- Email: [email protected]
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
Original Paper Pancreatology 2009;9:173–181 DOI: 10.1159/000178889
Received: December 17, 2007 Accepted after revision: July 1, 2008 Published online: December 13, 2008
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis Marianges Zadrozny Gouvêa da Costa Dulce Reis Guarita Suzane Kioko Ono-Nita Jerônimo de Alencar Nogueira Marcelo Eidi Nita Denise Cerqueira Paranaguá-Vezozzo Marcelo Tavares de Souza Eliane Pereira do Carmo Ana Cristina de Sá Teixeira Flair José Carrilho Department of Gastroenterology, University of São Paulo, School of Medicine, São Paulo, Brazil
Key Words Pancreatitis/genetics ⴢ Cystic fibrosis transmembrane conductance regulator ⴢ Polymorphisms ⴢ Alcoholism
Abstract Introduction: Pancreas susceptibility to alcohol is variable and only 5–10% of chronic alcohol abusers develop chronic pancreatitis; the role of genetic factors in this process is unknown. The CFTR gene encodes a protein that acts on epithelial cells and plays a key role in normal exocrine pancreatic function. Methods: This study investigated the frequency of polymorphisms in intron 8 of the CFTR gene in patients with alcoholic chronic pancreatitis. Three groups of patients were studied: group A – 68 adult alcoholics with a diagnosis of chronic pancreatitis; group B – 68 adult alcoholics without pancreatic disease or liver cirrhosis and group C – 104 healthy nonalcoholic adults. Results: T5/T7 genotype was more frequent in group A (11.8%) than in group B (2.9%) (p = 0.0481), and there was no statistical difference when groups A and C (5.8%) were compared (p = 0.1317). The haplotype combination (TG)10-T7/(TG)11-T7 was more frequent in groups B (23.5%) and C (20.2%) than in group A (7.3%) (p = 0.0080 and 0.0162). Conclusion: There are differences when these three groups are compared and individuals with T5/T7 genotype might have a greater risk of developing chronic pancreatitis when they become chronic alcoholics. Copyright © 2008 S. Karger AG, Basel and IAP
© 2008 S. Karger AG, Basel and IAP 1424–3903/09/0092–0173$26.00/0 Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com
Accessible online at: www.karger.com/pan
Introduction
Alcohol abuse affects 10–12% of the world’s population and 11.2% of those living in the 107 largest cities in Brazil [1], and the association between alcohol abuse and chronic pancreatitis is well established [2]. In the West, alcohol is the cause of 70–90% of calcifying chronic pancreatitis [3], and in our country the high prevalence of alcohol abuse is responsible for 93.4% of the cases [4]. However, pancreas susceptibility to alcohol is variable and only 5–10% of chronic alcoholics develop chronic pancreatitis. The role of genetic factors in this process is mostly unknown [2]. The investigation of genetic determinants for diseases with multiple causes is difficult since they result from the interaction of environmental factors with multiple genes [5]. Studies have been carried out to investigate the genetic predisposition to alcoholic chronic pancreatitis; however, the results are conflicting and there are no definitive conclusions available [6–17]. Recent investigations have identified mutations in the cationic trypsinogen gene (PRSS1), the pancreatic secretory trypsin inhibitor/ serine protease inhibitor, Kazal type 1 gene (SPINK1) and the cystic fibrosis transmenbrane conductance regulator gene (CFTR) in patients with chronic pancreatits. The discovery of PRSS1 mutations in hereditary pancreatitis by Whitcomb et al. [18] in 1996 led to a better Marianges Z.G. da Costa University of São Paulo, School of Medicine Eneas Carvalho de Aguiar 255, room 9159 São Paulo 05403000 (Brazil) Tel. +55 113 069 7830, Fax +55 113 069 8237, E-Mail [email protected]
Table 1. Frequency of the 5T variant in intron 8 of the CFTR gene in different populations of patients with alcoholic chronic pancreatitis
References
Country
Race
n
T5 allele
Sharer et al. [6], 1998 Haber et al. [7], 1999 Monaghan et al. [8], 2000
England Australia USA
71 50 46
4.2% 1.9% 7.6%
Kimura et al. [9], 2000 Malats et al. [10], 2001 Gaia et al. [11], 2003 Bernardino et al. [12], 2003
Japan Spain Italy Brazil
31 70 21 64
4.8%* 4.3% 0.0% 6.3%
Pezzilli et al. [13], 2003 Perri et al. [14], 2003 Casals et al. [15], 2004 Fujiki et al. [16], 2004 Nakamura et al. [17], 2005
Italy Italy Spain Japan Japan
White White White (24%) Black (74%) Hispanic (2%) Asian White White White (77.5%) Mixed races (18.5%) Asian (4%) White White White Asian Asian
34 45 37 51 44
7.4% 2.2% 4.1% 2.0%
(TG)12 allele
35%* 60.7%
* Statistically significant (p < 0.05).
understanding of the pathophysiology of the disease. R122H is the most common mutation observed [19]. Several different mutations, such as N29I and A16V were subsequently found in a large number of investigated families [20]. However, the researches have not found any mutations of the PRSS1 gene in patients with alcoholic pancreatitis [8, 14]. In Brazil, the E79K change in exon 3 was detected in 1 patient with alcohol-related chronic pancreatitis but with no difference when compared to control subjects [12]. In 2000, Witt et al. [21] demonstrated the association between mutation N34S of the SPINK1 gene and chronic idiopathic pancreatitis, confirmed by several other groups [20]. SPINK1 is a potent inhibitor of trypsin activity in the pancreas [20], and some authors have described a correlation with alcoholic chronic pancreatitis, as well [22, 23], but the results diverged [24–26]. Since it was discovered in 1989, over 1,000 mutations of the CFTR gene have been reported [27]. The most common mutation is F508del, responsible for 70% of the cases of cystic fibrosis, an autosomal recessive syndrome characterized by frequent respiratory infections and pancreatic insufficiency [28].
174
Pancreatology 2009;9:173–181
The CFTR gene encodes a regulatory protein which works as an anion channel in epithelial cells and plays a key role in the regulation of alkalinization and dilution of the pancreatic juice [27]. This gene was considered a possible contributor to the development of alcoholic chronic pancreatitis based on the identification of patients with atypical or monosymptomatic cystic fibrosis, manifested, for instance by isolated pancreatic disease [29]. In the presence of some mutations, heterozygous patients with a partial decrease in protein activity might develop isolated pancreatic disease when subjected to an environmental risk factor [30]. In these cases, alcohol might act as a trigger. High frequencies (23.5% [13] and 40.5% [15]) of mutations in the CFTR gene were described in patients with alcoholic pancreatitis. Other authors did not find the same results [6, 10]. Other genes, such as those encoding detoxifying enzymes (alcohol dehydrogenase (ADH) [17, 31], aldehyde dehydrogenase (ALDH) [17], glutathione S-transferase (GST) [32] and uridine 5ⴕ-diphosphate glucuronosyltransferase (AGT1A7) [33]) and the transforming growth factor TGFbeta1 [34] might have a role, possibly with an indirect mechanism, in the genetic predisposition to alcoholic pancreatitis. da Costa et al.
Group A Alcoholics with chronic pancreatitis
Group B Alcoholics without chronic pancreatitis
Group C Nonalcoholic blood donors
73 patients
83 patients
112 patients
2 with pancreatitis 3 unconfirmed diagnosis
6 positive viral serology for hepatitis
2 positive viral serology for hepatitis
5 altered laboratory or image exams 2 unconfirmed alcoholism
68 patients
68 patients
1 failure in genetic test 6 lack of necessary information 1 alcoholism
104 patients
Fig. 1. Patient inclusion flowchart.
However, the present results do not provide a definite conclusion. Current knowledge is still very limited. The discrepancies found in research are possibly due to variable methods, different ethnic backgrounds of the populations and small samples. This emphasizes the need for new studies to clarify how genetic polymorphisms are related to the pathogenesis of alcoholic chronic pancreatitis. In the present research we chose to study intron 8 of the CFTR gene because of the high frequency of polymorphism found in the overall population and because prior studies [8, 9, 12, 16] reported that variants were more frequently found in non-Caucasian populations, characterized by racial multiplicity, as in Brazil. One of the reported polymorphisms is the T5 variant which consists of a short tract of polythymidines (poly-T) (5T instead of 7 or 9T) located at intron 8. Its presence inhibits exon-9 transcription in 90% of the homozygous and in 50% of the heterozygous individuals. The shorter the T sequence, the lower the protein activity [27]. A Japanese research [9] found that the T5 allele was significantly more frequent in patients with alcoholic pancreatitis than in healthy controls (p = 0.048). Results from various studies are shown in table 1. In addition to the polythymidine sequence, there are the TG dinucleotide repeats (TG)n, which had never been studied in Brazil in patients with alcoholic chronic pancreatitis.
Cuppens et al. [35] analyzed haplotypes build up by alleles found at the (TG)n and poly T loci; for each type of transcript the quantitative data of exon 9 were provided. They observed that regardless of the allele present in the poly T locus, the longer the stretch of TG repeats, an increasing proportion of transcripts that lacked exon 9 was found. For instance, on a T7 background, the (TG)11 allele led to a 2.8-fold increase in the proportion of CFTR transcripts that lacked exon 9, and (TG)12 led to a 6-fold increase when compared with the (TG)10 allele. Supporting these results, Nakamura et al. [36] reported genotypes without the presence of allele (TG)12 as protectors against the decreased production of bicarbonate by the pancreatic juice. Therefore, this study investigated the frequency of polymorphism in the polyT and (TG)n tract in intron 8 of the CFTR gene in patients with alcoholic chronic pancreatitis.
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
Pancreatology 2009;9:173–181
Methods Subjects This study was carried out by the Pancreas Group from the Department of Gastroenterology at the University of São Paulo Medical School (FMUSP). All of the participants signed the Informed Consent approved by the Ethics Research Committee (CAPPESQ), FMUSP. This is a case-control study composed by three groups of patients (fig. 1). Group A included 68 patients from the Pancreas Group who had alcoholic chronic pancreatitis, diagnosed by a
175
Fig. 2. Examples of sequences.
typical history (abdominal pain, diabetes mellitus and/or steatorrhea), associated to radiologic criteria (pancreatic calcification and/or ductal alterations) [37]. Alcoholism was defined when ethanol consumption had exceeded 80 g/day for women and 100 g/day for men for at least 6 years. Group B included 68 volunteers of the Alcoholics Anonymous Association (AAA), with a previous history of alcohol abuse who did not have chronic pancreatitis or liver cirrhosis identified by the clinical history and by laboratory and imaging tests. Group C included 104 healthy, nonalcoholic volunteer blood donors at Hospital das Clínicas, FMUSP. Patients with chronic pancreatitis of other etiologies (e.g. anatomic anomalies, hereditary pancreatitis, familial pancreatitis, cystic fibrosis, tropical pancreatitis) and/or positive viral serology for hepatitis and/or with diagnosis of liver cirrhosis were excluded. Genetic Analysis The genomic DNA was extracted from peripheral blood leukocytes using the QIAamp DNA Blood Kit (Qiagen, Hilden, Germany) and was stored at –20 ° C. The polymerase chain reaction (PCR) amplification used the following primers: Forward (F) 5ⴕATGGGCCATGTGCTTTTCAAAC 3ⴕ Reverse (R) 5ⴕCTGAAGAAGAGGCTGTCATCACCA 3ⴕ The cycling conditions were the following: preheating at 95 ° C for 5 min, followed by 35 cycles of 95 ° C for 30 s, 60 ° C for 45 s and 72 ° C for 45 s and then, a final extension of 72 ° C for 5 min. For the sequencing reaction, Big Dye Terminator Cycle Sequencing Standard Version 3.1 reagents (Applied Biosystems, Foster City, Calif., USA) were used both with forward and reverse primers.
176
Pancreatology 2009;9:173–181
The samples were applied in Long Ranger polyacrylamide gel packs (Cambrex, Valais, Switzerland) in ABI Prism 377 automated sequencer (Applied Biosystems). The sequences obtained were transferred into a computer and analyzed using the Chromas쏐 program (2003–2007 Technelysium Pty Ltd). Statistical Analysis The data obtained from the questionnaire, the imaging tests and the genetic study were recorded at an Excel쏐 database, were subjected to statistical analysis and the results were compared between the groups. The STATA (Stata Corp., USA) program was used for statistical tests and a p ^ 0.05 was considered statistically significant. The 2 test and Fisher’s exact test were used to compare categorical variables. Continuous variables for the comparison of more than two groups were assessed by variance analysis. Odds ratio (OR) and 95% confidence interval (CI 95%) were used for results with p ^ 0.05.
Results
Table 2 shows the distribution of group A, B and C patients according to age, gender and race. The 240 sequenced samples identified 24 different haplotype combinations. Two of them had (TG)9-T9/ (TG)10-T9 (0.8%), 1 had (TG)10-T7/(TG)9-T9 (0.4%), 23 (TG)10-T7/(TG)10-T7 (9.5%), 11 (TG)10-T7/(TG)10-T9 (4.5%), 42 (TG)10-T7/(TG)11-T7 (17.5%), 4 (TG)10-T7/ (TG)11-T9 (1.7%), 8 (TG)10-T7/(TG)12-T7 (3.3%), 4 (TG)10-T9/(TG)10-T9 (1.7%), 1 (TG)10-T9/(TG)11-T9 (0.4%), 7 (TG)11-T5/(TG)10-T7 (2.9%), 1 (TG)11-T5/ da Costa et al.
Table 2. Distribution of group A, B and C
patients according to age, gender and race Males Mean age, years White Black Mixed Races Asian Native Indians
Group A
Group B
Group C
(59/68) 86.8% 55.8 (37–73) (37/68) 54.4% (8/68) 11.7% (22/68) 32.3% (1/68) 1.5% (0/68) 0.0%
(59/68) 86.8% 50.7 (31–71) (38/68) 55.8% (10/68) 14.7% (19/68) 27.9% (0/68) 0.0% (1/68) 1.5%
(60/104) 57.7% 32.2 (18–70) (62/104) 59.6% (14/104) 13.5% (28/104) 26.9% (0/104) 0.0% (0/104) 0.0%
p value <0.001 <0.001 0.808
Group A = patients with alcoholic chronic pancreatitis. Group B = chronic alcoholics without pancreatitis. Group C = volunteer blood donors.
Table 3. Distribution of the groups according to the most usual haplotype combinations
Combination of haplotypes
Groups
p value
A
B
C
A ! B and A ! C
(TG)10-T7/(TG)10-T7 (TG)10-T7/(TG)11-T7 (TG)10-T9/(TG)11-T7 (TG)11-T7/(TG)11-T7 (TG)11-T7/(TG)12-T7
(7/68) 10.3% (5/68) 7.3% (8/68) 11.8% (16/68) 23.5% (10/68) 14.7%
(7/68) 10.3% (16/68) 23.5% (5/68) 7.3% (16/68) 23.5% (7/68) 10.3%
(9/104) 8.6% (21/104) 20.2% (6/104) 5.8% (20/104) 29.4% (17/104) 16.3%
1.0 and 0.718 0.008 and 0.016 0.280 and 0.131 1.0 and 0.497 0.434 and 0.777
Group A = patients with alcoholic chronic pancreatitis. Group B = chronic alcoholics without pancreatitis. Group C = volunteer blood donors.
(TG)10-T9 (0.4%), 4 (TG)11-T5/(TG)11-T7 (1.7%), 2 (TG)11-T5/(TG)12-T7 (0.8%), 19 (TG)11-T7/(TG)10-T9 (7.9%), 52 (TG)11-T7/(TG)11-T7 (21.7%), 7 (TG)11-T7/ (TG)11-T9 (2.9%), 34 (TG)11-T7/(TG)12-T7 (14.2%), 1 (TG)12-T5/(TG)11-T7 (0.8%), 1 (TG)12-T5/(TG)11-T9 (0.8%), 5 (TG)12-T7/(TG)10-T9 (2.1%), 4 (TG)12-T7/ (TG)11-T9 (1.7%), 5 (TG)12-T7/(TG)12-T7 (2.1%), 1 (TG)13-T5/(TG)11-T7 (0.8%) and 1 (TG)13-T5/(TG)12-T7 (0.8%). Figure 2 shows a few examples of the sequences found. Table 3 shows the most frequent haplotype combinations (found in over 5% of the studied samples) in groups A, B and C. Haplotype combination (TG)10-T7/ (TG)11-T7 was found in 7.3% of group A, 23.5% of group B and 20.2% of group C patients. When groups A and B are compared, p = 0.0080, OR = 0.2579, CI 95% = 0.0885–0.7514 and when groups A and C are compared, p = 0.0162, with OR = 0.3137 and CI 95% = 0.1121– 0.8776.
Study of intron 8 polythymidines of the CFTR gene revealed the presence of the T5 allele only in heterozygotes in groups A, B and C populations. Table 4 shows the distribution of T5/T7, T7/T7 and T7/T9 genotypes in groups A, B and C. Genotype T5/T7 was found in 11.8% of group A patients, 2.9% of group B patients and 5.8% of group C patients. When groups A and B are compared, p = 0.0481, OR = 4.4, CI 95% = 0.8986–21.5435 and when groups A and C are compared, p = 0.1317. In table 5, we can see the distribution of group A patients with T5/T7 genotype and with other genotypes, according to the presence of symptoms and/or complication. Of the patients with T5/T7 genotype, 25% developed diabetes mellitus versus 63.3% of those with other genotypes (p = 0.0465, OR = 0.193, CI 95% = 0.0357– 1.0399).
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
Pancreatology 2009;9:173–181
177
Table 4. Distribution of the groups according to the frequency of genotypes T5/T7, T7/T7 and T7/T9
Genotype
Group
T5/T7 T7/T7 T7/T9
p value
A
B
C
A ! B and A ! C
(8/68) 11.8% (40/68) 58.8% (16/68) 23.5%
(2/68) 2.9% (49/68) 72.0% (15/68) 22.0%
(6/104) 5.8% (75/104) 72.1% (20/104) 19.2%
0.048 and 0.131 0.104 and 0.070 0.841 and 0.497
Group A = patients with alcoholic chronic pancreatitis. Group B = chronic alcoholics without pancreatitis. Group C = volunteer blood donors.
Table 5. Distribution of T5/T7 genotype according to the presence of symptoms and/or complications in group A patients
Symptom and/ or complication
T5/T7
Other genotypes
p value
Abdominal pain Diarrhea Weight loss Diabetes mellitus Pancreatic pseudocyst
(7/8) 87.5% (4/8) 50.0% (6/8) 75.0% (2/8) 25.0% (4/8) 50.0%
(41/60) 68.3% (31/60) 51.6% (38/60) 63.3% (38/60) 63.3% (16/60) 26.6%
0.250 0.611 0.411 0.046 0.170
Group A = patients with alcoholic chronic pancreatitis.
Discussion
The study compared three groups of patients to check the impact of polymorphisms of the CFTR gene in the presence of the environmental risk factor alcohol to test the hypothesis that disease development is multifactorial. It was suggested that the group A population (alcoholic chronic pancreatitis) has a greater frequency of CFTR-related genetic mutations than a group of individuals exposed to the same environmental risk, i.e. alcohol, but without pancreatitis (group B); the expectation was different for group C (healthy individuals) when compared to group A since it was not affected by alcoholism and may have a similar frequency of polymorphism without developing the disease. The molecular study of intron 8 of the CFTR gene indicated wide genetic variability, with 24 different haplotype combinations, which might result from the racial diversity of our population; Nakamura et al. [36] found 6 haplotypes in their study population. 178
Pancreatology 2009;9:173–181
An important finding of the present study was that the haplotype combination (TG)10-T7/(TG)11-T7 is statistically significantly more frequent in group B compared to group A, suggesting that even with an external factor, alcohol, a specific genetic profile could eventually prevent the development of pancreatitis. In order to define the association between a gene and a clinical manifestation, Bradford Hill [38] proposed a causality criterion such as the OR. The lower frequency of the (TG)10-T7/(TG)11-T7 genetic variant in group A compared to groups B and C (OR = 0.2579) suggests a lower association with susceptibility to alcoholic chronic pancreatitis. In other words, its presence might protect against the disease. However, the study of different alleles alone, i.e., (TG)9, (TG)10, (TG)11 and (TG)12, or genotypes of the (TG)n sequence did not indicate any differences among the groups. Apparently, differences in this segment are more important in Asian populations than in ours, which includes a very small number of Asian individuals. In the study by Fujiki et al. [16], the presence of the (TG)12/(TG)12 genotype was more frequent among patients than controls. In addition, Nakamura et al. [17] found that alcoholics with the (TG)12 allele had a greater risk of presenting pancreatic calcifications on helical computed tomography examination than those with the (TG)11 allele. In the present study, the polythymidines region in intron 8 of the CFTR gene showed a higher frequency of allele T5 in group A than in groups B and C; however, there was no statistically significant difference. This finding is in accordance with the results obtained by Sharer et al. [6], Monaghan et al. [8] and Casals et al. [15] with a higher frequency of allele T5 in patients than that expected for the overall population. However, these da Costa et al.
studies did not include a control group without pancreatic disease. Bernardino et al. [12], in Brazil, detected the presence of allele T5 in 6.3% of the chromosomes of patients with alcoholic pancreatitis; however, the control population was not tested for the presence of CFTR gene mutations. Kimura et al. [9] observed a higher frequency of allele T5 in the population of patients with alcoholic chronic pancreatitis when compared to healthy controls, and this difference was statistically significant. However, Haber et al. [7] and Fujiki et al. [16] did not find any differences between the frequency of T5, T7 or T9 when they compared patients with alcoholic chronic pancreatitis with controls without pancreatitis. Gaia et al. [11] did not find T5 allele in their population with alcoholic pancreatitis. Another important finding of the present study was that the presence of T5/T7 genotype is associated with alcoholic chronic pancreatitis (group A) and there is a statistically significant difference compared to group B but not with group C. Differences were expected when comparing group A with group B because these patients were exposed to the same environmental risk factor, alcohol, whereas subjects in group C, who were volunteer blood donors, reflect the genetic profile of the overall nonalcoholic population. Thus, those with this genotype (T5/T7) associated with the ingestion of ethanol would have a greater risk to develop chronic pancreatitis than the remainder of the population. As opposed to what was reported for haplotype combination (TG)10-T7/(TG)11-T7, genotype T5/T7 could eventually facilitate the development of alcoholic chronic pancreatitis. OR calculation indicates the power of the association between this genetic profile (T5/T7) and alcoholic chronic pancreatitis, showing that the presence of this genotype would implicate a 4.4 greater possibility of developing chronic pancreatitis for chronic alcohol abusers. Comparison of the clinical findings of patients with alcoholic chronic pancreatitis with genotype T5/T7 with those of patients with other genotypes shows that its presence did not affect the patients’ outcome in terms of the presence of abdominal pain, exocrine failure or the development of pseudocysts; however, these patients have a lower incidence of diabetes mellitus than those without genotypes T5/T7. Patients with cystic fibrosis initially develop exocrine pancreatic insufficiency and with the progression of glandular fibrosis, about 10% develop diabetes mellitus [39]. Few studies have correlated the presence of genetic
mutations in patients with alcoholic chronic pancreatitis with the characteristics of the progression of pancreatic disease. Gaia et al. [40] did so and observed that the incidence of diabetes mellitus was lower in patients with mutations of the CFTR gene than in those with mutations of the SPINK1 gene and the incidence of diabetes mellitus was 31%, which is similar to the results of the present investigation (25% in patients with genotype T5/T7). This suggests that patients with chronic pancreatitis associated with CFTR gene mutations would have a lower risk to develop diabetes mellitus. This association should be confirmed in a larger study population. Subject selection is very important and may lead to biases. For instance, the analysis of the results indicates there is no difference in gender distribution between groups A and B whereas a difference was observed in group C, which included significantly more females than groups A and B. This is an expected result since alcohol abuse is more prevalent in males than in females; the blood donor sample reflects the distribution of the population in general. There are no reports showing a difference in the distribution of CFTR polymorphisms between genders. There was also a statistically significant difference in mean age for group A, B and C patients. This might suggest that group A patients developed alcoholic chronic pancreatitis because they were older and had had more time to develop the disease; however, it should be taken into consideration that group B had enough alcohol intake time and volume for the pancreatic injury to develop. Since this difference was not observed, it might be a genetic profile that favored the progression to alcoholic chronic pancreatitis. Group C was included to obtain information on the genetic profile of the population in general, which is present since birth, and therefore age differences in this group would not affect the analysis. Therefore, the groups are comparable and the results are consistent. In conclusion, this study indicates that there are differences in the genetic profile of groups A, B, and C and the comparison between patients with alcoholic chronic pancreatic disease (group A) and chronic alcoholics without pancreatic disease (group B) shows that genotype T5/ T7 was more frequent in group A than in group B (p = 0.048). It was also observed that haplotype combination (TG)10-T7/(TG)11-T7 works as a possible protective factor against the development of chronic pancreatitis. This difference is also statistically significant (p = 0.0080).
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
Pancreatology 2009;9:173–181
179
The obtained data confirm the raised hypothesis; however, further investigations should be carried out in the same population, with a larger sample, including more mutations of the CFTR gene and other genes, with the objective of getting a better understanding of individual susceptibilities to the complications caused by chronic alcoholism.
Acknowledgments This work was supported by grants from Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) and the Alves de Queiroz Family Fund for Research.
References 1 Marques ACPR, Ribeiro M: Projeto Diretrizes. Associação Médica Brasileira e Conselho Federal de Medicina, 2002, pp 1–20. 2 Witt H: Chronic pancreatitis and cystic fibrosis. Gut 2003; 52:1–25. 3 Buscail L: New insights in idiopathic pancreatitis. Gastroenterol Clin Biol 2003; 27: 391– 393. 4 Mott CB, Guarita DR: Pancreatite Crônica; in Cordeiro F (eds): Condutas em Gastroenterologia. São Paulo, Livraria e Editora Revinter Ltda, 2004, pp 632–634. 5 Burton PR, Tobin MD, Hopper JL: Key concepts in genetic epidemiology. Lancet 2005; 366:941–951. 6 Sharer N, Schwarz M, Malone G, Howarth A, Painter J, Super M, Braganza J: Mutations of the cystic fibrosis gene in patients with chronic pancreatitis. N Engl J Med 1998;339: 645–652. 7 Haber PS, Norris MD, Apte MV, Rodgers SC, Norton ID, Pirola RC, Roberts-Thomson IC, Wilson JS: Alcoholic pancreatitis and polymorphisms of the variable length polythymidine tract in the cystic fibrosis gene. Alcohol Clin Exp Res 1999; 23:509–512. 8 Monaghan KG, Jackson CE, Kukuruga DL, Feldman GL: Mutation analysis of the cystic fibrosis and cationic trypsinogen genes in patients with alcohol related pancreatitis. Am J Med Genet 2000;94:120–124. 9 Kimura S, Okabayashi Y, Inushima K, Yutsudo Y, Kasuga M: Polymorphism of cystic fibrosis gene in Japanese patients with chronic pancreatitis. Dig Dis Sci 2000; 45: 2007– 2012. 10 Malats N, Casals T, Porta M, Guarner L, Estivill X, Real FX: Cystic fibrosis transmembrane regulator (CFTR) DeltaF508 mutation and 5T allele in patients with chronic pancreatitis and exocrine pancreatic cancer. PANKRAS II Study Group. Gut 2001;48:70– 74. 11 Gaia E, Salacone P, Gallo M, Promis GG, Brusco ABC, Carlo A: Germline mutations in CFTR and PSTI genes in chronic pancreatitis patients. Dig Dis Sci 2002; 47: 2416– 2421.
180
12 Bernardino AL, Guarita DR, Mott CB, Pedroso MRA, Machado MCC, Laudanna AA, Tani CM, Almeida FL, Zatz M: CFTR, PRSS1 and SPINK1 in the development of pancreatitis in Brazilian patients. J Pancreas 2003; 4:169–177. 13 Pezzilli R, Morselli-Labate AM, Mantovani V, Romboli E, Selva P, Migliori M, Corinaldesi R, Gullo L: Mutations of the CFTR gene in pancreatic disease. Pancreas 2003;27: 332–336. 14 Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A: Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis. Eur J Hum Genet 2003;11:687–692. 15 Casals T, Aparisi L, Costa CM, Gimenez J, Ramos MD, Mora J, Diaz J, Boadas J, Estivill X, Farré A: Different CFTR mutational spectrum in alcoholic and idiopathic chronic pancreatitis? Pancreas 2004; 28:374–379. 16 Fujiki K, Ishiguro H, Ko SBH, Mizuno N, Suzuki Y, Takemura T, Yamamoto A, Yoshikawa T, Kitagawa M, Hayakawa T, Sakai Y, Takayama T, Saito M, Kondo T, Naruse S: Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis. J Med Genet 2004;41:e55. 17 Nakamura Y, Ohmori T, Higuchi S, Maruyama K: Certain background factors exhibit an association with an increased risk for pancreatic calcification among Japanese male alcoholics. Pancreas 2005; 31:225–231. 18 Whitcomb DC, Gorry MC, Preston RA, Furey W, Sossenheimer MJ, Ulrich CD, Martin SP, Gates LK Jr, Amann ST, Toskes PP, Liddle R, McGrath K, Uomo G, Post JC, Ehrlich GD: Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet 1996;14:141–145. 19 Howes N, Greenhalf W, Stocken DD, Neoptolemos JP: Cationic trypsinogen mutations and pancreatitis. Clin Lab Med 2005;25:39– 59. 20 Teich N, Mossner J: Genetic aspects of chronic pancreatitis. Med Sci Monit 2004; 10: RA325–RA328.
Pancreatology 2009;9:173–181
21 Witt H, Luck W, Hennies HC, Classen M, Kage A, Lass U, Landt O, Becker M: Mutations in the gene encoding the serine protease inhibitor, Kazal type 1 are associated with chronic pancreatitis. Nat Genet 2000; 25:213–216. 22 Witt H, Luck W, Becker M, Böhmig M, Kage A, Truninger K, Ammann RW, O’Reilly D, Kingsnorth A, Schulz HU, Halangk W, Kielstein V, Knoefel WT, Teich N, Keim V: Mutation in the SPINK1 trypsin inhibitor gene, alcohol use, and chronic pancreatitis. JAMA 2001;285:2716–2717. 23 Lempinen M, Paju A, Kemppainen E, Smura T, Kylanpaa ML, Nevanlinna H, Stenman J, Stenman UH: Mutations N34S and P55S of the SPINK1 gene in patients with chronic pancreatitis or pancreatic cancer and in healthy subjects: a report from Finland. Scand J Gastroenterol 2005; 40:225–230. 24 Tukiainen E, Kylanpaa ML, Kemppainen E, Nevanlinna H, Paju A, Repo H, Stenman UH, Puolakkainen P: Pancreatic secretory trypsin inhibitor (SPINK1) gene mutations in patients with acute pancreatitis. Pancreas 2005;30:239–242. 25 Kume K, Masamune A, Mizutamari H, Kaneko K, Kikuta K, Satoh M, Satoh K, Kimura K, Suzuki N, Nagasaki Y, et al: Mutations in the serine protease inhibitor Kazal Type 1 (SPINK1) gene in Japanese patients with pancreatitis. Pancreatology 2005; 5: 354–360. 26 Lee KH, Ryu JK, Yoon WJ, Lee JK, Kim YT, Yoon YB: Mutation analysis of SPINK1 and CFTR gene in Korean patients with alcoholic chronic pancreatitis. Dig Dis Sci 2005; 50: 1852–1856. 27 Cohn JA, Mitchell RM, Jowell PS: The role of cystic fibrosis gene mutations in determining susceptibility to chronic pancreatitis. Gastroenterol Clin N Am 2004; 33:817–821. 28 Lyon E, Miller C: Current challenges in cystic fibrosis screening. Arch Pathol Lab Med 2003;127:1133–1139. 29 Bruno MJ: Current insights into the pathogenesis of acute and chronic pancreatitis. Scand J Gastroenterol 2001; 36(suppl 234): 103–108.
da Costa et al.
30 Whitcomb DC: Value of genetic testing in the management of pancreatitis. Gut 2004; 53:1710–1717. 31 Cichoz-Lach H, Partycka J, Nesina I, Celinski K, Slomka M, Wojcierowski J: Genetic polymorphism of alcohol dehydrogenase 3 in alcohol liver cirrhosis and in alcohol chronic pancreatitis. Alcohol Alcohol 2006; 41:14–17. 32 Verlaan M, te Morsche RH, Roelofs HM, Laheij RJ, Jansen JB, Peters WH, Drenth JP: Glutathione S-transferase Mu null genotype affords protection against alcohol induced chronic pancreatitis. Am J Med Genet 2003; 120A:34–39. 33 Ockenga J, Vogel A, Teich N, Keim V, Manns MP, Strassburg CP: UDP glucuronosyltransferase (UGT1A7) gene polymorphisms increase the risk of chronic pancreatitis and pancreatic cancer. Gastroenterology 2003; 124:1802–1808.
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
34 Bendicho MT, Guedes JC, Silva NN, Santana GO, dos Santos RR, Lyra AC, Lyra LG, Meyer R, Lemaire DC: Polymorphism of cytokine genes (TGF-beta1, IFN-gamma, IL-6, IL-10, and TNF-alpha) in patients with chronic pancreatitis. Pancreas 2005; 30:333– 336. 35 Cuppens H, Lin W, Jaspers M, Costes B, Teng H, Vankeerberghen A, Jorissen M, Droogmans G, Reynaert I, Goossens M, et al: Polyvariant mutant cystic fibrosis transmembrane conductance regulator genes. The polymorphic (Tg)m locus explains the partial penetrance of the T5 polymorphism as a disease mutation. J Clin Invest 1998; 101: 487–496.
36 Nakamura Y, Ohmori T, Ishikawa A, Kobayashi Y, Imazeki H, Higuchi S, Maruyama K: Homozygous (TG)11 allele in intron 8 of the cystic fibrosis transmenbrane conductance regulator (CFTR) gene has a protective role against bicarbonate decrease in pure pancreatic juice among Japanese male alcoholics. Intern Med 2004; 43:1131–1137. 37 Ammann RW: Diagnosis and management of chronic pancreatitis: current knowledge. Seiss Med Wkly 2006;136:166–174. 38 Hill AB: The environment and disease: association or causation? Proc R Soc Med 1965;58:295. 39 Vantyghem MC, Moussaïd-Guennoun R, Perimenis P, Marcelli-Tourvieille S, Perez T, Wallaert B: Cystic fibrosis diabetes in adult. Ann Endocrinol (Paris) 2005; 66:347–354. 40 Gaia E, Salacone P, Salmin P, Brusco A, Bacillo E, Arduino C: Differences in clinical manifestations in patients with chronic pancreatitis and mutations of CFTR, SPINK1 e PRSS1 genes. J Pancreas 2004; 6:521.
Pancreatology 2009;9:173–181
181
Received: December 17, 2007 Accepted after revision: July 1, 2008 Published online: December 13, 2008
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis Marianges Zadrozny Gouvêa da Costa Dulce Reis Guarita Suzane Kioko Ono-Nita Jerônimo de Alencar Nogueira Marcelo Eidi Nita Denise Cerqueira Paranaguá-Vezozzo Marcelo Tavares de Souza Eliane Pereira do Carmo Ana Cristina de Sá Teixeira Flair José Carrilho Department of Gastroenterology, University of São Paulo, School of Medicine, São Paulo, Brazil
Key Words Pancreatitis/genetics ⴢ Cystic fibrosis transmembrane conductance regulator ⴢ Polymorphisms ⴢ Alcoholism
Abstract Introduction: Pancreas susceptibility to alcohol is variable and only 5–10% of chronic alcohol abusers develop chronic pancreatitis; the role of genetic factors in this process is unknown. The CFTR gene encodes a protein that acts on epithelial cells and plays a key role in normal exocrine pancreatic function. Methods: This study investigated the frequency of polymorphisms in intron 8 of the CFTR gene in patients with alcoholic chronic pancreatitis. Three groups of patients were studied: group A – 68 adult alcoholics with a diagnosis of chronic pancreatitis; group B – 68 adult alcoholics without pancreatic disease or liver cirrhosis and group C – 104 healthy nonalcoholic adults. Results: T5/T7 genotype was more frequent in group A (11.8%) than in group B (2.9%) (p = 0.0481), and there was no statistical difference when groups A and C (5.8%) were compared (p = 0.1317). The haplotype combination (TG)10-T7/(TG)11-T7 was more frequent in groups B (23.5%) and C (20.2%) than in group A (7.3%) (p = 0.0080 and 0.0162). Conclusion: There are differences when these three groups are compared and individuals with T5/T7 genotype might have a greater risk of developing chronic pancreatitis when they become chronic alcoholics. Copyright © 2008 S. Karger AG, Basel and IAP
© 2008 S. Karger AG, Basel and IAP 1424–3903/09/0092–0173$26.00/0 Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com
Accessible online at: www.karger.com/pan
Introduction
Alcohol abuse affects 10–12% of the world’s population and 11.2% of those living in the 107 largest cities in Brazil [1], and the association between alcohol abuse and chronic pancreatitis is well established [2]. In the West, alcohol is the cause of 70–90% of calcifying chronic pancreatitis [3], and in our country the high prevalence of alcohol abuse is responsible for 93.4% of the cases [4]. However, pancreas susceptibility to alcohol is variable and only 5–10% of chronic alcoholics develop chronic pancreatitis. The role of genetic factors in this process is mostly unknown [2]. The investigation of genetic determinants for diseases with multiple causes is difficult since they result from the interaction of environmental factors with multiple genes [5]. Studies have been carried out to investigate the genetic predisposition to alcoholic chronic pancreatitis; however, the results are conflicting and there are no definitive conclusions available [6–17]. Recent investigations have identified mutations in the cationic trypsinogen gene (PRSS1), the pancreatic secretory trypsin inhibitor/ serine protease inhibitor, Kazal type 1 gene (SPINK1) and the cystic fibrosis transmenbrane conductance regulator gene (CFTR) in patients with chronic pancreatits. The discovery of PRSS1 mutations in hereditary pancreatitis by Whitcomb et al. [18] in 1996 led to a better Marianges Z.G. da Costa University of São Paulo, School of Medicine Eneas Carvalho de Aguiar 255, room 9159 São Paulo 05403000 (Brazil) Tel. +55 113 069 7830, Fax +55 113 069 8237, E-Mail [email protected]
Table 1. Frequency of the 5T variant in intron 8 of the CFTR gene in different populations of patients with alcoholic chronic pancreatitis
References
Country
Race
n
T5 allele
Sharer et al. [6], 1998 Haber et al. [7], 1999 Monaghan et al. [8], 2000
England Australia USA
71 50 46
4.2% 1.9% 7.6%
Kimura et al. [9], 2000 Malats et al. [10], 2001 Gaia et al. [11], 2003 Bernardino et al. [12], 2003
Japan Spain Italy Brazil
31 70 21 64
4.8%* 4.3% 0.0% 6.3%
Pezzilli et al. [13], 2003 Perri et al. [14], 2003 Casals et al. [15], 2004 Fujiki et al. [16], 2004 Nakamura et al. [17], 2005
Italy Italy Spain Japan Japan
White White White (24%) Black (74%) Hispanic (2%) Asian White White White (77.5%) Mixed races (18.5%) Asian (4%) White White White Asian Asian
34 45 37 51 44
7.4% 2.2% 4.1% 2.0%
(TG)12 allele
35%* 60.7%
* Statistically significant (p < 0.05).
understanding of the pathophysiology of the disease. R122H is the most common mutation observed [19]. Several different mutations, such as N29I and A16V were subsequently found in a large number of investigated families [20]. However, the researches have not found any mutations of the PRSS1 gene in patients with alcoholic pancreatitis [8, 14]. In Brazil, the E79K change in exon 3 was detected in 1 patient with alcohol-related chronic pancreatitis but with no difference when compared to control subjects [12]. In 2000, Witt et al. [21] demonstrated the association between mutation N34S of the SPINK1 gene and chronic idiopathic pancreatitis, confirmed by several other groups [20]. SPINK1 is a potent inhibitor of trypsin activity in the pancreas [20], and some authors have described a correlation with alcoholic chronic pancreatitis, as well [22, 23], but the results diverged [24–26]. Since it was discovered in 1989, over 1,000 mutations of the CFTR gene have been reported [27]. The most common mutation is F508del, responsible for 70% of the cases of cystic fibrosis, an autosomal recessive syndrome characterized by frequent respiratory infections and pancreatic insufficiency [28].
174
Pancreatology 2009;9:173–181
The CFTR gene encodes a regulatory protein which works as an anion channel in epithelial cells and plays a key role in the regulation of alkalinization and dilution of the pancreatic juice [27]. This gene was considered a possible contributor to the development of alcoholic chronic pancreatitis based on the identification of patients with atypical or monosymptomatic cystic fibrosis, manifested, for instance by isolated pancreatic disease [29]. In the presence of some mutations, heterozygous patients with a partial decrease in protein activity might develop isolated pancreatic disease when subjected to an environmental risk factor [30]. In these cases, alcohol might act as a trigger. High frequencies (23.5% [13] and 40.5% [15]) of mutations in the CFTR gene were described in patients with alcoholic pancreatitis. Other authors did not find the same results [6, 10]. Other genes, such as those encoding detoxifying enzymes (alcohol dehydrogenase (ADH) [17, 31], aldehyde dehydrogenase (ALDH) [17], glutathione S-transferase (GST) [32] and uridine 5ⴕ-diphosphate glucuronosyltransferase (AGT1A7) [33]) and the transforming growth factor TGFbeta1 [34] might have a role, possibly with an indirect mechanism, in the genetic predisposition to alcoholic pancreatitis. da Costa et al.
Group A Alcoholics with chronic pancreatitis
Group B Alcoholics without chronic pancreatitis
Group C Nonalcoholic blood donors
73 patients
83 patients
112 patients
2 with pancreatitis 3 unconfirmed diagnosis
6 positive viral serology for hepatitis
2 positive viral serology for hepatitis
5 altered laboratory or image exams 2 unconfirmed alcoholism
68 patients
68 patients
1 failure in genetic test 6 lack of necessary information 1 alcoholism
104 patients
Fig. 1. Patient inclusion flowchart.
However, the present results do not provide a definite conclusion. Current knowledge is still very limited. The discrepancies found in research are possibly due to variable methods, different ethnic backgrounds of the populations and small samples. This emphasizes the need for new studies to clarify how genetic polymorphisms are related to the pathogenesis of alcoholic chronic pancreatitis. In the present research we chose to study intron 8 of the CFTR gene because of the high frequency of polymorphism found in the overall population and because prior studies [8, 9, 12, 16] reported that variants were more frequently found in non-Caucasian populations, characterized by racial multiplicity, as in Brazil. One of the reported polymorphisms is the T5 variant which consists of a short tract of polythymidines (poly-T) (5T instead of 7 or 9T) located at intron 8. Its presence inhibits exon-9 transcription in 90% of the homozygous and in 50% of the heterozygous individuals. The shorter the T sequence, the lower the protein activity [27]. A Japanese research [9] found that the T5 allele was significantly more frequent in patients with alcoholic pancreatitis than in healthy controls (p = 0.048). Results from various studies are shown in table 1. In addition to the polythymidine sequence, there are the TG dinucleotide repeats (TG)n, which had never been studied in Brazil in patients with alcoholic chronic pancreatitis.
Cuppens et al. [35] analyzed haplotypes build up by alleles found at the (TG)n and poly T loci; for each type of transcript the quantitative data of exon 9 were provided. They observed that regardless of the allele present in the poly T locus, the longer the stretch of TG repeats, an increasing proportion of transcripts that lacked exon 9 was found. For instance, on a T7 background, the (TG)11 allele led to a 2.8-fold increase in the proportion of CFTR transcripts that lacked exon 9, and (TG)12 led to a 6-fold increase when compared with the (TG)10 allele. Supporting these results, Nakamura et al. [36] reported genotypes without the presence of allele (TG)12 as protectors against the decreased production of bicarbonate by the pancreatic juice. Therefore, this study investigated the frequency of polymorphism in the polyT and (TG)n tract in intron 8 of the CFTR gene in patients with alcoholic chronic pancreatitis.
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
Pancreatology 2009;9:173–181
Methods Subjects This study was carried out by the Pancreas Group from the Department of Gastroenterology at the University of São Paulo Medical School (FMUSP). All of the participants signed the Informed Consent approved by the Ethics Research Committee (CAPPESQ), FMUSP. This is a case-control study composed by three groups of patients (fig. 1). Group A included 68 patients from the Pancreas Group who had alcoholic chronic pancreatitis, diagnosed by a
175
Fig. 2. Examples of sequences.
typical history (abdominal pain, diabetes mellitus and/or steatorrhea), associated to radiologic criteria (pancreatic calcification and/or ductal alterations) [37]. Alcoholism was defined when ethanol consumption had exceeded 80 g/day for women and 100 g/day for men for at least 6 years. Group B included 68 volunteers of the Alcoholics Anonymous Association (AAA), with a previous history of alcohol abuse who did not have chronic pancreatitis or liver cirrhosis identified by the clinical history and by laboratory and imaging tests. Group C included 104 healthy, nonalcoholic volunteer blood donors at Hospital das Clínicas, FMUSP. Patients with chronic pancreatitis of other etiologies (e.g. anatomic anomalies, hereditary pancreatitis, familial pancreatitis, cystic fibrosis, tropical pancreatitis) and/or positive viral serology for hepatitis and/or with diagnosis of liver cirrhosis were excluded. Genetic Analysis The genomic DNA was extracted from peripheral blood leukocytes using the QIAamp DNA Blood Kit (Qiagen, Hilden, Germany) and was stored at –20 ° C. The polymerase chain reaction (PCR) amplification used the following primers: Forward (F) 5ⴕATGGGCCATGTGCTTTTCAAAC 3ⴕ Reverse (R) 5ⴕCTGAAGAAGAGGCTGTCATCACCA 3ⴕ The cycling conditions were the following: preheating at 95 ° C for 5 min, followed by 35 cycles of 95 ° C for 30 s, 60 ° C for 45 s and 72 ° C for 45 s and then, a final extension of 72 ° C for 5 min. For the sequencing reaction, Big Dye Terminator Cycle Sequencing Standard Version 3.1 reagents (Applied Biosystems, Foster City, Calif., USA) were used both with forward and reverse primers.
176
Pancreatology 2009;9:173–181
The samples were applied in Long Ranger polyacrylamide gel packs (Cambrex, Valais, Switzerland) in ABI Prism 377 automated sequencer (Applied Biosystems). The sequences obtained were transferred into a computer and analyzed using the Chromas쏐 program (2003–2007 Technelysium Pty Ltd). Statistical Analysis The data obtained from the questionnaire, the imaging tests and the genetic study were recorded at an Excel쏐 database, were subjected to statistical analysis and the results were compared between the groups. The STATA (Stata Corp., USA) program was used for statistical tests and a p ^ 0.05 was considered statistically significant. The 2 test and Fisher’s exact test were used to compare categorical variables. Continuous variables for the comparison of more than two groups were assessed by variance analysis. Odds ratio (OR) and 95% confidence interval (CI 95%) were used for results with p ^ 0.05.
Results
Table 2 shows the distribution of group A, B and C patients according to age, gender and race. The 240 sequenced samples identified 24 different haplotype combinations. Two of them had (TG)9-T9/ (TG)10-T9 (0.8%), 1 had (TG)10-T7/(TG)9-T9 (0.4%), 23 (TG)10-T7/(TG)10-T7 (9.5%), 11 (TG)10-T7/(TG)10-T9 (4.5%), 42 (TG)10-T7/(TG)11-T7 (17.5%), 4 (TG)10-T7/ (TG)11-T9 (1.7%), 8 (TG)10-T7/(TG)12-T7 (3.3%), 4 (TG)10-T9/(TG)10-T9 (1.7%), 1 (TG)10-T9/(TG)11-T9 (0.4%), 7 (TG)11-T5/(TG)10-T7 (2.9%), 1 (TG)11-T5/ da Costa et al.
Table 2. Distribution of group A, B and C
patients according to age, gender and race Males Mean age, years White Black Mixed Races Asian Native Indians
Group A
Group B
Group C
(59/68) 86.8% 55.8 (37–73) (37/68) 54.4% (8/68) 11.7% (22/68) 32.3% (1/68) 1.5% (0/68) 0.0%
(59/68) 86.8% 50.7 (31–71) (38/68) 55.8% (10/68) 14.7% (19/68) 27.9% (0/68) 0.0% (1/68) 1.5%
(60/104) 57.7% 32.2 (18–70) (62/104) 59.6% (14/104) 13.5% (28/104) 26.9% (0/104) 0.0% (0/104) 0.0%
p value <0.001 <0.001 0.808
Group A = patients with alcoholic chronic pancreatitis. Group B = chronic alcoholics without pancreatitis. Group C = volunteer blood donors.
Table 3. Distribution of the groups according to the most usual haplotype combinations
Combination of haplotypes
Groups
p value
A
B
C
A ! B and A ! C
(TG)10-T7/(TG)10-T7 (TG)10-T7/(TG)11-T7 (TG)10-T9/(TG)11-T7 (TG)11-T7/(TG)11-T7 (TG)11-T7/(TG)12-T7
(7/68) 10.3% (5/68) 7.3% (8/68) 11.8% (16/68) 23.5% (10/68) 14.7%
(7/68) 10.3% (16/68) 23.5% (5/68) 7.3% (16/68) 23.5% (7/68) 10.3%
(9/104) 8.6% (21/104) 20.2% (6/104) 5.8% (20/104) 29.4% (17/104) 16.3%
1.0 and 0.718 0.008 and 0.016 0.280 and 0.131 1.0 and 0.497 0.434 and 0.777
Group A = patients with alcoholic chronic pancreatitis. Group B = chronic alcoholics without pancreatitis. Group C = volunteer blood donors.
(TG)10-T9 (0.4%), 4 (TG)11-T5/(TG)11-T7 (1.7%), 2 (TG)11-T5/(TG)12-T7 (0.8%), 19 (TG)11-T7/(TG)10-T9 (7.9%), 52 (TG)11-T7/(TG)11-T7 (21.7%), 7 (TG)11-T7/ (TG)11-T9 (2.9%), 34 (TG)11-T7/(TG)12-T7 (14.2%), 1 (TG)12-T5/(TG)11-T7 (0.8%), 1 (TG)12-T5/(TG)11-T9 (0.8%), 5 (TG)12-T7/(TG)10-T9 (2.1%), 4 (TG)12-T7/ (TG)11-T9 (1.7%), 5 (TG)12-T7/(TG)12-T7 (2.1%), 1 (TG)13-T5/(TG)11-T7 (0.8%) and 1 (TG)13-T5/(TG)12-T7 (0.8%). Figure 2 shows a few examples of the sequences found. Table 3 shows the most frequent haplotype combinations (found in over 5% of the studied samples) in groups A, B and C. Haplotype combination (TG)10-T7/ (TG)11-T7 was found in 7.3% of group A, 23.5% of group B and 20.2% of group C patients. When groups A and B are compared, p = 0.0080, OR = 0.2579, CI 95% = 0.0885–0.7514 and when groups A and C are compared, p = 0.0162, with OR = 0.3137 and CI 95% = 0.1121– 0.8776.
Study of intron 8 polythymidines of the CFTR gene revealed the presence of the T5 allele only in heterozygotes in groups A, B and C populations. Table 4 shows the distribution of T5/T7, T7/T7 and T7/T9 genotypes in groups A, B and C. Genotype T5/T7 was found in 11.8% of group A patients, 2.9% of group B patients and 5.8% of group C patients. When groups A and B are compared, p = 0.0481, OR = 4.4, CI 95% = 0.8986–21.5435 and when groups A and C are compared, p = 0.1317. In table 5, we can see the distribution of group A patients with T5/T7 genotype and with other genotypes, according to the presence of symptoms and/or complication. Of the patients with T5/T7 genotype, 25% developed diabetes mellitus versus 63.3% of those with other genotypes (p = 0.0465, OR = 0.193, CI 95% = 0.0357– 1.0399).
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
Pancreatology 2009;9:173–181
177
Table 4. Distribution of the groups according to the frequency of genotypes T5/T7, T7/T7 and T7/T9
Genotype
Group
T5/T7 T7/T7 T7/T9
p value
A
B
C
A ! B and A ! C
(8/68) 11.8% (40/68) 58.8% (16/68) 23.5%
(2/68) 2.9% (49/68) 72.0% (15/68) 22.0%
(6/104) 5.8% (75/104) 72.1% (20/104) 19.2%
0.048 and 0.131 0.104 and 0.070 0.841 and 0.497
Group A = patients with alcoholic chronic pancreatitis. Group B = chronic alcoholics without pancreatitis. Group C = volunteer blood donors.
Table 5. Distribution of T5/T7 genotype according to the presence of symptoms and/or complications in group A patients
Symptom and/ or complication
T5/T7
Other genotypes
p value
Abdominal pain Diarrhea Weight loss Diabetes mellitus Pancreatic pseudocyst
(7/8) 87.5% (4/8) 50.0% (6/8) 75.0% (2/8) 25.0% (4/8) 50.0%
(41/60) 68.3% (31/60) 51.6% (38/60) 63.3% (38/60) 63.3% (16/60) 26.6%
0.250 0.611 0.411 0.046 0.170
Group A = patients with alcoholic chronic pancreatitis.
Discussion
The study compared three groups of patients to check the impact of polymorphisms of the CFTR gene in the presence of the environmental risk factor alcohol to test the hypothesis that disease development is multifactorial. It was suggested that the group A population (alcoholic chronic pancreatitis) has a greater frequency of CFTR-related genetic mutations than a group of individuals exposed to the same environmental risk, i.e. alcohol, but without pancreatitis (group B); the expectation was different for group C (healthy individuals) when compared to group A since it was not affected by alcoholism and may have a similar frequency of polymorphism without developing the disease. The molecular study of intron 8 of the CFTR gene indicated wide genetic variability, with 24 different haplotype combinations, which might result from the racial diversity of our population; Nakamura et al. [36] found 6 haplotypes in their study population. 178
Pancreatology 2009;9:173–181
An important finding of the present study was that the haplotype combination (TG)10-T7/(TG)11-T7 is statistically significantly more frequent in group B compared to group A, suggesting that even with an external factor, alcohol, a specific genetic profile could eventually prevent the development of pancreatitis. In order to define the association between a gene and a clinical manifestation, Bradford Hill [38] proposed a causality criterion such as the OR. The lower frequency of the (TG)10-T7/(TG)11-T7 genetic variant in group A compared to groups B and C (OR = 0.2579) suggests a lower association with susceptibility to alcoholic chronic pancreatitis. In other words, its presence might protect against the disease. However, the study of different alleles alone, i.e., (TG)9, (TG)10, (TG)11 and (TG)12, or genotypes of the (TG)n sequence did not indicate any differences among the groups. Apparently, differences in this segment are more important in Asian populations than in ours, which includes a very small number of Asian individuals. In the study by Fujiki et al. [16], the presence of the (TG)12/(TG)12 genotype was more frequent among patients than controls. In addition, Nakamura et al. [17] found that alcoholics with the (TG)12 allele had a greater risk of presenting pancreatic calcifications on helical computed tomography examination than those with the (TG)11 allele. In the present study, the polythymidines region in intron 8 of the CFTR gene showed a higher frequency of allele T5 in group A than in groups B and C; however, there was no statistically significant difference. This finding is in accordance with the results obtained by Sharer et al. [6], Monaghan et al. [8] and Casals et al. [15] with a higher frequency of allele T5 in patients than that expected for the overall population. However, these da Costa et al.
studies did not include a control group without pancreatic disease. Bernardino et al. [12], in Brazil, detected the presence of allele T5 in 6.3% of the chromosomes of patients with alcoholic pancreatitis; however, the control population was not tested for the presence of CFTR gene mutations. Kimura et al. [9] observed a higher frequency of allele T5 in the population of patients with alcoholic chronic pancreatitis when compared to healthy controls, and this difference was statistically significant. However, Haber et al. [7] and Fujiki et al. [16] did not find any differences between the frequency of T5, T7 or T9 when they compared patients with alcoholic chronic pancreatitis with controls without pancreatitis. Gaia et al. [11] did not find T5 allele in their population with alcoholic pancreatitis. Another important finding of the present study was that the presence of T5/T7 genotype is associated with alcoholic chronic pancreatitis (group A) and there is a statistically significant difference compared to group B but not with group C. Differences were expected when comparing group A with group B because these patients were exposed to the same environmental risk factor, alcohol, whereas subjects in group C, who were volunteer blood donors, reflect the genetic profile of the overall nonalcoholic population. Thus, those with this genotype (T5/T7) associated with the ingestion of ethanol would have a greater risk to develop chronic pancreatitis than the remainder of the population. As opposed to what was reported for haplotype combination (TG)10-T7/(TG)11-T7, genotype T5/T7 could eventually facilitate the development of alcoholic chronic pancreatitis. OR calculation indicates the power of the association between this genetic profile (T5/T7) and alcoholic chronic pancreatitis, showing that the presence of this genotype would implicate a 4.4 greater possibility of developing chronic pancreatitis for chronic alcohol abusers. Comparison of the clinical findings of patients with alcoholic chronic pancreatitis with genotype T5/T7 with those of patients with other genotypes shows that its presence did not affect the patients’ outcome in terms of the presence of abdominal pain, exocrine failure or the development of pseudocysts; however, these patients have a lower incidence of diabetes mellitus than those without genotypes T5/T7. Patients with cystic fibrosis initially develop exocrine pancreatic insufficiency and with the progression of glandular fibrosis, about 10% develop diabetes mellitus [39]. Few studies have correlated the presence of genetic
mutations in patients with alcoholic chronic pancreatitis with the characteristics of the progression of pancreatic disease. Gaia et al. [40] did so and observed that the incidence of diabetes mellitus was lower in patients with mutations of the CFTR gene than in those with mutations of the SPINK1 gene and the incidence of diabetes mellitus was 31%, which is similar to the results of the present investigation (25% in patients with genotype T5/T7). This suggests that patients with chronic pancreatitis associated with CFTR gene mutations would have a lower risk to develop diabetes mellitus. This association should be confirmed in a larger study population. Subject selection is very important and may lead to biases. For instance, the analysis of the results indicates there is no difference in gender distribution between groups A and B whereas a difference was observed in group C, which included significantly more females than groups A and B. This is an expected result since alcohol abuse is more prevalent in males than in females; the blood donor sample reflects the distribution of the population in general. There are no reports showing a difference in the distribution of CFTR polymorphisms between genders. There was also a statistically significant difference in mean age for group A, B and C patients. This might suggest that group A patients developed alcoholic chronic pancreatitis because they were older and had had more time to develop the disease; however, it should be taken into consideration that group B had enough alcohol intake time and volume for the pancreatic injury to develop. Since this difference was not observed, it might be a genetic profile that favored the progression to alcoholic chronic pancreatitis. Group C was included to obtain information on the genetic profile of the population in general, which is present since birth, and therefore age differences in this group would not affect the analysis. Therefore, the groups are comparable and the results are consistent. In conclusion, this study indicates that there are differences in the genetic profile of groups A, B, and C and the comparison between patients with alcoholic chronic pancreatic disease (group A) and chronic alcoholics without pancreatic disease (group B) shows that genotype T5/ T7 was more frequent in group A than in group B (p = 0.048). It was also observed that haplotype combination (TG)10-T7/(TG)11-T7 works as a possible protective factor against the development of chronic pancreatitis. This difference is also statistically significant (p = 0.0080).
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
Pancreatology 2009;9:173–181
179
The obtained data confirm the raised hypothesis; however, further investigations should be carried out in the same population, with a larger sample, including more mutations of the CFTR gene and other genes, with the objective of getting a better understanding of individual susceptibilities to the complications caused by chronic alcoholism.
Acknowledgments This work was supported by grants from Fundação de Amparo à Pesquisa do Estado de São Paulo (FAPESP) and the Alves de Queiroz Family Fund for Research.
References 1 Marques ACPR, Ribeiro M: Projeto Diretrizes. Associação Médica Brasileira e Conselho Federal de Medicina, 2002, pp 1–20. 2 Witt H: Chronic pancreatitis and cystic fibrosis. Gut 2003; 52:1–25. 3 Buscail L: New insights in idiopathic pancreatitis. Gastroenterol Clin Biol 2003; 27: 391– 393. 4 Mott CB, Guarita DR: Pancreatite Crônica; in Cordeiro F (eds): Condutas em Gastroenterologia. São Paulo, Livraria e Editora Revinter Ltda, 2004, pp 632–634. 5 Burton PR, Tobin MD, Hopper JL: Key concepts in genetic epidemiology. Lancet 2005; 366:941–951. 6 Sharer N, Schwarz M, Malone G, Howarth A, Painter J, Super M, Braganza J: Mutations of the cystic fibrosis gene in patients with chronic pancreatitis. N Engl J Med 1998;339: 645–652. 7 Haber PS, Norris MD, Apte MV, Rodgers SC, Norton ID, Pirola RC, Roberts-Thomson IC, Wilson JS: Alcoholic pancreatitis and polymorphisms of the variable length polythymidine tract in the cystic fibrosis gene. Alcohol Clin Exp Res 1999; 23:509–512. 8 Monaghan KG, Jackson CE, Kukuruga DL, Feldman GL: Mutation analysis of the cystic fibrosis and cationic trypsinogen genes in patients with alcohol related pancreatitis. Am J Med Genet 2000;94:120–124. 9 Kimura S, Okabayashi Y, Inushima K, Yutsudo Y, Kasuga M: Polymorphism of cystic fibrosis gene in Japanese patients with chronic pancreatitis. Dig Dis Sci 2000; 45: 2007– 2012. 10 Malats N, Casals T, Porta M, Guarner L, Estivill X, Real FX: Cystic fibrosis transmembrane regulator (CFTR) DeltaF508 mutation and 5T allele in patients with chronic pancreatitis and exocrine pancreatic cancer. PANKRAS II Study Group. Gut 2001;48:70– 74. 11 Gaia E, Salacone P, Gallo M, Promis GG, Brusco ABC, Carlo A: Germline mutations in CFTR and PSTI genes in chronic pancreatitis patients. Dig Dis Sci 2002; 47: 2416– 2421.
180
12 Bernardino AL, Guarita DR, Mott CB, Pedroso MRA, Machado MCC, Laudanna AA, Tani CM, Almeida FL, Zatz M: CFTR, PRSS1 and SPINK1 in the development of pancreatitis in Brazilian patients. J Pancreas 2003; 4:169–177. 13 Pezzilli R, Morselli-Labate AM, Mantovani V, Romboli E, Selva P, Migliori M, Corinaldesi R, Gullo L: Mutations of the CFTR gene in pancreatic disease. Pancreas 2003;27: 332–336. 14 Perri F, Piepoli A, Stanziale P, Merla A, Zelante L, Andriulli A: Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis. Eur J Hum Genet 2003;11:687–692. 15 Casals T, Aparisi L, Costa CM, Gimenez J, Ramos MD, Mora J, Diaz J, Boadas J, Estivill X, Farré A: Different CFTR mutational spectrum in alcoholic and idiopathic chronic pancreatitis? Pancreas 2004; 28:374–379. 16 Fujiki K, Ishiguro H, Ko SBH, Mizuno N, Suzuki Y, Takemura T, Yamamoto A, Yoshikawa T, Kitagawa M, Hayakawa T, Sakai Y, Takayama T, Saito M, Kondo T, Naruse S: Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis. J Med Genet 2004;41:e55. 17 Nakamura Y, Ohmori T, Higuchi S, Maruyama K: Certain background factors exhibit an association with an increased risk for pancreatic calcification among Japanese male alcoholics. Pancreas 2005; 31:225–231. 18 Whitcomb DC, Gorry MC, Preston RA, Furey W, Sossenheimer MJ, Ulrich CD, Martin SP, Gates LK Jr, Amann ST, Toskes PP, Liddle R, McGrath K, Uomo G, Post JC, Ehrlich GD: Hereditary pancreatitis is caused by a mutation in the cationic trypsinogen gene. Nat Genet 1996;14:141–145. 19 Howes N, Greenhalf W, Stocken DD, Neoptolemos JP: Cationic trypsinogen mutations and pancreatitis. Clin Lab Med 2005;25:39– 59. 20 Teich N, Mossner J: Genetic aspects of chronic pancreatitis. Med Sci Monit 2004; 10: RA325–RA328.
Pancreatology 2009;9:173–181
21 Witt H, Luck W, Hennies HC, Classen M, Kage A, Lass U, Landt O, Becker M: Mutations in the gene encoding the serine protease inhibitor, Kazal type 1 are associated with chronic pancreatitis. Nat Genet 2000; 25:213–216. 22 Witt H, Luck W, Becker M, Böhmig M, Kage A, Truninger K, Ammann RW, O’Reilly D, Kingsnorth A, Schulz HU, Halangk W, Kielstein V, Knoefel WT, Teich N, Keim V: Mutation in the SPINK1 trypsin inhibitor gene, alcohol use, and chronic pancreatitis. JAMA 2001;285:2716–2717. 23 Lempinen M, Paju A, Kemppainen E, Smura T, Kylanpaa ML, Nevanlinna H, Stenman J, Stenman UH: Mutations N34S and P55S of the SPINK1 gene in patients with chronic pancreatitis or pancreatic cancer and in healthy subjects: a report from Finland. Scand J Gastroenterol 2005; 40:225–230. 24 Tukiainen E, Kylanpaa ML, Kemppainen E, Nevanlinna H, Paju A, Repo H, Stenman UH, Puolakkainen P: Pancreatic secretory trypsin inhibitor (SPINK1) gene mutations in patients with acute pancreatitis. Pancreas 2005;30:239–242. 25 Kume K, Masamune A, Mizutamari H, Kaneko K, Kikuta K, Satoh M, Satoh K, Kimura K, Suzuki N, Nagasaki Y, et al: Mutations in the serine protease inhibitor Kazal Type 1 (SPINK1) gene in Japanese patients with pancreatitis. Pancreatology 2005; 5: 354–360. 26 Lee KH, Ryu JK, Yoon WJ, Lee JK, Kim YT, Yoon YB: Mutation analysis of SPINK1 and CFTR gene in Korean patients with alcoholic chronic pancreatitis. Dig Dis Sci 2005; 50: 1852–1856. 27 Cohn JA, Mitchell RM, Jowell PS: The role of cystic fibrosis gene mutations in determining susceptibility to chronic pancreatitis. Gastroenterol Clin N Am 2004; 33:817–821. 28 Lyon E, Miller C: Current challenges in cystic fibrosis screening. Arch Pathol Lab Med 2003;127:1133–1139. 29 Bruno MJ: Current insights into the pathogenesis of acute and chronic pancreatitis. Scand J Gastroenterol 2001; 36(suppl 234): 103–108.
da Costa et al.
30 Whitcomb DC: Value of genetic testing in the management of pancreatitis. Gut 2004; 53:1710–1717. 31 Cichoz-Lach H, Partycka J, Nesina I, Celinski K, Slomka M, Wojcierowski J: Genetic polymorphism of alcohol dehydrogenase 3 in alcohol liver cirrhosis and in alcohol chronic pancreatitis. Alcohol Alcohol 2006; 41:14–17. 32 Verlaan M, te Morsche RH, Roelofs HM, Laheij RJ, Jansen JB, Peters WH, Drenth JP: Glutathione S-transferase Mu null genotype affords protection against alcohol induced chronic pancreatitis. Am J Med Genet 2003; 120A:34–39. 33 Ockenga J, Vogel A, Teich N, Keim V, Manns MP, Strassburg CP: UDP glucuronosyltransferase (UGT1A7) gene polymorphisms increase the risk of chronic pancreatitis and pancreatic cancer. Gastroenterology 2003; 124:1802–1808.
CFTR Polymorphisms in Patients with Alcoholic Chronic Pancreatitis
34 Bendicho MT, Guedes JC, Silva NN, Santana GO, dos Santos RR, Lyra AC, Lyra LG, Meyer R, Lemaire DC: Polymorphism of cytokine genes (TGF-beta1, IFN-gamma, IL-6, IL-10, and TNF-alpha) in patients with chronic pancreatitis. Pancreas 2005; 30:333– 336. 35 Cuppens H, Lin W, Jaspers M, Costes B, Teng H, Vankeerberghen A, Jorissen M, Droogmans G, Reynaert I, Goossens M, et al: Polyvariant mutant cystic fibrosis transmembrane conductance regulator genes. The polymorphic (Tg)m locus explains the partial penetrance of the T5 polymorphism as a disease mutation. J Clin Invest 1998; 101: 487–496.
36 Nakamura Y, Ohmori T, Ishikawa A, Kobayashi Y, Imazeki H, Higuchi S, Maruyama K: Homozygous (TG)11 allele in intron 8 of the cystic fibrosis transmenbrane conductance regulator (CFTR) gene has a protective role against bicarbonate decrease in pure pancreatic juice among Japanese male alcoholics. Intern Med 2004; 43:1131–1137. 37 Ammann RW: Diagnosis and management of chronic pancreatitis: current knowledge. Seiss Med Wkly 2006;136:166–174. 38 Hill AB: The environment and disease: association or causation? Proc R Soc Med 1965;58:295. 39 Vantyghem MC, Moussaïd-Guennoun R, Perimenis P, Marcelli-Tourvieille S, Perez T, Wallaert B: Cystic fibrosis diabetes in adult. Ann Endocrinol (Paris) 2005; 66:347–354. 40 Gaia E, Salacone P, Salmin P, Brusco A, Bacillo E, Arduino C: Differences in clinical manifestations in patients with chronic pancreatitis and mutations of CFTR, SPINK1 e PRSS1 genes. J Pancreas 2004; 6:521.
Pancreatology 2009;9:173–181
181