney), suggesting a homeostatic role of this receptor in limiting the availability of its potential ligands. The expression of trout ACKR2 is regulated by PAMPs and by a complex network of cytokines, indicating that ACKR2 is likely to have an important role in the control of the chemokine network in fish, as seen in the regulation of the mammalian chemokine network. Conflict of interest All authors declare no financial or commercial conflict of interest. Acknowledgements This work received funding from the MASTS pooling initiative (The Marine Alliance for Science and Technology for Scotland).
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
MASTS is funded by the Scottish Funding Council (grant reference HR09011) and contributing institutions. ZQ was supported by the Overseas training plan for young and middle-aged teachers and principals of colleges and universities in Jiangsu Province, China. YJ was supported financially by the National Scholarship Council of Shanghai City, China and JWH by the Biotechnology and Biological Sciences Research Council (BB/K009125/1). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.02.038. References [1] Zlotnik A, Yoshie O. The chemokine superfamily revisited. Immunity 2012;36: 705e16. [2] Bajoghli B. Evolution and function of chemokine receptors in the immune system of lower vertebrates. Eur J Immunol 2013;43:1686e92. [3] Nomiyama H, Osada N, Yoshie O. Systematic classification of vertebrate chemokines based on conserved synteny and evolutionary history. Genes Cells 2013;18:1e16. [4] Bachelerie F, Ben-Baruch A, Burkhardt AM, Combadiere C, Farber JM, Graham GJ, et al. International Union of Basic and clinical Pharmacology. LXXXIX. Update on the extended family of chemokine receptors and introducing a new nomenclature for atypical chemokine receptors. Pharmacol Rev 2013;66:1e79. [5] Nomiyama H, Osada N, Yoshie O. The evolution of mammalian chemokine genes. Cytokine Growth Factor Rev 2010;21:253e62. [6] Alejo A, Tafalla C. Chemokines in teleost fish species. Dev Comp Immunol 2011;35:1215e22. [7] Lira SA, Furtado GC. The biology of chemokines and their receptors. Immunol Res 2012;54:111e20. [8] Allen SJ, Crown SE, Handel TM. Chemokine: receptor structure, interactions, and antagonism. Annu Rev Immunol 2007;25:787e820. [9] Zweemer AJ, Toraskar J, Heitman LH, IJzerman AP. Bias in chemokine receptor signalling. Trends Immunol 2014;35:243e52. [10] Bennett LD, Fox JM, Signoret N. Mechanisms regulating chemokine receptor activity. Immunology 2011;134:246e56. [11] Nibbs RJ, Graham GJ. Immune regulation by atypical chemokine receptors. Nat Rev Immunol 2013;13:815e29. [12] Graham GJ, Locati M. Regulation of the immune and inflammatory responses by the 'atypical' chemokine receptor D6. J Pathol 2013;229:168e75. [13] Cancellieri C, Caronni N, Vacchini A, Savino B, Borroni EM, Locati M, et al. Review: structure-function and biological properties of the atypical chemokine receptor D6. Mol Immunol 2013;55:87e93. [14] Hansell CA, Hurson CE, Nibbs RJ. DARC and D6: silent partners in chemokine regulation? Immunol Cell Biol 2011;89:197e206. [15] Graham GJ, Locati M, Mantovani A, Rot A, Thelen M. The biochemistry and biology of the atypical chemokine receptors. Immunol Lett 2012;145:30e8. [16] Locati M, Torre YM, Galliera E, Bonecchi R, Bodduluri H, Vago G, et al. Silent chemoattractant receptors: D6 as a decoy and scavenger receptor for inflammatory CC chemokines. Cytokine Growth Factor Rev 2005;16:679e86. [17] Hansell CAH, MacLellan LM, Oldham RS, Doonan J, Chapple KJ, Anderson EJ, et al. The atypical chemokine receptor ACKR2 suppresses Th17 responses to protein autoantigens. Immunol Cell Biol 2015;93:167e76. [18] Nomiyama H, Osada N, Yoshie O. A family tree of vertebrate chemokine receptors for a unified nomenclature. Dev Comp Immunol 2011;35:705e15. [19] DeVries ME, Kelvin AA, Xu L, Ran L, Robinson J, Kelvin DJ. Defining the origins and evolution of the chemokine/chemokine receptor system. J Immunol 2006;176:401e15. [20] Liu Y, Chang MX, Wu SG, Nie P. Characterization of C-C chemokine receptor subfamily in teleost fish. Mol Immunol 2009;46:498e504. [21] Chen J, Xu Q, Wang T, Collet B, Corripio-Miyar Y, Bird S, et al. Phylogenetic analysis of vertebrate CXC chemokines reveals novel lineage specific groups in teleost fish. Dev Comp Immunol 2013;41:137e52. [22] Kuroda N, Uinuk-ool TS, Sato A, Samonte IE, Figueroa F, Mayer WE, et al. identification of chemokines and a chemokine receptor in cichlid fish, shark, and lamprey. Immunogenetics 2003;54:884e95. [23] Grimholt U, Hauge H, Hauge AG, Leong J, Koop BF. Chemokine receptors in Atlantic salmon. Dev Comp Immunol 2015;49:79e95. [24] Zou J, Redmond AK, Qi Z, Dooley H, Secombes CJ. The CXC chemokine receptors of fish: insights into CXCR evolution in the vertebrates. Gen Comp Endocrinol 2015. http://dx.doi.org/10.1016/j.ygcen.2015.01.004 [in press]. [25] Xu Q, Li R, Monte MM, Jiang Y, Nie P, Holland JW, et al. Sequence and expression analysis of rainbow trout CXCR2, CXCR3a and CXCR3b aids interpretation of lineage-specific conversion, loss and expansion of these receptors during vertebrate evolution. Dev Comp Immunol 2014;45:201e13. [26] Meyer A, Van de Peer Y. From 2R to 3R: evidence for a fish-specific genome duplication (FSGD). Bioessays 2005;27:937e45.
397
[27] Venkatesh B, Lee AP, Ravi V, Maurya AK, Lian MM, Swann JB, et al. Elephant shark genome provides unique insights into gnathostome evolution. Nature 2014;505:174e9. [28] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389e402. [29] Wang T, Diaz-Rosales P, Costa MM, Campbell S, Snow M, Collet B, et al. Functional characterization of a nonmammalian IL-21: rainbow trout Oncorhynchus mykiss IL-21 upregulates the expression of the Th cell signature cytokines IFN-gamma, IL-10, and IL-22. J Immunol 2011;186:708e821. [30] Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, et al. Multiple sequence alignment with the clustal series of programs. Nucleic Acids Res 2003;31:3497e500. [31] Campanella JJ, Bitincka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinforma 2003;4:29. [32] Letunic I, Doerks T, Bork P. SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Res 2012;40(Database issue):D302e5. [33] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary Genetics analysis version 6.0. Mol Biol Evol 2013;30:2725e9. [34] Muffato M, Louis A, Poisnel CE, Roest Crollius H. Genomicus: a database and a browser to study gene synteny in modern and ancestral genomes. Bioinformatics 2010;26:1119e21. [35] Harun NO, Wang T, Secombes CJ. Gene expression profiling in naïve and vaccinated rainbow trout after Yersinia ruckeri infection: insights into the mechanisms of protection seen in vaccinated fish. Vaccine 2011;29:4388e99. [36] Raida MK, Holten-Andersen L, Buchmann K. Association between Yersinia ruckeri infection, cytokine expression and survival in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol 2011;30:1257e64. [37] Clifton-Hadley RS, Bucke D, Richards RH. A study of the sequential clinical and pathological changes during proliferative kidney disease in rainbow trout, Salmo gairdneri Richardson. J Fish Dis 1987;10:335e52. [38] Gorgoglione B, Wang T, Secombes CJ, Holland JW. Immune gene expression profiling of proliferative kidney disease in rainbow trout Oncorhynchus mykiss reveals a dominance of anti-inflammatory, antibody and T helper cell-like activities. Vet Res 2013;44:55. [39] Díaz-Rosales P, Bird S, Wang TH, Fujiki K, Davidson WS, Zou J, et al. Rainbow trout interleukin-2: cloning, expression and bioactivity analysis. Fish Shellfish Immunol 2009;27:414e22. [40] Costa MM, Maehr T, Diaz-Rosales P, Secombes CJ, Wang T. Bioactivity studies of rainbow trout (Oncorhynchus mykiss) interleukin-6: effects on macrophage growth and antimicrobial peptide gene expression. Mol Immunol 2011;48: 1903e16. [41] Wang T, Huang W, Costa MM, Martin SA, Secombes CJ. Two copies of the genes encoding the subunits of putative interleukin (IL)-4/IL-13 receptors, IL4Ra,IL-13Ra1 and IL-13Ra2, have been identified in rainbow trout (Oncorhynchus mykiss) and have complex patterns of expression and modulation. Immunogenetics 2011;63:235e53. [42] Hong S, Li R, Xu Q, Secombes CJ, Wang T. Two types of TNF-a exist in teleost fish: phylogeny, expression, and bioactivity analysis of type-II TNF-a3 in rainbow trout Oncorhynchus mykiss. J Immunol 2013;191:5959e72. [43] Hong S, Zou J, Crampe M, Peddie S, Scapigliati G, Bols N, et al. The production and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1 beta. Vet Immunol Immunopathol 2001;81:1e14. [44] Wang T, Husain M, Hong S, Holland JW. Differential expression, modulation and bioactivity of distinct fish IL-12 isoforms: implication towards the evolution of Th1-like immune responses. Eur J Immunol 2014;44:1541e51. [45] Kochetov AV, Ahmad S, Ivanisenko V, Volkova OA, Kolchanov NA, Sarai A. uORFs, reinitiation and alternative translation start sites in human mRNAs. FEBS Lett 2008;582:1293e7. €ldi J, Lee AP, Fan S, Philippe H, Maccallum I, et al. The African [46] Amemiya CT, Alfo coelacanth genome provides insights into tetrapod evolution. Nature 2013;496:311e6. [47] Limatola C, Di Bartolomeo S, Catalano M, Trettel F, Fucile S, Castellani L, et al. Cysteine residues are critical for chemokine receptor CXCR2 functional properties. Exp Cell Res 2005;307:65e75. [48] Hewit KD, Fraser A, Nibbs RJ, Graham GJ. The N-terminal region of the atypical chemokine receptor ACKR2 is a key determinant of ligand binding. J Biol Chem 2014;289:12330e42. [49] Blackburn PE, Simpson CV, Nibbs RJ, O'Hara M, Booth R, Poulos J, et al. Purification and biochemical characterization of the D6 chemokine receptor. Biochem J 2004;379:263e72. [50] Peatman E, Liu Z. Evolution of CC chemokines in teleost fish: a case study in gene duplication and implications for immune diversity. Immunogenetics 2007;59:613e23. [51] Laing KJ, Secombes CJ. Trout CC chemokines: comparison of their sequences and expression patterns. Mol Immunol 2004;41:793e808. [52] Sanchez E, Coll J, Tafalla C. Expression of inducible CC chemokines in rainbow trout (Oncorhynchus mykiss) in response to a viral haemorrhagic septicemia virus (VHSV) DNA vaccine and interleukin 8. Dev Comp Immunol 2007;31:916e26. [53] Flajnik MF, Kasahara M. Origin and evolution of the adaptive immune system: genetic events and selective pressures. Nat Rev Genet 2010;11:47e59. [54] Husain M, Bird S, van Zwieten R, Secombes CJ, Wang T. Cloning of the IL-1b3 gene and IL-1b4 pseudogene in salmonids uncovers a second type of IL-1b gene in teleost fish. Dev Comp Immunol 2012;38:431e46.
398
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
[55] Wang T, Husain M. The expanding repertoire of the IL-12 cytokine family in teleost fish: identification of three paralogues each of the p35 and p40 genes in salmonids, and comparative analysis of their expression and modulation in Atlantic salmon Salmo salar. Dev Comp Immunol 2014;46:194e207. [56] Wang T, Bird S, Koussounadis A, Holland JW, Carrington A, Zou J, et al. Identification of a novel IL-1 cytokine family member in teleost fish. J Immunol 2009;183:962e74.
[57] Wang T, Holland JW, Carrington A, Zou J, Secombes CJ. Molecular and functional characterization of IL-15 in rainbow trout Oncorhynchus mykiss: a potent inducer of IFN-gamma expression in spleen leukocytes. J Immunol 2007;179:1475e88. [58] Zou J, Secombes CJ. Teleost fish interferons and their role in immunity. Dev Comp Immunol 2011;35:1376e87.
Contents lists available at ScienceDirect
Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Identification and expression analysis of an atypical chemokine receptor-2 (ACKR2)/CC chemokine binding protein-2 (CCBP2) in rainbow trout (Oncorhynchus mykiss) Zhitao Qi a, b, Yousheng Jiang a, c, Jason W. Holland a, Pin Nie d, Christopher J. Secombes a, Tiehui Wang a, * a
Scottish Fish Immunology Research Centre, Institute of Biological and Environmental Sciences, University of Aberdeen, Aberdeen AB24 2TZ, UK Key Laboratory of Aquaculture and Ecology of Coastal Pool in Jiangsu Province, Department of Ocean Technology, Yancheng Institute of Technology, Yancheng, Jiangsu, 224051, China c College of Fishery and Life Science, Shanghai Ocean University, Shanghai, 201306, China d State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, Hubei, 430072, China b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 19 January 2015 Received in revised form 23 February 2015 Accepted 24 February 2015 Available online 3 March 2015
Atypical chemokine receptors (ACKRs) have emerged as key components of the chemokine system, with an essential regulatory function in innate and adaptive immune responses and inflammation. In mammals ACKR2 is a ‘scavenging’ receptor for inflammatory CC chemokines and plays a central role in the resolution of in vivo inflammatory responses. An ACKR2 like gene has been identified and cloned in rainbow trout (Teleostei) in the present study, enabling the further identification of this molecule in another group of ray-finned teleost fish (Holostei), in a lobe-finned fish (Sarcopterygii-coelacanth), and in reptiles. The identity of these ACKR2 molecules is supported by their conserved structure, and by phylogenetic tree and synteny analysis. Trout ACKR2 is highly expressed in spleen and head kidney, suggesting a homeostatic role of this receptor in limiting the availability of its potential ligands. Trout ACKR2 expression can be modulated in vivo by bacterial and parasitic infections, and in vitro by PAMPs (poly I:C and peptidoglycan) and cytokines (IL-6, TNF-a, IFN-g and IL-21) in a time dependent manner. These patterns of expression and modulation suggest that trout ACKR2 is regulated in a complex way and has an important role in control of the chemokine network in fish as in mammals. © 2015 Elsevier Ltd. All rights reserved.
Keywords: Rainbow trout Oncorhynchus mykiss Atypical chemokine receptor-2 (ACKR2) CC chemokine binding protein-2 (CCBP2) Expression Infection
1. Introduction The initiation, maintenance and resolution of immune and inflammatory responses are crucially dependent on proper spatiotemporal positioning of leukocytes and on appropriate functional interactions between leukocytes and other cells in tissue specific contexts. The coordinated movement of leucocytes is mediated primarily by the chemokine system that includes a large number of ligands binding to a smaller number of receptors [1e3]. For example, the human chemokine system consists of 48 ligands and 23 receptors [1,4]. The chemokine ligands have been classified into four groups (CC, CXC, CX3C, and XC) based on the position of the first two cysteine residues [5e7]. On the other hand, the chemokine receptors are classified according to the chemokine group that they
* Corresponding author. Tel.: þ44 1224 272883; fax: þ44 1224 272396. E-mail address: [email protected] (T. Wang). http://dx.doi.org/10.1016/j.fsi.2015.02.038 1050-4648/© 2015 Elsevier Ltd. All rights reserved.
bind. Another classification of chemokines is based on functional criteria that group them into homeostatic and inflammatory chemokines. Homeostatic chemokines are constitutively expressed and regulate the migration of leukocytes and their precursors. The inflammatory chemokines are inducible and regulate leukocyte migration into tissues in response to an inflammatory stimulus, such as tissue damage or infection [1e4,8]. Chemokine receptors are seven transmembrane molecules connected by three intracellular loops (ICL) and three extracellular loops (ECL), and have a conserved DRY amino acid motif within the second ICL, which is involved in coupling to G-proteins [4,8]. The binding of classic chemokine receptors with their ligands results in multiple signal transduction pathways, triggering a cascade of intracellular events from gene transcription to cytoskeleton rearrangement and chemotaxis [9,10]. The chemokine/receptordependent responses can be regulated by a family of atypical chemokine receptors (ACKRs) that structurally resemble conventional chemokine receptors but cannot initiate classical chemokine
390
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
receptor signalling in response to ligand binding [4,11e13]. This family have at least four members in humans, i.e. ACKR1 (Duffy antigen receptor for chemokines, DARC), ACKR2 (D6 and CC chemokine binding protein 2 or CCBP2), ACKR3 (CXC-chemokine receptor 7 or CXCR7, and RDC1) and ACKR4 (CC-chemokine receptorlike 1 or CCRL1, CCXCKR and CCR11). ACKRs serve homeostatic functions by clearing chemokines from the circulation and tissues [1,4,14e16]. ACKR1 binds a large number of CXC and CC inflammatory but not homeostatic chemokines, is abundantly expressed by erythrocytes, and functions as a chemokine sink [1,4]. Human ACKR2 binds at least 12 inflammatory CC chemokines and plays well characterized roles in the regulation of the in vivo inflammatory response [11,12]. It is expressed by a variety of leukocytes, that in humans include dendritic cells and monocytes in PBLs, resident mast cells and intestinal mononuclear cells, and macrophages in inflamed lung tissue [11], whilst in mice it is regarded as highly restricted to innate-like B cells [17]. In addition it is expressed in a number of other cell types such as lymphatic endothelial cells, and in trophoblasts in the placenta [11]. Chemokines that have been bound by ACKR2 at the cell surface can be rapidly internalized, dislodged from the receptor by the low pH in endosomes and then destroyed in lysosomes. The chemokine-free ACKR2 travels back to the cell surface to re-acquire a ligand. Through repeated cycles, ACKR2 can progressively deplete extracellular chemokines [11]. ACKRs influence leukocyte recruitment by 'tuning' the concentrations and gradients of ligands in tissues by diverse means, including binding, storing, scavenging, transporting and trans-presenting chemokines. Thus, ACKRs have emerged as key components of the chemokine system, with an essential regulatory function in innate and adaptive immune responses and inflammation [4]. A large number of chemokines and chemokine receptors have been described in vertebrates from teleosts to mammals. Recent analysis of vertebrate genomes [3,5,18e22] has revealed that both chemokines and their receptors have been evolving rapidly through species-specific gene duplications, although this type of rapid evolution is more characteristic of the chemokines than their receptors. Whilst humans have 48 chemokines, analysis of the genomes of several teleosts, including zebrafish, medaka, stickleback and tetraodon have shown they contain 89, 36, 24 and 20 chemokines, respectively [5]. The orthologues of most of the known 23 human chemokine receptors have also been identified in teleost fish [3e5,18,23,24] together with a few chemokine receptors (eg CXCR3b/ssCXCR8 and drCCR12/ssCCR3) that are not present in humans [18,23e25]. In line with the fish specific (3R) wholegenome duplication (WGD) event, which occurred in ray finned fish species before the divergence of most teleost species [26], 3R fish often possess more than two genes for a single human counterpart, and in salmonids this can be even higher due to a 4R WGD event in this lineage [24]. So far, 40, 31, 24, 48 and 30 chemokine receptor genes have been identified in zebrafish, medaka, tetraodon, Atlantic salmon and pike, respectively [18,24]. The ACKR2 gene is present in birds and mammals, and recently has been identified in teleost fish (Atlantic salmon, zebrafish, pike) [24] and cartilaginous fish (elephant shark - accession. no. XM_007908256) [27], although in the latter case the N-terminal of the predicted translation is relatively large and may include upstream genomic sequence. However, to date little or no functional analysis has been performed in fish. In this communication, we first report the cloning of an ACKR2 gene from rainbow trout Oncorhynchus mykiss. We then identified ACKR2 genes in other fish groups (holostei, sarcopterygii) and in reptiles in the database, and characterized these molecules by phylogenetic tree analysis, synteny analysis and multiple alignment. Finally, the expression of trout ACKR2 was examined in vivo in healthy fish and under bacterial and parasitic infections, and in vitro in response to pathogen
associated molecular patterns (PAMPs) and recombinant trout cytokines. 2. Materials and methods 2.1. Fish Rainbow trout were obtained from the Mill of Elrich Trout Fishery (Aberdeenshire, UK). Fish were maintained in 1 m diameter aerated fibreglass tanks with a re-circulating water system at 14 ± 1 C and fed twice daily with standard commercial pellets (EWOS). Prior to experimentation, fish were acclimated for at least 2 weeks. 2.2. Cloning of trout ACKR2 and sequence analysis Using the human and mouse ACKR2 protein sequence as bait, a candidate trout EST (GenBank No. CA361402) was identified by BLAST [28] search in the National Center for Biotechnology Informatics database (http://www.ncbi.nlm.nih.gov). The EST (667 bp), containing a 5’-untranslated region (UTR) and an incomplete open reading frame (ORF), was again used to BLAST a draft trout genome downloaded from http://www.genoscope.cns.fr/trout-ggb/data/. A scaffold (MMSRT009B_scaff_1696_1, 252.8 kbp) was identified that contained a complete trout ACKR2 ORF. To confirm the predicted cDNA sequence, primers (Table 1) were designed within the 50 -UTR and predicted 30 -UTR for PCR amplification using head kidney (HK) cDNA samples. A single band was obtained, cloned and sequence analysed as described previously [23,29]. The presence of ACKR2 in other species was identified by BLAST [28] search at NCBI and Ensembl (Database release 78) databases. A multiple sequence alignment was produced using ClustalW [30]. Global sequence comparison was conducted using the MatGAT programme (V2.02) [31]. A transmembrane domain was predicted by SMART7 [32]. A phylogenetic tree was constructed by the neighbour-joining method using MEGA 6.0 [33], with 10,000 bootstrap calculations, using ACKR2 molecules and other chemokine receptors (eg CCR, CCRL) present at the human ACKR2 locus (Chr 3). Lastly, gene synteny at the ACKR2 locus was analysed using the Genomicus program [34]. 2.3. Tissue distribution of trout ACKR2 transcripts RNA preparation, cDNA synthesis, and real-time PCR analysis was performed as described previously [23,29]. Six healthy rainbow trout (~120 g) were killed and tail fin, adipose fin, thymus, gills, brain, scales, skin, muscle, liver, spleen, HK, caudal kidney, intestine, heart, blood and peritoneal adipose tissue were collected. The expression level of ACKR2 in different tissues was normalized to the expression of EF-1a. 2.4. Expression of trout ACKR2 during bacterial and parasitic infections Bacterial infection: A pathogenic strain (MT3072) of the Gramnegative salmonid pathogen, Yersinia ruckeri [35] was injected Table 1 Primers used for cloning and expression analysis. Primer
Sequence (50 to 30 )
Application
CCBP2-F1 CCBP2-R1 CCBP2eF CCBP2-R EF-1a-F EF-1a-R
CTTACTTCAGACAAACTGCTTAC TCCACTTAACTTCCCAGGTATAGT TCAGAAACACTTTTTTTCCAGAGATATAC GAGGGTGCAAATGATAATGTAAGAGAC CAAGGATATCCGTCGTGGCA ACAGCGAAACGACCAAGAGG
PCR cloning PCR cloning Real-time PCR Real-time PCR Real-time PCR Real-time PCR
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
intraperitoneally (i.p.) into fish at 1 106 cfu in 0.5 ml PBS, as described previously [36]. A control group of fish was injected with PBS only (0.5 ml/fish). Six fish were killed at 6 h, 24 h, 48 h and 72 h post-infection and head kidney tissue collected. Parasitic infection: Proliferative kidney disease (PKD) is a parasitic disease of salmonid fish caused by the myxozoan parasite Tetracapsuloides bryosalmonae [37]. The parasite infects salmonid fish primarily via the gill epithelia, subsequently gaining access to internal tissues via the vascular system with the kidney being the main target organ. Caudal kidney tissue collection from infected fish and cDNA preparation was as described previously [38]. The severity of clinical pathology was analysed and a kidney swelling grade assigned to each fish according to the kidney swelling index system devised by CliftoneHadley and colleagues [37]. Real-time PCR analysis of gene expression was conducted as described in Section 2.3. 2.5. Expression of trout ACKR2 in HK cells Since kidney tissue was used in the above studies and exhibits one of the highest constitutive levels of ACKR2 expression (see results), HK cells were used to examine whether ACKR2 expression could be modulated by rainbow trout cytokines in vitro. Freshly prepared HK cells were prepared as described previously [29] and stimulated with recombinant (r)IL-2 (200 ng/ml) [39], rIL-6 (100 ng/ml) [40] and rIL-21 (100 ng/ml) [29], since these are molecules that may affect gene expression in lymphocyte populations, including B cells that express ACKR2 in mammals. After 4 h, 8 h and 24 h of stimulation real-time PCR quantification of ACKR2 expression was performed as described above. The concentration chosen for these stimulants was deemed optimal for immune gene expression studies based on our previous studies [29,39,40]. In addition, since ACKR2 can be expressed in mononuclear cells, lung macrophages and monocytes in humans, expression modulation was lastly studied in macrophages. Four day old primary HK macrophages were prepared as described previously [40] and stimulated with a variety of PAMPS and cytokines, including polyinosinic: polycytidylic acid (poly I:C, 50 mg/ml, Sigma), peptidoglycan (PGN, 5 mg/ml, Invivogen), rIL-6 (100 ng/ml) [40], rIFN-g (20 ng/ml) [41], rTNF-a (10 ng/ml) [42], rIL-1b (20 ng/ml) [43], and two rIL-12 isoforms that differ in the p40 chain [44] for 4 h, 8 h and 24 h. As above, the concentration chosen for each stimulant was deemed optimal for immune gene expression experiments based on our previous studies [40e44]. Real-time PCR quantification of expression was as described above and the results were expressed as a fold change relative to the time-matched unstimulated controls. 2.6. Statistical analysis Real-time PCR data were analysed using the SPSS Statistics package 19.0 (SPSS Inc., Chicago, Illinois) as described previously [29,41]. One way-analysis of variance (ANOVA) and the LSD post hoc test were used to analyse expression data derived from the infection studies, with P < 0.05 between treatment and control groups considered significant. Since in vitro experiments consisted of sample sets from individual fish, a Paired-Sample T-test was applied. 3. Results 3.1. Cloning and characterisation of ACKR2 in rainbow trout and sequence analysis of genes from other vertebrate species The amplified trout ACKR2 cDNA (GenBank No. KM516350) was 1343 bp and was predicted to contain a 50 - UTR of 142 bp, an ORF of 1119 bp encoding for 372 aa and a 30 -UTR of 82 bp (Supplementary Fig. S1). The cDNA sequence matched perfectly with the genomic
391
scaffold 1696 that contained a single intron of 108 bp in the 50 -UTR. There is an in-frame upstream stop codon (TAG) in the 50 -UTR before the main ORF of the rainbow trout ACKR2 gene, suggesting the complete ORF had been correctly predicted in this species. A short ORF encoding for 10 aa is also present in the 50 -UTR that may be involved in the regulation of the trout ACKR2 translation [45] (Fig. S1). Further search of databases identified ACKR2 like molecules for the first time in a number of other fish species i.e. the rayfinned fish Mexican tetra Astyanax mexicanus and spotted gar Lepisosteus oculatus, and the lobe-finned fish Latimeria chalumnae (coelacanth) [46], as well as in reptiles (eg. Chinese soft-shelled turtle Pelodiscus sinensis, Western painted turtle Chrysemys picta bellii, green sea turtle Chelonia mydas and alligator Alligator mississippiensis). The newly identified ACKR2 molecules showed top hits to ACKR2, and CCRL and CCR molecules clustered on human chromosome 3 [1,4,20], by BLAST search. Therefore, a neighbour-joining phylogenetic tree was constructed that included these CCR and CCRL molecules that clustered on human chromosome 3. ACKR1 members were also included as an out group. The predicted elephant shark ACKR2 [27] was excluded from the phylogenetic tree analysis because of the uncertainty of its N-terminal sequence. All the ACKR2 molecules were grouped together and separated from other molecules (CCR1-5,8,9, CCRL1-2 and ACKR1) with high bootstrap support (98%) in a neighbour-joining tree. In the ACKR2 group, lineage-specific clades with over 90% bootstrap support (i.e. mammals, birds, reptiles and ray-finned fish) are apparent, with the lobe-finned coelacanth ACKR2 lying outside the ray-finned fish clade as typically seen in phylogenetic tree analysis [23]. This tree (Fig. 1) was also in agreement with homology analysis on fulllength amino acid sequences (Table S1) which showed that the newly identified fish and reptile ACKR2 molecules have higher identities to mammalian and bird ACKR2s than to other CCR and CCRL molecules (e.g. reptile ACKR2 molecules had 45.7e52.1% identities to mammalian and bird ACKR2s compared to only 27.3e39.7% identities to other human CCR and CCRL molecules on chromosome 3 (Table S1)). The ACKR2 molecules from 2R fish (spotted gar and coelacanth) had apparently higher identities to tetrapod ACKR2s than to those from 3R fish (salmonids, zebrafish and tetra), e.g. the coelacanth ACKR2 shared 39.5e51.3% amino acid identities to tetrapod ACKR2s compared to 27.8e40.6% identities between ACKR2 molecules from 3R fish and tetrapods (Table S1). Further support of the newly identified ACKR2 molecules was derived from synteny analysis (Fig. 2). Most of the neighbouring genes (eg CYP8B1, HIGD1A, CCDC13, HHATL, KLHL40 and ZBTB47) of the Chinese soft-shelled turtle ACKR2 are syntenically conserved in humans, chicken, spotted gar and zebrafish. A HIGD1A gene was also found close to trout ACKR2 on scaffold 1696 (Fig. 2). To further characterise the newly identified fish and reptile ACKR2 molecules, a multiple alignment was constructed with selected ACKR2 molecules from mammals (human and mouse), birds (chicken and duck), reptiles (Chinese soft-shelled turtle, green sea turtle and alligator), ray-finned fish (trout, salmon, zebrafish, Mexican tetra and spotted gar), and the lobe-finned coelacanth (Fig. 3). Vertebrate ACKR2 molecules are well conserved in the seven TM domains with sequences all possessing four cysteine residues (one in the N-terminal and three in the ECLs) that form two disulphide bonds, one from the N-terminal to ECL3 and one from ECL1 to ECL2 [47]. Tyrosine-linked sulphation is important for ACKR ligand binding, internalisation and scavenging [48]. There are 3e5 tyrosine residues at the N-termini of these proteins that show a degree of conservation (Fig. 3), with at least three completely conserved in each animal lineage. A potential N-glycosylation site is also conserved in ACKR2 molecules from lobe-finned coelacanth and tetrapods just before the conserved tyrosine motif. A potential
392
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
Fig. 1. An unrooted phylogenetic tree of ACKR2, CCR and CCRL molecules on human chromosome 3 and from selected vertebrates. The tree was constructed using amino acid multiple alignments and the neighbour-joining method within the MEGA6 program. Node values represent percent bootstrap confidence derived from 10,000 replicates. The evolutionary distances were computed using the JTT matrix-based method and pairwise deletion option. The accession number for each sequence is given after the species name and molecular type. The trout ACKR2 is shaded. The bootstrap values at the roots of the ACKR clades from different lineages are highlighted with a circle. The molecular groups are indicated on the right.
N-linked glycosylation site is also present in this region in rainbow trout, Atlantic salmon, spotted gar and Mexican tetra at the N-terminus of ACKR2 but is missing in zebrafish. This site is glycosylated in human ACKR2 [49]. Interestingly, the lobe-finned coelacanth ACKR2 has two potential N-linked glycosylation sites in the alignment, one that is conserved in tetrapod ACKR2 molecules and the other conserved in salmonid ACKR2 homologues. A DRY motif at the boundary of TM3 and ICL2 is well conserved in typical chemokine receptors and critical for ligand induced signalling activity [7,13]. Unlike ACKR2 molecules in higher vertebrates, this DRY motif has been previously described in Atlantic salmon ACKR2 [24] and, from the current study, reported in rainbow trout and coelacanth ACKR2 (Fig. 3). 3.2. Tissue distribution of trout ACKR2 expression To gain an insight into ACKR2 function, we first examined trout ACKR2 expression in seventeen tissues from six healthy fish using real-time PCR. The expression of trout ACKR2 is ubiquitous, with
the highest expression levels found in spleen and HK (no significant difference as indicated by paired samples T test), and the lowest in blood and tail fins (Fig. 4). A relatively high level of ACKR2 expression was also found in muscle, heart, gonad, caudal kidney and adipose fin. 3.3. Expression of trout ACKR2 after bacterial and parasite infections We next investigated ACKR2 transcriptional modulation during bacterial and parasitic infections. Following infection of trout with the common Gram-negative bacterial fish pathogen, Y. ruckeri [35], the expression level of ACKR2 in HK was significantly increased (2.2-fold) at 24 h relative to time matched control fish, but stayed at the same level as the time-matched controls at 6 h, 48 h and 72 h (Fig. 5A). In fish with clinical PKD, ACKR2 expression was significantly decreased in kidneys from fish with a PKD swelling grade of 1e2, but was not modulated in kidneys from fish with a swelling grade of 1, 2 or 3 [37] (Fig. 5B).
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
393
Fig. 2. Diagram to show gene synteny at the ACKR2 loci in vertebrates. The Chinese soft-shelled turtle ACKR2 locus on Chromosome (Chr) JH208041 was used as a reference to compare the conserved synteny between the ACKR2 loci in fish (spotted gar, zebrafish and rainbow trout), birds (chicken) and mammals (human). The gene transcriptional direction is indicated by “þ” or ““.
3.4. Expression of trout ACKR2 in HK primary leukocytes The modulation of kidney ACKR2 expression by infection prompted us to examine its expression in immune cells isolated from this tissue. The HK cells are a mixed population of cell types, including lymphocytes, granulocytes and macrophages amongst others. In response to stimulation with rIL-2, rIL-6 and rIL-21 we found that rIL-2 and rIL-6 had no effect on ACKR2 expression whilst, in contrast, rIL-21 up-regulated ACKR2 expression at 24 h and 48 h but had no impact at earlier time points (Fig. 6). The cytokines were shown to be active by examining the expression of marker genes that are highly responsive to each recombinant cytokine; namely CATH2 for rIL-6 [40] and IFN-g for rIL-2 [39] and rIL-21 [29]. In each case they were highly upregulated in the current study (data not shown). Since ACKR2 can be expressed in monocytes/macrophages in certain situations, we also examined whether ACKR2 could be modulated in stimulated HK primary macrophage cultures. Trout ACKR2 expression was detectable constitutively in HK primary macrophages (Fig. 7). A variety of known macrophage stimulants were used in this study and included PAMPs (Poly I:C and PGN) and recombinant cytokines (rIFN-g, rTNF-a, rIL-1b, rIL-6 and rIL12). Both PAMPs and the inflammatory cytokine rIFN-g downregulated ACKR2 expression at 8 h, but had no effects at 4 h and 24 h (Fig. 7). rIL-6 up-regulated ACKR2 expression at 4 h (1.8 fold) but down-regulated its expression at 8 h, with no effect apparent at 24 h post stimulation. rTNF-a down-regulated ACKR2 expression at 4 h but had no effect at later time points (Fig. 7). ACKR2 expression was refractory to stimulation with rIL-1b [51] and the
two rIL-12 isoforms [52] from 4 h to 24 h in primary HK macrophages (data not shown).
4. Discussion In this report, we first cloned an ACKR2 like gene in rainbow trout and further identified ACKR2 genes in a lobe-finned fish, in two groups of ray-finned fish (holostei, teleostei), and in reptiles. The identity of these newly identified ACKR2 molecules is supported by; (A) their higher identity to mammalian and bird ACKR proteins (Table S1); (B) the phylogenetic tree analysis (Fig. 1) that illustrates that all ACKR2 homologues reported in this study group with mammalian and bird ACKR2 molecules with high bootstrap support (98%); (C) a well conserved gene synteny (Fig. 2) at the ACKR2 loci in reptiles (Chinese soft-shelled turtle), mammals (humans), birds (chicken) and ray-finned fish (zebrafish and spotted gar); and (D) well conserved structural features in the multiple alignment (Fig. 3). ACKRs are emerging as crucial regulatory components of chemokine networks in a wide range of developmental, physiological and pathological contexts in mammals [4,11]. ACKR2 is a ‘scavenging’ receptor for inflammatory CC chemokines and plays a central role in the resolution of inflammatory responses in vivo. However, this receptor has so far only been studied functionally in mammals and birds, with the identification of ACKR2 in other vertebrates unknown until the recent analysis of the salmon genome confirmed its presence in teleost fish. In this report we describe the independent cloning of the rainbow trout ACKR2 gene and greatly expand our knowledge of
Fig. 3. Multiple alignment of fish ACKR2s and selected ACKR2 molecules from mammals, birds and reptiles. The multiple alignment was produced using ClustalW, and conserved amino acids shaded using BOXSHADE (version 3.21) except in the N-terminal domain. The N-terminus, seven transmembrane domains (TM1-7), three extracellular loops (ECL1-3) and intracellular loops (ICL1-3) and the C-terminus are marked above the alignment. The four conserved cysteine residues in each extracellular domain are indicated by black arrows. The potential N-linked glycosylation site at the N terminal is underlined. Conserved tyrosine residues in the N-terminal and the DRY motifs in ICL2 are highlighted below the alignment. The accession numbers for sequences used in this alignment are given in Fig. 1.
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
Fig. 4. Constitutive expression of trout ACKR2 in vivo. The transcript expression level of the trout ACKR2 was determined by real time RT-PCR in 17 tissues from six fish. The transcript level was first calculated using a serial dilution of references and normalized against the expression level of EF-1a. The results represent the average þ SEM of six fish. AT ¼ adipose tissue, AF ¼ adipose fin, CK ¼ caudal kidney, HK ¼ head kidney.
395
Fig. 6. Modulation of ACKR2 expression in HK cells by IL-2, IL-6 and IL-21. Freshly prepared HK leukocytes were stimulated with rIL-2 (200 ng/ml), rIL-6 (100 ng/ml), rIL21 (100 ng/ml) or with medium only as control, for 4 h, 8 h and 24 h. The gene expression was expressed as a fold change that was calculated as the average expression level of stimulated samples divided by that of the time-matched controls. The means þ SEM of cells from four fish is shown. Significant results of a paired sample T test between stimulated samples and their time matched controls is shown above the bars as: *p < 0.05.
this gene in fish and reptiles, and undertake studies of expression modulation in fish for the first time. Of the 28 known human CC chemokines, ACKR2 can bind 14 CC inflammatory chemokines [12]. Global analysis of CC chemokines in teleosts revealed 7 large groups, including CCL19/21/25, CCL20 and CCL27/28 groups, that are highly related to mammalian CC chemokines, and the CCL17/22, MIP and MCP groups, where similarities among species members are obscured by rapid tandem gene duplications that may contribute to immune diversity in different species; and a fish specific group [50]. The human ACKR2 binds exclusively to the CCL17/22, MIP and MCP groups [11,50]. At least 18 CC chemokines (CK1-12 with some CC chemokines existing as duplicates) are present in rainbow trout [51], of which, CK6a/b, CK7a/b and CK5a/b belong to the CCL17/22, MCP and MIP groups, respectively [50]. The expression of these chemokines is inducible in a macrophage-like cell line (RTS-11) in response to TNF-a stimulation [51], and in vivo in HK after DNA vaccination with the G protein of VHSV [52]. Thus, the CCL17/22, MCP and MIP groups (i.e. trout CK6a/b, CK7a/b and CK5a/b, respectively) are candidate inflammatory chemokines that ACKR2 may bind to target them for degradation in fish. To understand the role(s) of ACKR2 in teleost
chemokine regulatory networks, this hypothesis will need be tested in future studies by examining the binding of fish ACKR2 to recombinant fish chemokines. Whole genome duplication (WGD) that happened twice (2R) early in vertebrate evolution, is an important mechanism for the evolution of phenotypic complexity, and is believed to have contributed to the genesis of the adaptive immune system in jawed vertebrates [53]. Teleost fish experienced a third (3R) WGD before their radiation ~350 Mya and the common ancestor of salmonids experienced a fourth (4R) WGD [26]. Thus many immune genes are present as two types, e.g. IL-1b [54], TNF-a [42] and subunits of IL12 [55], etc. in 3R/4R fish. Whilst there are lineage-specific expansions of CC chemokines that ACKR2 may potentially bind to in different vertebrates, ACKR2 is present as a single copy in the genomes of 3R fish, such as zebrafish, as also seen in other 2R vertebrates. Indeed, only a single copy of ACKR2 has been identified in rainbow trout in this report and in Atlantic salmon by Grimholt et al. [23]. However the presence of two ACKR2 paralogues in 4R salmonids cannot be excluded at the present time and will need to
Fig. 5. Modulation of trout ACKR expression by bacterial (A) and parasitic infection (B). (A) Rainbow trout were injected i.p. with Y. ruckeri or PBS as control [35]. HK tissue was collected at varying times post-challenge and real-time PCR analysis performed as described in Fig. 4. The gene expression was expressed as a fold change that was calculated as the average expression level of infected fish divided by that of the timematched controls. Results are presented as means þ SEM of five fish. (B) Kidneys from rainbow trout infected with Tetracapsuloides bryosalmonae or from unexposed (control) fish were collected during a natural infection [38]. The gene expression was expressed as a fold change that was calculated as the average expression level of infected fish divided by that of the controls. Results are presented as means þ SEM. The numbers of fish analysed were 11, 5, 9, 10 and 9 representing control, grade 1, 1e2, 2 and 3, respectively. The significance of LSD post hoc tests after one way-analysis of variance between infected and control fish is shown above the bars. *p 0.05.
Fig. 7. Modulation of ACKR2 expression in HK primary macrophages. Four day old primary HK macrophages were stimulated with poly I:C (50 mg/ml), peptidoglycan (PGN, 5 mg/ml), rIL-6 (100 ng/ml), rIFN-g (20 ng/ml), and rTNF-a 10 ng/ml), for 4 h, 8 h and 24 h. The gene expression was expressed as a fold change as in Fig. 6. The results are presented as the means þ SEM of cells from four fish. Significant results of a paired sample t-test between the stimulated samples and controls at the same time point is shown above the bars as: *p < 0.05.
396
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
be clarified after the completion of a salmonid genome. The deletion of duplicated ACKR2 paralogues in 3R fish and potentially in 4R salmonids might suggest that multiple copies of this gene are not compatible with its function. Expression analysis of ACKR2 in teleost fish has, to date, been undertaken in one individual salmon using an RNAseq transcriptome analysis of different tissues to determine whether the apparent large number of salmon chemokine receptors in the genome are expressed or are potential pseudogenes [24]. Clear expression was found in the HK (>10 reads per kilobase per million mapped reads), with a degree of expression (2e7 reads) also observed in kidney, spleen and gut tissues. In the present study we first investigated the tissue distribution of trout ACKR2 expression in six healthy trout and also found that the central immune organs in fish (HK and spleen) express the highest levels of ACKR2 (Fig. 4). The high level of expression in spleen and HK in healthy rainbow trout suggests a homeostatic role of ACKR2. It is known that the potential trout ACKR2 ligands discussed above (i.e. CK5, CK6 and CK7) are highly expressed in spleen and HK constitutively and can be up-regulated by vaccination [51,52]. Furthermore, the expression of these chemokines in leukocytes, for example from HK tissue, can be highly induced by other inflammatory cytokines such as TNF-a and IL-8 [51,52]. Thus, the high level ACKR2 expression may help to remove the constitutively expressed CC chemokines in spleen and HK and regulate the infiltration of inflammatory cells that express the receptors of these CC chemokines. Since endothelial cells are a primary site of ACKR2 expression, at least in humans [12], it was no surprise that we observed the lowest level of trout ACKR2 expression in blood that contains only red blood cells and leukocytes. Since inflammation is an important response to infection, we examined whether ACKR2 was modulated in two disease models. At 24 h post-infection with a pathogenic strain of Y. ruckeri, the expression of a number of pro-inflammatory cytokines, e.g. IL-1b, IL-6, IL-8, TNF-a and IFN-g, is known to be highly upregulated in immune organs such as the kidney [35,36]. The increased expression of trout ACKR2 in the HK at this time may be indicative of negative regulation of the inflammatory response at this stage of the infection. As the infection progresses, the pathogenic bacteria may overcome the host response leading to the death of the host. It is noteworthy that there is only a 2-fold increase of ACKR2 expression, possibly reflecting an increase in the number of cells that express this molecule. PKD of salmonid fish is a disease characterized by a slow progressive chronic immunopathology primarily caused by lymphocytic hyperplasia, formation of granulomatous lesions, and renal atrophy [38]. The expression of several CC chemokines, including potential ACKR2 ligands, is upregulated during clinical PKD (unpublished data). The downregulation of trout ACKR2 expression at early stages of PKD pathology (grade 1e2) may contribute to the increased infiltration of lymphocytes into the kidney by increasing the availability of proinflammatory CC chemokines. In addition to endothelial cells, human ACKR2 is also expressed in a range of leukocytes, e.g. dendritic cells, monocytes/macrophages and innate B cells [12,17]. Leukocyte expression is regulated by both stimulators and inhibitors of inflammatory responses. Thus, we investigated the modulation of trout ACKR2 expression by a range of PAMPs and cytokines in HK primary cells that contain a mixture of leukocyte types and in HK primary macrophages. Initially HK cells were stimulated with three cytokines rIL-2, rIL-6 and rIL-21. All the three cytokines are known to be active in trout HK cells [26,39,40], with IL-6 and IL-21 stimulating B cells, and IL-6 also active in macrophages. rIL-21 was found to up-regulate ACKR2 expression at a relatively late stage (24e48 h) post-stimulation, whilst ACKR2 expression was refractory to IL-2 and IL-6. This may
reflect a regulatory role of IL-21 with respect to the upregulation of molecules that scavenge secreted proinflammatory CC chemokines in order to limit the inflammatory response. The receptor for IL-2 and IL-21 shares a common signalling chain (g-chain) and hence IL-2 and IL-21 share many functions. For example, both can induce IFN-g expression in rainbow trout HK cells. However, IL-21 is also a strong inducer of the expression of rainbow trout Th17 cytokines, such as IL-17A/F1 and IL-22, and the anti-inflammatory cytokine IL10 [29], and unpublished data]. The late induction of ACKR2 expression by IL-21 may indicate an indirect effect of IL-21 via the upregulation of other cytokines. In primary HK macrophages, PAMPs (poly I:C and PGN) were found to down-regulate ACKR2 expression at 8 h. Under the same conditions, the expression of a number of inflammatory cytokines (e.g. IL-6, TNF-a and IL-1b) is highly upregulated [40,42,56]. The transient down-regulation of the scavenger ACKR2 by PAMPs may enhance the release of chemokines to attract immune cells to a site of infection. The effects of PAMPs on ACKR2 expression may be attributed to their ability to induce the production of inflammatory cytokines, such as IL-6 and TNF-a. However, the role of individual cytokines in the regulation of ACKR2 expression may differ. TNF-a is one of the earliest genes induced by PAMPs [42]. Thus, the transient down-regulation of ACKR2 expression by rTNF-a suggests a potential role for this cytokine in PAMP regulated ACKR2 expression. In contrast, ACKR2 expression was up-regulated by rIL-6 at 4h post stimulation whilst down-regulated at 8 h post stimulation. Trout IL6 is a proinflammatory cytokine that also has an immune regulatory function, and can down-regulate IL-1b and TNF-a expression [40]. Thus, the impact of rIL6 on ACKR2 expression may reflect the known dual role of fish IL-6 as a pro- and anti-inflammatory cytokine. IFN-g is a critical cytokine that is known to be induced in rainbow trout by several cytokines, such as IL-2 [39], IL-15 [57] and IL-21 [29]. IFN-g can modulate the expression of a number of other cytokines and chemokines in fish [58]. The down-regulation of ACKR2 expression by rIFN-g coincides temporally with the down-regulation of ACKR2 observed in the presence of PAMPs. These data imply that complex networks of signals induced by PAMPs and cytokines following immune activation are likely to be involved in the control of ACKR2 expression in fish. In conclusion, ACKRs have emerged as key components of the chemokine system, with an essential regulatory function in innate and adaptive immune responses and inflammation. ACKR2 is a ‘scavenging’ receptor for mammalian inflammatory CC chemokines, which are expanded in different vertebrate lineages by rapid tandem gene duplications that may contribute to immune diversity in different species. The cloning of rainbow trout ACKR2 and further identification of this molecule in Holostei, in lobe-finned fish and in reptiles greatly expands our knowledge of this gene during vertebrate evolution. Trout ACKR2 is highly expressed in central immune organs (i.e. spleen and head kidney), suggesting a homeostatic role of this receptor in limiting the availability of its potential ligands. The expression of trout ACKR2 is regulated by PAMPs and by a complex network of cytokines, indicating that ACKR2 is likely to have an important role in the control of the chemokine network in fish, as seen in the regulation of the mammalian chemokine network. Conflict of interest All authors declare no financial or commercial conflict of interest. Acknowledgements This work received funding from the MASTS pooling initiative (The Marine Alliance for Science and Technology for Scotland).
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
MASTS is funded by the Scottish Funding Council (grant reference HR09011) and contributing institutions. ZQ was supported by the Overseas training plan for young and middle-aged teachers and principals of colleges and universities in Jiangsu Province, China. YJ was supported financially by the National Scholarship Council of Shanghai City, China and JWH by the Biotechnology and Biological Sciences Research Council (BB/K009125/1). Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2015.02.038. References [1] Zlotnik A, Yoshie O. The chemokine superfamily revisited. Immunity 2012;36: 705e16. [2] Bajoghli B. Evolution and function of chemokine receptors in the immune system of lower vertebrates. Eur J Immunol 2013;43:1686e92. [3] Nomiyama H, Osada N, Yoshie O. Systematic classification of vertebrate chemokines based on conserved synteny and evolutionary history. Genes Cells 2013;18:1e16. [4] Bachelerie F, Ben-Baruch A, Burkhardt AM, Combadiere C, Farber JM, Graham GJ, et al. International Union of Basic and clinical Pharmacology. LXXXIX. Update on the extended family of chemokine receptors and introducing a new nomenclature for atypical chemokine receptors. Pharmacol Rev 2013;66:1e79. [5] Nomiyama H, Osada N, Yoshie O. The evolution of mammalian chemokine genes. Cytokine Growth Factor Rev 2010;21:253e62. [6] Alejo A, Tafalla C. Chemokines in teleost fish species. Dev Comp Immunol 2011;35:1215e22. [7] Lira SA, Furtado GC. The biology of chemokines and their receptors. Immunol Res 2012;54:111e20. [8] Allen SJ, Crown SE, Handel TM. Chemokine: receptor structure, interactions, and antagonism. Annu Rev Immunol 2007;25:787e820. [9] Zweemer AJ, Toraskar J, Heitman LH, IJzerman AP. Bias in chemokine receptor signalling. Trends Immunol 2014;35:243e52. [10] Bennett LD, Fox JM, Signoret N. Mechanisms regulating chemokine receptor activity. Immunology 2011;134:246e56. [11] Nibbs RJ, Graham GJ. Immune regulation by atypical chemokine receptors. Nat Rev Immunol 2013;13:815e29. [12] Graham GJ, Locati M. Regulation of the immune and inflammatory responses by the 'atypical' chemokine receptor D6. J Pathol 2013;229:168e75. [13] Cancellieri C, Caronni N, Vacchini A, Savino B, Borroni EM, Locati M, et al. Review: structure-function and biological properties of the atypical chemokine receptor D6. Mol Immunol 2013;55:87e93. [14] Hansell CA, Hurson CE, Nibbs RJ. DARC and D6: silent partners in chemokine regulation? Immunol Cell Biol 2011;89:197e206. [15] Graham GJ, Locati M, Mantovani A, Rot A, Thelen M. The biochemistry and biology of the atypical chemokine receptors. Immunol Lett 2012;145:30e8. [16] Locati M, Torre YM, Galliera E, Bonecchi R, Bodduluri H, Vago G, et al. Silent chemoattractant receptors: D6 as a decoy and scavenger receptor for inflammatory CC chemokines. Cytokine Growth Factor Rev 2005;16:679e86. [17] Hansell CAH, MacLellan LM, Oldham RS, Doonan J, Chapple KJ, Anderson EJ, et al. The atypical chemokine receptor ACKR2 suppresses Th17 responses to protein autoantigens. Immunol Cell Biol 2015;93:167e76. [18] Nomiyama H, Osada N, Yoshie O. A family tree of vertebrate chemokine receptors for a unified nomenclature. Dev Comp Immunol 2011;35:705e15. [19] DeVries ME, Kelvin AA, Xu L, Ran L, Robinson J, Kelvin DJ. Defining the origins and evolution of the chemokine/chemokine receptor system. J Immunol 2006;176:401e15. [20] Liu Y, Chang MX, Wu SG, Nie P. Characterization of C-C chemokine receptor subfamily in teleost fish. Mol Immunol 2009;46:498e504. [21] Chen J, Xu Q, Wang T, Collet B, Corripio-Miyar Y, Bird S, et al. Phylogenetic analysis of vertebrate CXC chemokines reveals novel lineage specific groups in teleost fish. Dev Comp Immunol 2013;41:137e52. [22] Kuroda N, Uinuk-ool TS, Sato A, Samonte IE, Figueroa F, Mayer WE, et al. identification of chemokines and a chemokine receptor in cichlid fish, shark, and lamprey. Immunogenetics 2003;54:884e95. [23] Grimholt U, Hauge H, Hauge AG, Leong J, Koop BF. Chemokine receptors in Atlantic salmon. Dev Comp Immunol 2015;49:79e95. [24] Zou J, Redmond AK, Qi Z, Dooley H, Secombes CJ. The CXC chemokine receptors of fish: insights into CXCR evolution in the vertebrates. Gen Comp Endocrinol 2015. http://dx.doi.org/10.1016/j.ygcen.2015.01.004 [in press]. [25] Xu Q, Li R, Monte MM, Jiang Y, Nie P, Holland JW, et al. Sequence and expression analysis of rainbow trout CXCR2, CXCR3a and CXCR3b aids interpretation of lineage-specific conversion, loss and expansion of these receptors during vertebrate evolution. Dev Comp Immunol 2014;45:201e13. [26] Meyer A, Van de Peer Y. From 2R to 3R: evidence for a fish-specific genome duplication (FSGD). Bioessays 2005;27:937e45.
397
[27] Venkatesh B, Lee AP, Ravi V, Maurya AK, Lian MM, Swann JB, et al. Elephant shark genome provides unique insights into gnathostome evolution. Nature 2014;505:174e9. [28] Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389e402. [29] Wang T, Diaz-Rosales P, Costa MM, Campbell S, Snow M, Collet B, et al. Functional characterization of a nonmammalian IL-21: rainbow trout Oncorhynchus mykiss IL-21 upregulates the expression of the Th cell signature cytokines IFN-gamma, IL-10, and IL-22. J Immunol 2011;186:708e821. [30] Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, et al. Multiple sequence alignment with the clustal series of programs. Nucleic Acids Res 2003;31:3497e500. [31] Campanella JJ, Bitincka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinforma 2003;4:29. [32] Letunic I, Doerks T, Bork P. SMART 7: recent updates to the protein domain annotation resource. Nucleic Acids Res 2012;40(Database issue):D302e5. [33] Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. MEGA6: molecular evolutionary Genetics analysis version 6.0. Mol Biol Evol 2013;30:2725e9. [34] Muffato M, Louis A, Poisnel CE, Roest Crollius H. Genomicus: a database and a browser to study gene synteny in modern and ancestral genomes. Bioinformatics 2010;26:1119e21. [35] Harun NO, Wang T, Secombes CJ. Gene expression profiling in naïve and vaccinated rainbow trout after Yersinia ruckeri infection: insights into the mechanisms of protection seen in vaccinated fish. Vaccine 2011;29:4388e99. [36] Raida MK, Holten-Andersen L, Buchmann K. Association between Yersinia ruckeri infection, cytokine expression and survival in rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol 2011;30:1257e64. [37] Clifton-Hadley RS, Bucke D, Richards RH. A study of the sequential clinical and pathological changes during proliferative kidney disease in rainbow trout, Salmo gairdneri Richardson. J Fish Dis 1987;10:335e52. [38] Gorgoglione B, Wang T, Secombes CJ, Holland JW. Immune gene expression profiling of proliferative kidney disease in rainbow trout Oncorhynchus mykiss reveals a dominance of anti-inflammatory, antibody and T helper cell-like activities. Vet Res 2013;44:55. [39] Díaz-Rosales P, Bird S, Wang TH, Fujiki K, Davidson WS, Zou J, et al. Rainbow trout interleukin-2: cloning, expression and bioactivity analysis. Fish Shellfish Immunol 2009;27:414e22. [40] Costa MM, Maehr T, Diaz-Rosales P, Secombes CJ, Wang T. Bioactivity studies of rainbow trout (Oncorhynchus mykiss) interleukin-6: effects on macrophage growth and antimicrobial peptide gene expression. Mol Immunol 2011;48: 1903e16. [41] Wang T, Huang W, Costa MM, Martin SA, Secombes CJ. Two copies of the genes encoding the subunits of putative interleukin (IL)-4/IL-13 receptors, IL4Ra,IL-13Ra1 and IL-13Ra2, have been identified in rainbow trout (Oncorhynchus mykiss) and have complex patterns of expression and modulation. Immunogenetics 2011;63:235e53. [42] Hong S, Li R, Xu Q, Secombes CJ, Wang T. Two types of TNF-a exist in teleost fish: phylogeny, expression, and bioactivity analysis of type-II TNF-a3 in rainbow trout Oncorhynchus mykiss. J Immunol 2013;191:5959e72. [43] Hong S, Zou J, Crampe M, Peddie S, Scapigliati G, Bols N, et al. The production and bioactivity of rainbow trout (Oncorhynchus mykiss) recombinant IL-1 beta. Vet Immunol Immunopathol 2001;81:1e14. [44] Wang T, Husain M, Hong S, Holland JW. Differential expression, modulation and bioactivity of distinct fish IL-12 isoforms: implication towards the evolution of Th1-like immune responses. Eur J Immunol 2014;44:1541e51. [45] Kochetov AV, Ahmad S, Ivanisenko V, Volkova OA, Kolchanov NA, Sarai A. uORFs, reinitiation and alternative translation start sites in human mRNAs. FEBS Lett 2008;582:1293e7. €ldi J, Lee AP, Fan S, Philippe H, Maccallum I, et al. The African [46] Amemiya CT, Alfo coelacanth genome provides insights into tetrapod evolution. Nature 2013;496:311e6. [47] Limatola C, Di Bartolomeo S, Catalano M, Trettel F, Fucile S, Castellani L, et al. Cysteine residues are critical for chemokine receptor CXCR2 functional properties. Exp Cell Res 2005;307:65e75. [48] Hewit KD, Fraser A, Nibbs RJ, Graham GJ. The N-terminal region of the atypical chemokine receptor ACKR2 is a key determinant of ligand binding. J Biol Chem 2014;289:12330e42. [49] Blackburn PE, Simpson CV, Nibbs RJ, O'Hara M, Booth R, Poulos J, et al. Purification and biochemical characterization of the D6 chemokine receptor. Biochem J 2004;379:263e72. [50] Peatman E, Liu Z. Evolution of CC chemokines in teleost fish: a case study in gene duplication and implications for immune diversity. Immunogenetics 2007;59:613e23. [51] Laing KJ, Secombes CJ. Trout CC chemokines: comparison of their sequences and expression patterns. Mol Immunol 2004;41:793e808. [52] Sanchez E, Coll J, Tafalla C. Expression of inducible CC chemokines in rainbow trout (Oncorhynchus mykiss) in response to a viral haemorrhagic septicemia virus (VHSV) DNA vaccine and interleukin 8. Dev Comp Immunol 2007;31:916e26. [53] Flajnik MF, Kasahara M. Origin and evolution of the adaptive immune system: genetic events and selective pressures. Nat Rev Genet 2010;11:47e59. [54] Husain M, Bird S, van Zwieten R, Secombes CJ, Wang T. Cloning of the IL-1b3 gene and IL-1b4 pseudogene in salmonids uncovers a second type of IL-1b gene in teleost fish. Dev Comp Immunol 2012;38:431e46.
398
Z. Qi et al. / Fish & Shellfish Immunology 44 (2015) 389e398
[55] Wang T, Husain M. The expanding repertoire of the IL-12 cytokine family in teleost fish: identification of three paralogues each of the p35 and p40 genes in salmonids, and comparative analysis of their expression and modulation in Atlantic salmon Salmo salar. Dev Comp Immunol 2014;46:194e207. [56] Wang T, Bird S, Koussounadis A, Holland JW, Carrington A, Zou J, et al. Identification of a novel IL-1 cytokine family member in teleost fish. J Immunol 2009;183:962e74.
[57] Wang T, Holland JW, Carrington A, Zou J, Secombes CJ. Molecular and functional characterization of IL-15 in rainbow trout Oncorhynchus mykiss: a potent inducer of IFN-gamma expression in spleen leukocytes. J Immunol 2007;179:1475e88. [58] Zou J, Secombes CJ. Teleost fish interferons and their role in immunity. Dev Comp Immunol 2011;35:1376e87.