CD38− AML cells

G Model

ARTICLE IN PRESS

LR-5396; No. of Pages 9

Leukemia Research xxx (2015) xxx–xxx

Contents lists available at ScienceDirect

Leukemia Research journal homepage: www.elsevier.com/locate/leukres

STAT5A regulates DNMT3A in CD34+ /CD38− AML cells Asako Takeuchi, Chie Nishioka, Takayuki Ikezoe ∗ , Jing Yang, Akihito Yokoyama Department of Hematology and Respiratory Medicine, Kochi Medical School, Kochi University, Okoh-cho, Nankoku 783-8505, Kochi, Japan

a r t i c l e

i n f o

Article history: Received 30 June 2014 Received in revised form 17 April 2015 Accepted 13 May 2015 Available online xxx Keywords: AML DNMT3A STAT5A PTEN

a b s t r a c t Signal transducer and activator of transcription 5 (STAT5) is activated in CD34+ /CD38− acute myelogenous leukemia (AML) cells. Inhibition of STAT5 induced apoptosis and sensitized these cells to the growth inhibition mediated by conventional chemotherapeutic agents. The present study attempted to identify molecules that are regulated by STAT5 in CD34+ /CD38− AML cells by utilizing cDNA microarrays, comparing the gene expression profiles of control and STAT5A shRNA-transduced CD34+ /CD38− AML cells. Interestingly, DNA methyltransferase (DNMT) 3A was downregulated after depletion of STAT5A in CD34+ /CD38− AML cells. Reporter gene assays found that an increase in activity of DNMT3A occurred in response to activation of STAT5A in leukemia cells. On the other hand, dephosphorylation of STAT5A by AZ960 decreased this transcriptional activity. Further studies utilizing a chromatin immunoprecipitation assay identified a STAT5A-binding site on the promoter region of DNMT3A gene. Forced expression of STAT5A in leukemia cells caused hypermethylation on the promoter region of the tumor suppressor gene, PTEN, and downregulated its mRNA levels, as measured by methylation-specific and real-time polymerase chain reaction, respectively. Taken together, these data suggest that STAT5A positively regulates levels of DNMT3A, resulting in inactivation of tumor suppressor genes by epigenetic mechanisms in AML cells. © 2015 Elsevier Ltd. All rights reserved.

1. Introduction Acute myelogenous leukemia (AML) is initiated and maintained by a subset of self renewing leukemia stem cells (LSCs) [1]. Novel treatment strategies targeting LSCs are urgently needed to induce a cure in individuals with AML. LSCs are supposed to possess selfrenewal potency and are able to generate AML cells in severely immunocompromised mice [2,3]. Several studies indicate that CD34+ /CD38− AML cells fulfill the criteria for LSCs in vivo [2,3], although recent studies employing more severely immunocompromised mice found that in some cases, even CD34− or CD38+ AML cells can be used to reconstitute AML [4,5]. We recently measured the activity of the major prosurvival signal pathways in CD34+ /CD38− cells and their CD34+ /CD38+ counterparts isolated from patients with AML (n = 11) by fluorescenceactivated cell sorting (FACS). Interestingly, CD34+ /CD38− cells

Abbreviations: STAT5A, signal transducer and activator of transcription 5; AML, acute myelogenous leukemia; LSCs, leukemia stem cells; DNMT3A, DNA methyltransferase 3A; HSCs, hematopoietic stem cells. ∗ Corresponding author. Tel.: +81 88 880 2345; fax: +81 88 880 2348. E-mail addresses: [email protected] (A. Takeuchi), [email protected] (T. Ikezoe).

expressed a greater amount of signal transducer and activator of transcription 5 (STAT5) than their CD34+ /CD38+ counterparts in 10 of 11 cases [6]. STAT5 is involved in various aspects of hematopoiesis, cell proliferation, differentiation, and cell survival [7,8]. The human STATs consist of STAT5A and STAT5B which share a 96% sequence similarity [9]. Both STAT5A and STAT5B regulate proliferation and long term stem cell maintenance of CD34+ chronic myeloid leukemia (CML) cells [10]. However, the ratios of STAT5A to STAT5B increased in CML cells during the process of acquisition of tyrosine kinase inhibitor-resistance. Further studies found that STAT5A played a role in protection of CML cells from oxidative stress [10]. In addition, a persistent activation of STAT5A in human hematopoietic stem cells (HSCs) and progenitor cells results in their enhanced self-renewal and diverts differentiation to the erythroid lineage [7]. Deletion of STAT5 stimulates cell cycling in HSCs in association with downregulation of Tie and p53 [11], which play important roles in engraftment of these cells into the BM (bone marrow) niche via modulation of c-Mpl signaling [12,13]. Moreover, long-term repopulating activity was impaired when STAT5 was genetically depleted in both CD34+ AML and HSCs [14,15]. These observations suggest that STAT5, especially STAT5A is required for the maintenance, expansion, and engraftment of primitive hematopoietic stem/progenitor cells during normal and leukemic hematopoiesis.

http://dx.doi.org/10.1016/j.leukres.2015.05.006 0145-2126/© 2015 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model

ARTICLE IN PRESS

LR-5396; No. of Pages 9

A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

2

DNA methyltransferases (DNMTs), such as DNMT1, DNMT3A, and DNMT3B, are key epigenetic regulators involved in transcriptional repression [16–18]. DNMT3A and DNMT3B act as de novo methyltransferases, whereas DNMT1 acts to maintain methyltransferase activity [19]. Whole-genome sequencing studies have identified somatic mutation of DNMT3A in 22% of adult patients with AML [20]. Mutations of DNMT3A were associated with an increased risk of relapse and poor prognosis in patients with AML, although the enzymatic activity of mutant forms of DNMT3A remains unknown [21]. Recently, we found that long term exposure of leukemia cells to imatinib induced expression of DNMT3A and resulted in downregulation of phosphatase and tensin homolog deleted on chromosome ten (PTEN) in leukemia cells [22]. We have also identified hypermethylation on the promoter region of the PTEN gene in association with downregulation of this gene transcripts and activation of AKT signaling in imatinibresistant leukemia cells isolated from individuals with chronic eosinophilic leukemia, CML and Philadelphia-positive acute lymphoblastic leukemia (Ph+ ALL) [23]. These observations suggest that downregulation of PTEN contributed to acquisition of the drugresistant character of leukemia cells. This study aimed to identify novel function of STAT5 in CD34+ /CD38− AML cells by utilizing cDNA microarray, and investigate relationships between STAT5 and DNMTs in these cells.

2. Materials and methods 2.1. Sample collection and isolation of CD34+ /CD38− AML cells and their CD34+ /CD38+ counterparts Leukemia cells were freshly isolated from AML patients (n = 11) with World Health Organization (WHO) classification system subtype, AML without maturation (case # 1), AML with maturation (case # 2 and 8), minimally differentiated AML (case # 3), acute myelomonocytic leukemia (case # 4 and 11), therapy-related AML (case # 5), and AML with myelodysplasia related changes (case # 6, 7, 9 and 10) as shown in supplemental Table 1. We obtained informed consent from patients in accordance with the declaration of Helsinki. All protocols were approved by the Kochi University Institutional Review Board. CD34+ /CD38− AML cells and CD34+ /CD38+ counterparts were purified by magnetic cell sorting utilizing a CD34 MultiSort kit and a CD38 MicroBead kit (Miltenyi Biotec GmbH, Germany), as previously described [24].

2.2. Cells Chronic eosinophilic leukemia (CEL) EOL-1 cells were obtained from RIKEN BRC Cell Bank (Tsukuba, Japan). An imatinib-resistant CEL EOL-1R cell line was established by culturing cells with increasing concentrations of imatinib (from 1 to 100 nM) for 6 months as previously described [23]. The EOL-1R cells expressed CD34 on the cell surface [23]. A large number of EOL-1R cells were arrested in the G0/G1 phase of the cell cycle in association with aberrant expression of various cell cycle-related molecules, including p53 and p21waf1 , and were resistant to anticancer agent-mediated apoptosis [23]. The characteristics of the EOL-1R cells appeared to be similar to those of LSCs, which also exist in a dormant state as a result of upregulation of p53 and p21waf1 expression [23]. MOLM13, a cell line of AML M5a with FLT3/ITD, was kindly provided by Dr. Yoshinobu Matsuo (Fujisaki Cell Center, Okayama, Japan) [25]. 2.3. Microarray hybridization Approximately 250 ng of each of the cDNAs generated from RNA extracted from AML cells (n = 3, #1, #2 and #3) were used as template for Cy3 and Cy5 labeling, which was performed according to Miltenyi Biotec’s undisclosed protocol. The corresponding Cy3and Cy5-labeled cDNAs were combined and hybridized overnight (17 h, 65 ◦ C) to an Agilent Whole Human Genome Oligo Microarrays 8 × 60 K using Agilent’s recommended hybridization chamber and oven. In general, control samples were labeled with Cy3, and experimental samples were labeled with Cy5. Finally, the microarrays were washed once with the Agilent Gene Expression Wash Buffer 1 for 1 min at room temperature followed by a second wash with preheated Agilent Gene Expression Wash Buffer 2 (37 ◦ C) for 1 min. The last washing step was performed with acetonitrile. After vigorous washing, the hybridized microarrays were scanned using Agilent’s DNA microarray scanner (Agilent Technologies). The resulting images were analyzed using the Rosetta Resolver gene expression data analysis system (Rosetta Biosoftware). 2.4. Extraction of RNA Total RNA was extracted from tissues using the single-step Trizol RNA extraction kit (Invitrogen) according to the manufacturer’s instructions, concentrated by isopropanol precipitation, and column-purified using the QIAGEN RNeasy Mini Kit (Cat No. 74104). The RNA was quantified by a Nanodrop ND-1000 (Thermo

Table 1 Gene expression profiles in CD34+ /CD38− AML cells transduced by either control or STAT5A shRNA. No. 1

No. 2

No. 3

Sequence code

Primary sequence name

Accession no.

Fold change

Fold change

Fold change

A A A A A A A A A A A A A A A A A A

HDAC1 HDAC2 HDAC3 HDAC4 HDAC5 HDAC6 HDAC7 HDAC8 HDAC9 HDAC10 HDAC11 DNMT3L DNMT3B DNMT3A DNMT1 EZH2 EED SUZ12

NM NM NM NM NM NM NM NM NM NM NM NM NM NM NM NM NM NM

−1.01801 1.55867 2.14343 −1.07612 −4.33321 −1.24816 −1.37875 −1.53653 3.42791 −1.43123 3.3437 −5.98153 2.44873 −1.40368 2.8163 −2.42412 −1.35696 −1.64255

1.07245 −1.34216 −2.72017 −2.22889 −1.07965 1 1.60651 1 1 1.41578 −1.0825 1 −1.42753 −174.895 1 −1.67178 1.20238 1.0153

−9.35259 −3.32138 −7.21372 2.39346 −3.38208 −7.66047 −2.86073 −5.11241 −1.0126 1.14406 3.28595 −2.76755 −2.62881 −9.01401 −6.29344 −2.31003 1.00451 −6.67173

23 23 33 23 24 33 23 33 23 23 33 23 23 33 33 33 23 23

P114656 P122304 P3309929 P210048 P125283 P3320619 P2582 P3296789 P404162 P368740 P3417944 P17673 P28953 P3272330 P3329187 P3252196 P53217 P100883

004964 001527 003883 006037 001015053 006044 015401 001166422 014707 032019 001136041 013369 175850 175629 001130823 004456 152991 015355

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model LR-5396; No. of Pages 9

ARTICLE IN PRESS A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

Scientific). The quality of the RNA was evaluated using the Agilent 2100 Bioanalyzer expert software. RNA samples with a 2100 RNA integrity number (RIN) ≥ 6.0 was deemed of sufficient quality for gene expression profiling experiments. 2.5. Production of STAT5A short hairpin RNA lentiviral vectors and infection of cells An imatinib-resistant CEL EOL-1R cell line was established by culturing cells with increasing concentrations of imatinib (from 1 to 100 nM) for 6 months. The EOL-1R cells expressed CD34 on the cell surface [2,3]. The control and STAT5A lentiviral vectors, designed to co-express green fluorescence protein (GFP), were purchased from GeneCopoeia (Rockville, MD). Lentiviral short hairpin (sh) RNA particles were produced using the viral power packaging system (Invitrogen, CA, USA) and transduced into CD34+ /CD38− AML, EOL-1R and MOLM13 cells as previously described [26]. The control and STAT5A shRNA lentiviral vectors coexpressed GFP (green fluorescent protein). Quantification of GFP-positive cells using FACS (fluorescence-activated cell sorting) analysis indicated that the lentiviral transduction efficiency was nearly 70%. GFP-positive cells were sorted using JSAN (Bay Bioscience Co., Ltd., Kobe, Japan) [24]. 2.6. STAT5A lentiviral vectors STAT5A cDNA (NM 003152) was synthesized by TAKARA BIO Inc. (Shiga Japan). Gene products were cloned into the pLenti6.3/V5-TOPO vector (Invitrogen). Lentiviral particles were produced using the viral power packaging system (Invitrogen) and transduced into CD34+ /CD38− AML, EOL-1R and MOLM13 cells as previously described [24]. FACS analysis utilizing an anti-V5 antibody (Invitrogen, R960-25) indicated that the efficiency of transduction into CD34+ /CD38− AML cells was nearly 80% [24]. 2.7. RNA isolation and real-time reverse transcription-polymerase chain reaction (RT-PCR) RNA isolation and cDNA preparation were performed as described previously [23]. Real-time RT-PCR was carried out using Power SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK), as previously described [23]. 2.8. Western blot analysis Western blot analysis was performed as described previously using the following antibodies: anti-PTEN (#9559, Cell Signaling Technology, Beverly, MA), anti-STAT5 (sc-835, Santa Cruz Biotechnology), anti-p-STAT5, (#9351, Cell Signaling Technology, Beverly, MA), anti-STAT5b (ab178941, Abcam, Cambridge, UK) and anti-DNMT3A, (ab13888, Abcam, Cambridge, UK) [23]. Anti-p-STAT5 antibody detects expression of both p-STAT5A and p-STAT5B. 2.9. Reporter plasmid, transfection, and reporter gene assay The human DNMT3A promoter-luciferase construct (pDNMT3A (−709/+102)-Luc) was prepared as follows. Primers complementary to the published human DNMT3A promoter sequence (AB076659) containing NheI and XhoI restriction sites for the forward (GCGGCTAGCCCAACCCTGTAGCCAAACGG) and reverse (GCGCTCGAGGTATGGCCGGTGGGGTCG) primers, respectively, were synthesized. Human genomic DNA (636401, Clontech, Heidelberg, Germany) was mixed with the primers, and PCR was performed using PrimeSTAR® GXL DNA Polymerase (TAKARA BIO). The PCR product and pGL4.10 [Luc2] vector (E6651, Promega,

3

Madison, WI) were digested with NheI (1241A, TAKARA BIO) and XhoI (1094A, TAKARA BIO) restriction endonucleases. The PCR product was ligated into the pGL4.10 [Luc2] vector using T4 DNA ligase (2011A, TAKARA BIO). pDNMT3A (−2489/+102)-Luc vector was digested with NheI (1241A, TAKARA BIO) and EcoRI (1094A, TAKARA BIO) restriction endonucleases and ligated into the vector using DNA blunting kit (TAKARA BIO). The transfection and reporter gene assay was performed as described previously [27]. Briefly, EOL-1R cells were transfected with pDNMT3A (−709/+102)-Luc (4 ng) and pRL vector (0.5 ng) by electroporation (150 V). After 48 h, the luciferase activity of the cell lysate was measured using the Dual Luciferase assay system (Promega). The luciferase activity of the cell lysate was normalized to that of Renilla luciferase, which was used as a control.

2.10. Chromatin immunoprecipitation assay Cells (5 × 105 per ml) were collected and subjected to Enzymatic Chromatin IP kit (Cell Signaling Technology, Japan) according to the manufacturer’s protocol. Anti-STAT5A antibody (sc-835, Santa Cruz Biotechnology), anti-rabbit IgG, HRP linked antibody (#7074, Cell Signaling Technology, Beverly, MA) and anti-mouse IgG, HRP linked antibody (#707, Cell Signaling Technology, Beverly, MA) was used for immunoprecipitation. Immunoprecipitated DNA was recovered and used as a template for real-time PCR. The primers for DNMT3A were as follows: ChIP1 (−709/−509) forward, (CACTGTGATATAGCTGAAGTGCTG), reverse, (GTGGGGGCTGTTCTCCTT), ChIP2 (−509/−309) forward, (AGGAACCTAGAGCCCTGAGC), reverse, (CAGGCTCCAAAGCCTCTCT), ChIP3 (−309/−109) forward, (AGGTACGGGGAACTCACTCC), reverse (CTTCGCCCTGCAGTTCTC), and ChIP4 (−109/+102) forward (GTGCTGAGGCAGGCAGAG), reverse, (CAGAGCCCCTCGAGTCGT). Real-time PCR was carried out by using Power CYBR Green PCR Master Mix (Applied Biosystems), as previously described [23]. The amplified sequences were normalized to those from input (cross-linked DNA/protein complexes), which were not immunoprecipitated with anti-STAT5A antibodies, as previously described [23].

2.11. Transfections EOL-1R cells were transiently transfected with control, DNMT3A siRNA1 (300 nM), or DNMT3A siRNA2 (300 nM) by Amaxa electroporator Nucleofector II (Wako Pure Chemical Industries, Ltd., Osaka, Japan) using the Nucleofector Kit V (program U-001) as previously described [24].

2.12. Methylation analysis by methylation-specific PCR DNA (1 ␮g) isolated from EOL-1R cells was used for bisulfite treatment done by the EZ DNA Methylation kit (Zymo Reserch, Orange, CA, USA) according to the supplier’s protocol. The primer sets used to amplify the promoter region of the PTEN gene were described elsewhere [23]. Amplification was carried out in a Mycycler thermal cycler (Bio-Rad, Tokyo, Japan) at 94 ◦ C for 1 min, cycled at 98 ◦ C for 10 s, 59 ◦ C for 15 s and 68 ◦ C for 30 s (30 cycles).

2.13. Statistical analysis When comparing two groups, the Wilcoxon pairs test was used. All statistical analyses were carried out using PRISM statistical analysis software (GraphPad Software, Inc, San Diego, CA) and the results were considered to be significant when the P-value was <0.05, and highly significant when the P-value was <0.01.

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model LR-5396; No. of Pages 9

ARTICLE IN PRESS A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

4

3. Results 3.1. Gene expression profiles in CD34+ /CD38− AML cells following shRNA-mediated downregulation of STAT5A gene To explore the function of STAT5A in CD34+ /CD38− AML cells, the gene expression profiles in CD34+ /CD38− AML cells isolated from patients (n = 3, cases #1, 2, and 3) following shRNAmediated downregulation of STAT5A were compared to those in CD34+ /CD38− AML cells transduced with control shRNA by microarray analysis. Differences greater than 3-fold or less than 3-fold in more than two AML cases were considered to be significant. Four hundred and eighty-eight genes were differentially expressed between STAT5A-depleted CD34+ /CD38− AML cells and CD34+ /CD38− AML cells transduced with control shRNA in at least two AML samples. Notably, levels of a series of epigenetic regulator genes, including DNMT3A, were downregulated in STAT5A-depleted CD34+ /CD38− AML cells (Table 1). 3.2. Downregulation of STAT5A decreased levels of DNMT3A To confirm the result of the gene expression profile experiments, we performed real-time RT-PCR, which showed that the levels of DNMT3A decreased to 0.7-fold (P < 0.01) in CD34+ /CD38− AML cells following shRNA-mediated downregulation of STAT5A expression (n = 5, cases # 1, 2, 3, 9 and 10, Fig. 1A). We next examined whether forced expression of STAT5A would increase levels of DNMT3A in CD34+ /CD38− AML cells. Transduction of STAT5A expressing vector into CD34+ /CD38− AML cells tended to increase the DNMT3A levels (n = 5, cases # 1, 2, 3, 9 and 11; P = 0.3, Fig. 1B). These observations were also noted in two different human leukemic cell lines; downregulation of STAT5A in EOL-1R and MOLM13 cells by shRNA decreased levels of DNMT3A to 0.2-fold and 0.4-fold (P < 0.05, P < 0.01), respectively, compared to these cells transfected with control shRNA (Fig. 1C). Forced expression of STAT5A in EOL-1R and MOLM13 cells increased levels of DNMT3A by 2.8-fold (P = 0.1) and 1.8-fold (P = 0.08), respectively, as compared with these cells transfected with empty vector (Fig. 1D). Western blotting using anti-STAT5 and anti-DNMT3A showed that downregulation of STAT5 and decreased levels of DNMT3A expressions by STAT5A shRNA in EOL-1R and MOLM13 cells. Western blot analysis using anti-STAT5B antibody found that downregulation of STAT5A by shRNA in EOL-1R and MOLM13 cells did not modulate levels of STAT5B. Forced expression of STAT5A in EOL-1R and MOLM13 cells increased levels of DNMT3A expressions (Fig. 1E). Further experiments found that the levels of DNMT3A in CD34+ /CD38− AML cells with an abundant amount of p-STAT5 [6] isolated from patients (n = 8) were 2.8fold greater than those in their CD34+ /CD38+ counterparts (P = 0.1) (Supplemental Fig. 1). Collectively, these results suggested the possibility that STAT5A may regulate levels of DNMT3A in leukemia cells. 3.3. STAT5A increased transcriptional activation of DNMT3A We next explored whether STAT5A regulated the transcriptional activation of DNMT3A in CD34+ /CD38− AML cells using a reporter gene assay. Downregulation of STAT5A in EOL-1R cells by shRNA potently decreased DNMT3A transcriptional activity (P < 0.01, Fig. 2A). Downregulation of STAT5A by shRNA also decreased DNMT3A transcriptional activity in MOLM13 cells (P < 0.05, Fig. 2A). We further transfected pGL4.10 [Luc2] empty vector in STAT5A shRNA transduced cells. As a result, the luciferase activity did not change (data not shown). We utilized interleukin-10 (IL-10) to increase the level of p-STAT5 in EOL-1R and MOLM13 cells. As we expected, exposure of leukemia cells to IL-10 increased the levels

of p-STAT5 without an increase in the levels of the total amount of these proteins. On the other hand, AZ960, an inhibitor of JAK2, decreased levels of p-STAT5 in EOL-1R and MOLM13 cells (Supplemental Fig. 2). Levels of DNMT3A mRNAs were also increased by IL-10 to 3.6-fold in EOL-1R cells, which were significantly hampered when cells were exposed to IL-10 together with AZ960 (Fig. 2B). Reporter gene assay showed that activation of STAT5 by IL-10 increased DNMT3A transcriptional activity by 2.0-fold in EOL-1R and 1.7-fold in MOLM13 cells. On the other hand, inactivation of STAT5 by AZ960 decreased this transcriptional activity to 0.4-fold in EOL-1R cells and 0.6-fold in MOLM13 cells. In addition, AZ960 blunted the ability of IL-10 to stimulate transcriptional activity of DNMT3A in EOL-1R and MOLM13 cells (P < 0.01, Fig. 2C). 3.4. STAT5A bound to a promoter region of DNMT3A gene To confirm whether STAT5A bound to a promoter region of the DNMT3A gene, EOL-1R cells were transfected with either STAT5A or empty vector. After 72 h, cells were harvested and subjected to chromatin immunoprecipitation assay. We divided the DNMT3A promoter region −709/+102 in four parts; −709/−509 (ChIP1), −509/−309 (ChIP2), −309/−109 (ChIP3) and −109/+102 (ChIP4) (Fig. 3A). As a result, STAT5A enrichment was increased by 2.6fold in ChIP2 (P = 0.01) in leukemia cells when compared with that in EOL-1R cells transfected with empty vector (Fig. 3B). On the other hand, transfection of STAT5A shRNA into EOL-1R cells significantly decreased the amounts of STAT5A bound to ChIP2 region of DNMT3A promoter (P < 0.01; Fig. 3C). Control experiments with IgG did not identify STAT5A enrichment in EOL-1R cells (data not shown). These results indicated that STAT5A probably binds to the promoter region of the DNMT3A gene and stimulated the transcriptional activity of this gene. 3.5. The effect of STAT5A on DNA hypermethylation We previously showed that DNMT3A formed a complex with polycomb group protein enhancer of zeste homolog 2 (EZH2), which facilitated their binding to the PTEN promoter and induced DNA hypermethylation of this region [22]. We therefore hypothesized that STAT5A could affect epigenetic modification, such as DNA hypermethylation, via activation of DNMT3A. To investigate this hypothesis, we examined the methylation status on the promoter regions of the PTEN gene in leukemia cells using methylation-specific PCR. As shown in Fig. 4A, unmethylated PCR products became detectable after transfection of the shRNA targeting STAT5A in EOL-1R cells. In contrast, methylated PCR products became strongly detectable after transfection of STAT5Aexpressing vector in EOL-1R cells. Western blotting showed that downregulation of STAT5A by shRNA decreased levels of DNMT3A by 0.5-fold in EOL-1R cells, following shRNA-mediated downregulation of STAT5A in parallel with upregulation of PTEN (Fig. 4B). On the other hand, forced expression of STAT5A by transfection of STAT5A-expressing vector increased levels of DNMT3A by 2.4-fold and decreased levels of PTEN by 0.4-fold in these cells (Fig. 4B). These findings indicate the possibility that overexpression of STAT5A might downregulate PTEN via upregulation of DNMT3A. To testify this hypothesis, we compared the methylation status on the promoter regions of the PTEN gene in leukemia cells after depletion of DNMT3A by siRNAs. Transfection of DNMT3A siRNA 1 and 2 decreased DNMT3A expressions to 0.61 and 0.73-fold, respectively, compared to the control siRNA transfected cells (figure not shown). As expected, the amounts of unmethylated PCR products increased and those of methylated PCR products decreased in the promoter region of the PTEN gene in DNMT3A depleted cells (Fig. 4C).

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model LR-5396; No. of Pages 9

ARTICLE IN PRESS A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

5

Fig. 1. Effect of signal transducer and activator of transcription 5 (STAT5) on levels of DNA methyltransferase (DNMT) 3A in CD34+ /CD38− AML cells. Real time RT-PCR. (A) CD34+ /CD38− AML cells (n = 5, cases # 1, 2, 3, 9 and 10) transduced with either control or STAT5A sh (short hairpin) RNA lentiviral particles were collected, and mRNAs were extracted. (B) CD34+ /CD38− AML cells (n = 5, cases # 1, 2, 3, 9 and 11) transduced with either empty or STAT5A vectors were collected, and mRNAs were extracted. cDNAs were synthesized and subjected to real-time RT-PCR to determine the DNMT3A level. Each dot represents the level of DNMT3A for an individual experiment, and the mean is indicated by the line. * P < 0.05; ** P < 0.01. Effect of STAT5A on levels of DNMT3A in leukemia cells. Real time RT-PCR. (C) EOL-1R and MOLM13 cells were transfected with either control shRNA or STAT5A shRNA. After 72 h, GFP-positive cells were collected, and mRNAs were extracted. (D) EOL-1R and MOLM13 cells were transfected with either empty or STAT5A vectors were collected, and mRNAs were extracted. cDNAs were synthesized and subjected to real-time RT-PCR to determine the DNMT3A level. Results represent the mean ± SD of duplicate cultures. Experiments were repeated 3 times. * P < 0.05; ** P < 0.01. Western blot analysis. (E) EOL-1R and MOLM13 cells were transfected with either control shRNA or STAT5 shRNA. After 72 h, GFP-positive cells were harvested, these proteins were extracted, and subjected to western blot analysis to monitor the levels of STAT5 STAT5b and DNMT3A. Each lane was loaded with 30 ␮g of whole protein lysate. The experiments were performed three times independently and identical results were obtained.

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model LR-5396; No. of Pages 9 6

ARTICLE IN PRESS A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

Fig. 2. Effect of STAT5 to DNA methyltransferase (DNMT) 3A transcriptional activity in EOL-1R cells. DNMT3A luciferase reporter gene assay. (A) EOL-1R cells were transfected with either control shRNA or STAT5A shRNA. After 72 h, GFP-positive cells were collected, and then transfected with pDNMT3A (−709/+102)-Luc (4 ng) and Renilla luciferase reporter (pRL) vector. pRL vector was co-transfected for normalization. After 48 h, cells were harvested, and subjected to the reporter gene assay. Experiments were repeated 3 times. ** P < 0.01. Measurement of DNMT3A mRNA. (B) EOL-1R cells were exposed to either IL-10 (50 ng/ml) and/or AZ960 (1 ␮M) for 24 h, harvested, and mRNAs were extracted. cDNAs were synthesized and subjected to real-time RT-PCR to determine the DNMT3A level. Results represent the mean ± SD of duplicate cultures. Experiments were repeated 3 times. ** P < 0.01. DNMT3A luciferase reporter assay. (C) The construct (pDNMT3A (−709/+102)-Luc) contained the DNMT3A gene promoter site cloned into pGL4.10 [Luc2] vector. EOL-1R cells were transfected with pDNMT3A (−709/+102)-Luc (4 ng) and Renilla luciferase reporter (pRL) vector. pRL vector was co-transfected for normalization. After 48 h, cells were exposed to either IL-10 (50 ng/ml) and/or AZ960 (1 ␮M) for 24 h, harvested, and subjected to the reporter gene assay. Experiments were repeated 3 times. * P < 0.05; ** P < 0.01.

Moreover, real-time RT-PCR analysis revealed that the levels of PTEN increased by 1.8-fold in CD34+ /CD38− AML cells (P < 0.01) following shRNA-mediated downregulation of STAT5A (n = 5, cases # 1, 2, 3, 9 and 11) (Fig. 4D). In contrast, transduction of STAT5A expressing vector into CD34+ /CD38− AML cells resulted in a decrease in the levels of PTEN by 0.5-fold (P < 0.01; Fig. 4E).

Likewise, downregulation of STAT5A in EOL-1R and MOLM13 cells by shRNA increased levels of PTEN by 2.1-fold and 7.8-fold (P < 0.05 and P = 0.1), respectively, when compared with these cells transfected with control shRNA (Fig. 4F). On the other hand, forced expression of STAT5A in EOL-1R and MOLM13 cells decreased levels of PTEN by 0.4-fold and 0.6-fold (P < 0.05 and P < 0.05), respectively,

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model LR-5396; No. of Pages 9

ARTICLE IN PRESS A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

7

Fig. 3. Chromatin immunoprecipitation (ChIP) assay. (A) Schematic overview of DNMT3A promoter region. (B) EOL-1 cells were transfected with either control or signal transducer and activator of transcription 5A (STAT5A) vector. After 72 h, cells were harvested and subjected to chromatin immunoprecipitation followed by real-time PCR. The amplified sequences of the DNA methyltransferase (DNMT) 3A gene promoter were normalized to those of the input (the cross-linked DNA/protein complexes, which were not immunoprecipitated with anti-STAT5A antibody) Experiments were repeated 3 times. (C) EOL-1 cells were transfected with either control or STAT5A shRNA. After 72 h, cells were harvested and subjected to chromatin immunoprecipitation followed by real-time PCR. The amplified sequences of the DNA methyltransferase (DNMT) 3A gene promoter were normalized to those of the input (the cross-linked DNA/protein complexes, which were not immunoprecipitated with anti-STAT5A antibody). Experiments were repeated 3 times. * P < 0.05; ** P < 0.01.

when compared with these cells transfected with empty vector (Fig. 4G). These results suggested that STAT5A regulated expression of PTEN via methyltransferase activity in leukemia cells.

4. Discussion This is the first study to demonstrate that STAT5A directly bound on the promoter region of DNMT3A and increased its transcriptional activity. The GAS motif in −498 to −490 of DNMT3A promoter region (ChIP 2) is a candidate site for STAT5A binding (Fig. 3). Recent studies also showed that STAT5 acted as an epigenetic regulator; the activated STAT5 bound to the immunoglobulin ␬-chain gene, which recruited methyltransferase EZH2, leading to trimethylation of histone H3 at Lys27 during B lymphopoiesis [28]. It is reported that conditional deletion of STAT5 stimulates cell cycling in HSCs and gradually reduced survival and depleted the long-term HSC pool in mice [11]. In addition, downregulation of STAT5A by shRNA inhibited the colony forming ability in EOL-1R cells (Supplemental Fig. 3). The activated DNMT3A could cause epigenetic modification at specific loci, which plays a role in maintenance of the self-renewal capability of LSCs. In fact, we found that forced expression of STAT5A resulted in an increase in levels of DNMT3A and a decrease in expression of the tumor suppressor PTEN gene in leukemia cells (Fig. 4B). Transient silencing of PTEN in CD34+ HSCs increased engraftment of these cells in immunodeficient mice [29]. Inactivation of PTEN in murine hematopoietic cells using a flox-Cre system quickly produced myeloproliferative disease that progressed rapidly to AML [30]. These observations clearly highlight the important roles of PTEN in leukemogenesis as well as in the maintenance of stem cell activity.

We previously showed that downregulation of PTEN increased levels of p-STAT5 in leukemia cells, suggesting that PTEN negatively regulated STAT5 signaling [23]. STAT5/DNMT3-mediated silencing of PTEN could further activate STAT5 in leukemia cells. Furthermore, the forced expression of PTEN restored the sensitivity of EOL-1R cells to imatinib in association with the downregulation of Bcl-2 [23]. The loss of PTEN could play a crucial role in the acquisition of drug resistance in EOL-1R cells. Other investigators showed that DNMT3A plays important roles in HSC differentiation; for example, DNMT3a-deleted HSCs dramatically expanded the stem cell compartment without a parallel increase in differentiated lineages in the second transplants. Gene expression analysis showed that DNMT3a loss causes reduced expression of differentiation-related genes. The roles of DNMT3a in normal HSCs could be distinct from those in LSCs. Inhibition of JAK2 by AZ960 resulted in a decrease in levels of p-STAT5 and inactivated transcriptional activity of DNMT3A in EOL-1R and MOLM13 cells (Fig. 2). We previously showed that inhibition of JAK2/STAT5 by AZ960 stimulated cell cycling of dormant CD34+ /CD38− AML cells and inhibited their colony formation [24]. Inhibition of JAK2/STAT5 causes downregulation of DNMT3A, which could restore the expression of various genes involved in cell cycle regulation and cell proliferation. Taken together, these data suggest that STAT5A positively regulated expression of DNMT3A, leading to DNA methylation of the tumor suppression gene, PTEN. Restoration of expression of tumor suppressor genes by inhibition of STAT5/DNMT3 could sensitize drug-resistant CD34+ /CD38− AML cells to anti-leukemic agents. The STAT5/DNMT3A axis may be a promising therapeutic target to eradicate AML cells.

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model LR-5396; No. of Pages 9 8

ARTICLE IN PRESS A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

Fig. 4. Methylation-specific PCR. (A) EOL-1R and MOLM13 cells were transfected with either control or signal transducer and activator of transcription 5A (STAT5A) shRNA for 72 h. EOL-1R and MOLM13 cells were transfected with either empty or STAT5A vector for 72 h. DNA was extracted from these cells. DNA with methylated CpG was processed using the EZ DNA Methylation Kit. The recovered DNA was amplified by PCR on methylation of the phosphatase and tensin homolog deleted on chromosome ten (PTEN). Experiments were repeated 3 times. Western blot analysis. (B) EOL-1R and MOLM13 cells were transfected with either control or STAT5A shRNA for 72 h (left panel). EOL-1R and MOLM13 cells were transfected with either empty or STAT5A vector for 72 h (right panel). EOL-1R and MOLM13 cells were harvested and subjected to western blot analysis to monitor the levels of the indicated proteins. Each lane was loaded with 30 ␮g of whole protein lysate. Experiments were repeated 3 times. Methylation-specific PCR. (C) EOL-1R cells were transfected either scrambled control or DNA methyltransferase 3A (DNMT3A) siRNA (small interfering RNA) for 24 h. DNA was extracted from these cells. DNA with methylated CpG was processed using the EZ DNA Methylation Kit. The recovered DNA was amplified by PCR on methylation of the phosphatase and tensin homolog deleted on chromosome ten (PTEN). Experiments were repeated 3 times. Real time RT-PCR. (D) CD34+ /CD38− AML cells (n = 5, cases # 1, 2, 3, 9 and 10) transduced with either control or STAT5A shRNA lentiviral particles were collected, and mRNAs were extracted. (E) CD34+ /CD38− AML cells (n = 5, cases # 1, 2, 3, 9 and 11) transduced with either empty or STAT5A vectors were collected, and mRNAs were extracted. cDNAs were synthesized and subjected to real-time RT-PCR to determine the DNMT3A level. Each dot represents the level of DNMT3A for an individual experiment, and the mean is indicated by the line. * P < 0.05. Effect of STAT5A on levels of PTEN in leukemia cells. Real time RT-PCR. (F) EOL-1R and MOLM13 cells were transfected with control shRNA or STAT5A shRNA. After 72 h, cells were collected, and mRNAs were extracted. Experiments were repeated 3 times. (G) EOL-1R and MOLM13 cells were transfected with either empty or STAT5A vectors were collected, and mRNAs were extracted. cDNAs were synthesized and subjected to real-time RT-PCR to determine the DNMT3A level. Results represent the mean ± SD of duplicate cultures. Experiments were repeated 3 times. * P < 0.05.

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006

G Model LR-5396; No. of Pages 9

ARTICLE IN PRESS A. Takeuchi et al. / Leukemia Research xxx (2015) xxx–xxx

Acknowledgements This work was supported in part by the Kochi University President’s Discretionary Grant (to T.I.) and Takeda Science Foundation (to C.N). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.leukres.2015. 05.006 References [1] Bonnet D, Dick JE. Human acute myeloid leukemia is organized as a hierarchy that originates from a primitive hematopoietic cell. Nat Med 1997;3:730–7. [2] Clarke MF, Dick JE, Dirks PB, Eaves CJ, Jamieson CH, Jones DL, et al. Cancer stem cells-perspectives on current status and future directions: AACR Workshop on cancer stem cells. Cancer Res 2006;66:9339–44. [3] Ishikawa F, Yoshida S, Saito Y, Hijikata A, Kitamura H, Tanaka S, et al. Chemotherapy-resistant human AML stem cells home to and engraft within the bone-marrow endosteal region. Nat Biotechnol 2007;25:1315–21. [4] Taussing DC, Miraki-Moud F, Anjos-Afonso F, Pearce DJ, Allen K, Ridler C, et al. Anti-CD38 antibody-mediated clearance of human repopulating cell masks the heterogeneity of leukemia-initiating cell. Blood 2008;112:568–75. [5] Sarry JE, Murphy K, Perry R, Sanchez PV, Secreto A, Keefer C, et al. Human acute myelogenous leukemia stem cells are rare and heterogeneous when assay in NOD/SCID/IL2R␥c-deficient mice. J Clin Invest 2011;121: 384–95. [6] Ikezoe T, Yang J, Nishioka C, Kojima S, Takeuchi A, Koeffler HP, et al. Inhibition of signal transducer and activator of transcription 5 by the inhibitor of janus kinases stimulates dormant human leukemia CD34+ /CD38− cells and sensitizes them to antileukemia agents. Int J Cancer 2011;128:2317–25. [7] Schuringa JJ, Chung KY, Morrone G, Moor MA. Constitutive activation of STAT5A promotes human hematopoietic stem cell self-renewal and erythroid differentiation. J Exp Med 2004;200:623–35. [8] Schuringa JJ, Wu K, Morrone G, Moor MA. Enforced activation of STAT5A facilitates the generation of embryonic stem-derived hematopoietic stem cells that contribute to hematopoiesis in vivo. Stem Cells 2004;22:1191–204. [9] Grimley PM, Dong F, Rui H. Stat5a and Stat5b: fraternal twins of signal transduction and transcriptional activation. Cytokine Growth Factor Rev 1999;10:131–57. [10] Casetti L, Martin-Lannerée S, Naijar I, Plo I, Augé S, Roy L, et al. Differential contributions of STAT5A and STAT5B to stress protection and tyrosine kinase inhibitor resistance of chronic myeloid leukemia stem/progenitor cells. Cancer Res 2013;73:2052–8. [11] Wang Z, Li G, Tse W, Bunting KD. Conditional deletion of STAT5A in adult mouse hematopoietic stem cells causes loss of quiescence and permits efficient nonablative stem cell replacement. Blood 2009;113:4856–65. [12] Yoshihara H, Arai F, Hosokawa K, Hagiwara T, Takubo K, Nakamura Y, et al. Trombopoietin/MPL signaling regulates hematopoietic stem cells. Cell Stem Cell 2007;1:685–97.

9

[13] Qian H, Buza-Vidas N, Hyland CD, Jensen CT, Antonchuk J, Mansson R, et al. Critical role of thrombopoietin in maintaining adult quiescent hematopoietic stem cells. Cell Stem Cell 2007;1:671–84. [14] Schepers H, van Gosliga D, Wierenga AT, Eggen BJ, Schuringa JJ, Vellenga E. STAT5A is required for long-term maintenance of normal and leukemic human stem/progenitor cells. Blood 2007;110:2880–8. [15] Moore MA, Dorn DC, Schuringa JJ, Chung KY, Morrone G. Constitutive activation of Flt3 and STAT5A enhances self-renewal and alters differentiation of hematopoietic stem cells. Exp Hematol 2007;35:105–16. [16] Bachman KE, Park BH, Rhee I, Rajagopalan H, Herman JG, Baylin SB, et al. Histone modifications and silencing prior to DNA methylation of a tumor suppressor gene. Cancer Cell 2003;3:89–95. [17] Fuks F, Burgers WA, Brehm A, Hughes-Davies L, Kouzarides T. DNA methyltransferase Dnmt1 associates with histone deacetylase activity. Nat Genet 2000;24:88–91. [18] Fuks F, Burgers WA, Godin N, Kasai M, Kouzarides T. Dnmt3a binds deacetylases and is recruited by a sequence-specific repressor to silence transcription. EMBO J 2001;20:2536–44. [19] Chen T, Ueda Y, Dodge JE, Wang Z, Li E. Establishment and maintenance of genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b. Mol Cell Biol 2003;23:5594–605. [20] Ley TJ, Ding L, Walter MJ, McLellan MD, Lamprecht T, Larson DE, et al. DNMT3A mutations in acute myeloid leukemia. N Engl J Med 2010;363:2424–33. [21] Thol F, Damm F, Lüdeking A, Winschel C, Wangner K, Morgan M, et al. Incidence and prognostic influence of DNMT3A mutations in acute myeloid leukemia. J Clin Oncol 2011;29:2889–96. [22] Nishioka C, Ikezoe T, Yang J, Udaka K, Yokoyama A. Imatinib causes epigenetic alterations of PTEN gene via upregulation of DNA methyltransferases and polycomb group proteins. Blood Cancer J 2011;1:e48. [23] Nishioka C, Ikezoe T, Yang J, Yokoyama A. Long-term exposure of leukemia cells to multi-targeted tyrosine kinase inhibitor induces activations of AKT, ERK and STAT5 signaling via epigenetic silencing of the PTEN gene. Leukemia 2010;24:1631–40. [24] Nishioka C, Ikezoe T, Furihata M, Yang J, Serada S, Naka T, et al. CD34+ /CD38− acute myelogenous leukemia cells aberrantly express CD82 which regulates adhesion and survival of leukemia stem cells. Int J Cancer 2013;132:2006–19. [25] Matsuo Y, MacLeod RA, Uphoff CC, Drexler HG, Nishizaki C, Katayama Y, et al. Two acute monocytic leukemia (AML-5a) cell lines (MOLM-13 and MOLM-14) with interclonal phenotypic heterogeneity showing MLL-AF9 fusion resulting from an occult chromosome insertion, ins(11;9)(q23;p22p23). Leukemia 1997;11:1469–77. [26] Nishioka C, Ikezoe T, Yang J, Nobumoto A, Kataoka S, Tsuda M, et al. CD82 regulates STAT5/IL-10 and supports survival of acute myelogenous leukemia cells. Int J Cancer 2014;134:55–64. [27] Nishioka C, Ikezoe T, Yang J, Koeffler HP, Taguchi H. Fuludarabine induces apoptosis of human T-cell leukemia virus type 1-induced T cells via inhibition of the nuclear factor-kappaB signal pathway. Leukemia 2007;21:1044–9. [28] Mandal M, Powers SE, Maienschaein-Cline M, Bartom ET, Hamel KM, Kee BL, et al. Epigenetic repression of the lgk locus by STAT5-mediated recruitment of the histone methyltransferase Ezh2. Nat Immunol 2011;12:1212–20. [29] Kim I, Kim YJ, Métais JY, Dunbar CE, Larochelle A. Transient silencing of PTEN in human CD34(+) cells enhanced their proliferative potential and ability to engraft immunodeficient mice. Exp Hematol 2012;40:84–91. [30] Yilmaz OH, Valdez R, Theisen BK, Guo W, Ferguson DO, Wu H, et al. Pten dependence distinguishes haematopoietic stem cells from leukaemia-initiating cells. Nature 2006;441:475–82.

Please cite this article in press as: Takeuchi A, et al. STAT5A regulates DNMT3A in CD34+ /CD38− AML cells. Leuk Res (2015), http://dx.doi.org/10.1016/j.leukres.2015.05.006